ID: 970399406 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:15703230-15703252 |
Sequence | GGGCGCGCGCGCGGTGGCGC GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 625 | |||
Summary | {0: 1, 1: 0, 2: 10, 3: 94, 4: 520} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
970399395_970399406 | 27 | Left | 970399395 | 4:15703180-15703202 | CCAGCTGCTGCTGCAGCTTCTGC | 0: 1 1: 7 2: 130 3: 417 4: 1671 |
||
Right | 970399406 | 4:15703230-15703252 | GGGCGCGCGCGCGGTGGCGCGGG | 0: 1 1: 0 2: 10 3: 94 4: 520 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
970399406 | Original CRISPR | GGGCGCGCGCGCGGTGGCGC GGG | Exonic | ||