ID: 970399387

View in Genome Browser
Species Human (GRCh38)
Location 4:15703137-15703159
Sequence GTTCCCCGATGGCGGCCCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970399387 Original CRISPR GTTCCCCGATGGCGGCCCAG GGG Exonic
900485036 1:2918607-2918629 CTTCCCCGCTGGTGGCCCTGGGG + Intergenic
903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG + Intronic
903385955 1:22926671-22926693 GTTCCCCAGTGCCGGCACAGTGG + Intergenic
905647176 1:39632955-39632977 GTTCCCCGACGGCCGCCGCGAGG - Intronic
905819615 1:40979592-40979614 GTTCAGCGGAGGCGGCCCAGCGG + Exonic
905964539 1:42081148-42081170 GTACCCAGAAGGTGGCCCAGTGG + Intergenic
910592983 1:88947635-88947657 GTTCCCTGATGGGGCTCCAGGGG - Intronic
913205490 1:116534514-116534536 CTTCCTCGCCGGCGGCCCAGCGG - Intronic
1076374320 10:129973117-129973139 GGTGCCCGTAGGCGGCCCAGCGG + Intergenic
1078937426 11:15964138-15964160 TTTCCATGATGGAGGCCCAGAGG + Intergenic
1079128421 11:17734559-17734581 GTTCCCCGAGGGCGGACCGTGGG + Intergenic
1084959926 11:72711078-72711100 GGTCCCCGATGGCAGCCACGTGG + Exonic
1087145597 11:94807855-94807877 GTTCCCAGATTGCGACCCAGTGG + Intronic
1087146060 11:94812851-94812873 GTTCCCAGATTGCGACCCAGTGG - Intronic
1096580230 12:52580368-52580390 GTGCCCAGATGGGGGCCTAGTGG - Intergenic
1104916598 12:132268785-132268807 GCTCCCTGATGGCCGCCGAGGGG - Intronic
1105943605 13:25171434-25171456 CTTCCCCGACGGCGGCTCGGCGG + Exonic
1109867247 13:68281557-68281579 GTTGCCCGCTGGTGGCTCAGGGG + Intergenic
1116030695 14:39567878-39567900 CTTCCCCAAAGGCTGCCCAGGGG - Intergenic
1125536020 15:40441498-40441520 GTTCCCCGATGGCGGGACCGTGG - Intronic
1129799556 15:78403784-78403806 CTTCCCCGGTGGCTGCCCAGAGG + Intergenic
1133036387 16:3036356-3036378 GCTCCCCTAGGGCGGCTCAGGGG + Intronic
1136293157 16:29287844-29287866 GTTCCCTGCTGGTGGCACAGAGG + Intergenic
1142099041 16:88261851-88261873 GTTCCCTGCTGGTGGCACAGAGG + Intergenic
1147028488 17:37609647-37609669 GGGCCCAGCTGGCGGCCCAGTGG + Intergenic
1147991214 17:44334567-44334589 GTTCTCAGATGTGGGCCCAGGGG + Intergenic
1158014746 18:52770992-52771014 TTTCCCCTGTGGAGGCCCAGTGG - Intronic
1160981996 19:1820433-1820455 GTTCCCCGCTGGAGGCCTTGTGG - Intronic
1161652915 19:5496321-5496343 GTTCAGGGATGGGGGCCCAGTGG + Intergenic
1163021372 19:14482640-14482662 GGTCCCTGATGGTGGACCAGAGG - Intronic
928090428 2:28370522-28370544 CTTCCCAGGTGGTGGCCCAGAGG - Intergenic
948059894 2:235034995-235035017 GTTTCGAGATGGCGGCTCAGCGG + Exonic
1175722334 20:61294718-61294740 CTTTCCCCAGGGCGGCCCAGAGG - Intronic
1176331665 21:5553964-5553986 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176396092 21:6266987-6267009 GGTCCTCGATGCTGGCCCAGCGG + Intergenic
1176441065 21:6722117-6722139 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176465327 21:7049186-7049208 GGTCCTCGATGCTGGCCCAGCGG - Intronic
1176488888 21:7430964-7430986 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1179087371 21:38229292-38229314 GTTCCCCGATGGCATGCCTGAGG + Intronic
1180674948 22:17580753-17580775 GTGCCCTGGTGGCGGCCCATGGG + Intronic
1182692920 22:32176241-32176263 GTTCCACGAGGGCGTCCCAGAGG + Intergenic
968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG + Intergenic
970399387 4:15703137-15703159 GTTCCCCGATGGCGGCCCAGGGG + Exonic
970834613 4:20387665-20387687 GTTCCCAGATGGAGGCCCACGGG + Intronic
973293209 4:48490284-48490306 GTGCGCCCATGGCGGCCCTGGGG + Exonic
981782532 4:148444359-148444381 GTTGCCCGCTGGCGGCCCTGGGG - Intronic
983010254 4:162537858-162537880 GTACCCCGATTCCTGCCCAGAGG + Intergenic
985650204 5:1104052-1104074 GGTCCCCGACCGCAGCCCAGAGG - Intronic
994367002 5:98928437-98928459 GTGCCCAGGCGGCGGCCCAGCGG - Intronic
997740904 5:136252867-136252889 GGTACCAGTTGGCGGCCCAGGGG + Intronic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1019670645 7:2276303-2276325 CATCCCCGACTGCGGCCCAGAGG + Intronic
1020075162 7:5253050-5253072 ATTCCCCGACGGCTTCCCAGTGG - Intergenic
1026482459 7:70790414-70790436 GGTCCCGGATGGGGTCCCAGTGG - Exonic
1034938236 7:155213533-155213555 GGTCCCTCATGGAGGCCCAGAGG + Intergenic
1035063943 7:156091867-156091889 GCTCCCTGAAGGCTGCCCAGGGG + Intergenic
1047203830 8:122787677-122787699 CTTCCCTGTTGGGGGCCCAGGGG + Intronic
1047325855 8:123835160-123835182 GTTTCCTGATGGCTCCCCAGCGG + Intergenic
1049391832 8:142375565-142375587 GTGCACCGAAGGCTGCCCAGTGG - Intronic
1053122333 9:35556396-35556418 GTCCCCAGATGGCAGCTCAGAGG + Exonic
1057448769 9:95137970-95137992 GATCCCAGGCGGCGGCCCAGAGG + Intronic
1057869945 9:98709519-98709541 GTTCCACGAAGGCGTCCCAGAGG + Intergenic
1203430434 Un_GL000195v1:86370-86392 GGTCCTCGATGCTGGCCCAGCGG + Intergenic
1191216238 X:57934549-57934571 GTTCCCCCAGGGCGCGCCAGTGG + Intergenic