ID: 970399406

View in Genome Browser
Species Human (GRCh38)
Location 4:15703230-15703252
Sequence GGGCGCGCGCGCGGTGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 10, 3: 94, 4: 520}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970399395_970399406 27 Left 970399395 4:15703180-15703202 CCAGCTGCTGCTGCAGCTTCTGC 0: 1
1: 7
2: 130
3: 417
4: 1671
Right 970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG 0: 1
1: 0
2: 10
3: 94
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970399406 Original CRISPR GGGCGCGCGCGCGGTGGCGC GGG Exonic
900096000 1:940352-940374 GGCCGCTAGCGCGGGGGCGCTGG + Intronic
900166614 1:1246544-1246566 GGACGCGCTGGCGGTGGCGTTGG + Exonic
900349633 1:2228406-2228428 GGGCCCGCGAGCGTTGGCGTTGG + Intergenic
901019106 1:6246944-6246966 GGGCGGGCGCGCGGGGGGACAGG + Intergenic
901109772 1:6785439-6785461 GGGCGGGTGCGCGGCGGCGGCGG + Exonic
901242868 1:7704958-7704980 GGGCGCGCGCGGGGCGGGGGCGG + Intronic
901433883 1:9234724-9234746 GGGGGCGCGCGCGGCGGGGGCGG - Intergenic
901506515 1:9689228-9689250 CGGCGCGCGCACGCTGGCTCTGG - Intronic
901526092 1:9824116-9824138 GGGAGCGCGCGCGGCGGACCCGG + Exonic
902089642 1:13893089-13893111 CGGCGCTCGCGCGGGGACGCGGG + Intergenic
902400833 1:16155857-16155879 GGCCGCGGCCGCGGCGGCGCAGG - Exonic
902476739 1:16692469-16692491 GGGCGGGCGGGCGGTGGCGGCGG + Intergenic
902590359 1:17469544-17469566 GGGGCCGGGCGCGGTGGCTCAGG + Intergenic
902920692 1:19664834-19664856 GGGCGCACGCTCCGCGGCGCGGG + Intergenic
903078102 1:20787325-20787347 GGGGGCGCGCGCGGGGCCGCGGG - Intergenic
903597019 1:24502809-24502831 GGGCGCGCGCACGGCGGCGCAGG - Intronic
903614458 1:24642060-24642082 GGGGCCGGGCGCGGTGGCTCAGG + Intronic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
904528847 1:31155131-31155153 GGGCGCGGGCGCGGGGCCGGAGG + Intergenic
904563391 1:31413318-31413340 CGGCGCGCGCGGGCGGGCGCCGG - Intronic
905121551 1:35686027-35686049 GGGGCCGGGCGCGGTGGCTCAGG + Intergenic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
907278145 1:53328139-53328161 GGGAGCGCGCGCGCTGGCGGCGG - Intergenic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
908534758 1:65067153-65067175 GAGCGCGGGGGCGGCGGCGCGGG - Intergenic
910288200 1:85577104-85577126 GGGCGCGCGGGCGGGGTGGCCGG + Intronic
912514667 1:110210400-110210422 GGGCGGGCGCGAGGTGGCATAGG - Intergenic
912685005 1:111755576-111755598 CGGCGAGAGGGCGGTGGCGCCGG + Exonic
913323519 1:117606609-117606631 GTGCGCGCCCGCGGGAGCGCCGG - Intronic
913962991 1:143353793-143353815 GGGCGCGCGGGCGGAGGTGCGGG + Intergenic
914057346 1:144179378-144179400 GGGCGCGCGGGCGGAGGTGCGGG + Intergenic
914121800 1:144786988-144787010 GGGCGCGCGGGCGGAGGTGCGGG - Intergenic
915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG + Exonic
915557495 1:156668675-156668697 GGGCGGGCGGGGGGTGGCGGGGG - Intergenic
916651666 1:166839609-166839631 GTGCGCGCGGGCGGGGGCGGCGG + Intronic
916651770 1:166839902-166839924 GGGCGCGGCGGCGGTGGCGCAGG + Intronic
916749885 1:167714334-167714356 GGGCGCGGGCGGGGCGCCGCCGG + Intergenic
918237583 1:182595544-182595566 GGGGCCGGGCGCGGTGGCTCAGG - Intergenic
920357660 1:205386583-205386605 GGGGCCGGGCGCGGTGGCTCAGG - Intronic
921029698 1:211326758-211326780 GGGCGCGGGCGGAGGGGCGCGGG - Intronic
921603981 1:217135518-217135540 GGGCGCGCGCGCGGCGGCGGCGG + Intronic
921934877 1:220787028-220787050 GGGCCTGACCGCGGTGGCGCTGG + Exonic
922196475 1:223364194-223364216 GAGCGCGCGGGCGGGGGAGCTGG - Intronic
922925405 1:229343079-229343101 GGGAGCGCGCGTGGAGGCTCCGG - Intronic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
923008004 1:230067377-230067399 GGGGGCGCGGGCGGCGGCGCCGG + Exonic
923055897 1:230425931-230425953 GGGCGCGCGGGCGGCGGCCGGGG - Intergenic
923299737 1:232630147-232630169 GGGCGGGCGGGCGGTGGCATCGG - Intergenic
923372660 1:233328344-233328366 GGCCGCGAGGGCGGCGGCGCGGG - Exonic
923400760 1:233614037-233614059 GGGCGGGCGCGCGGGGGAGCGGG + Exonic
923506591 1:234610241-234610263 GAGCGCGCGCGCGGGAGGGCGGG - Intergenic
923684139 1:236142391-236142413 GGGCGCGCGGGCCGGGGCGGGGG + Intergenic
923684149 1:236142411-236142433 GGGCGCGCGGGCCGGGGCGGGGG + Intergenic
924199009 1:241640376-241640398 GGCCCGGCGCGCGGTAGCGCGGG - Intronic
924199052 1:241640500-241640522 GGACGCGCCCGCGGGGGGGCGGG - Intronic
924436594 1:244048660-244048682 GGGAGCGAGCGCGGAGCCGCCGG - Intergenic
1062874124 10:931582-931604 GGGCGGGCGCGAGCTGGCGGCGG + Exonic
1062874255 10:932075-932097 AGGGGCGCACGCGGTGGCGGAGG - Intergenic
1063582909 10:7325247-7325269 GGGTGGGGGCGCGGTGGCTCAGG - Intronic
1064418233 10:15168722-15168744 GGGCGCGGGCGGGGCGGGGCGGG - Intergenic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1065533685 10:26697943-26697965 GGGGGCGCGCGGGGTAGCTCCGG + Intronic
1065712826 10:28533498-28533520 GGGCGCGCAGGCGGCGGCGGCGG - Exonic
1066370459 10:34814997-34815019 GGGCCCGCCCGCGGCGGCGGCGG - Exonic
1067071759 10:43137898-43137920 GGCCGTGCTCGCGGTGGCGTGGG + Intergenic
1068545078 10:58335444-58335466 GGGCCCGCGCGCGTTCGCGCCGG + Intronic
1070198030 10:74176834-74176856 GGACGCGGGCGCCGTGGCGCTGG + Intronic
1071573701 10:86711435-86711457 GGGCGGGCGCGCGCTGGAGTCGG + Intronic
1072021830 10:91410270-91410292 GGGCTCGCGCGCAAAGGCGCGGG + Exonic
1073306045 10:102504181-102504203 GGCCGGGGGCGCGGTGGGGCCGG - Exonic
1073478762 10:103772365-103772387 GGGCGCGGGGGCGGTGAGGCAGG + Intronic
1075031887 10:119029601-119029623 GGGCGCGGGCGAGGTGGCCGGGG + Intergenic
1075693751 10:124418774-124418796 GGGCGGGCGCGGGGTGGCCGCGG - Intronic
1076792879 10:132786103-132786125 GGGCGGGCGGGCGGCGGCGGCGG + Intergenic
1077010083 11:375780-375802 GGGGGCCCGCGCGGGGGCGAGGG + Intronic
1077076885 11:706086-706108 GGGCGGGCGCGCGGGGGAGGAGG - Intronic
1077090764 11:777297-777319 GGGCGCGCGTCACGTGGCGCCGG - Intronic
1077250054 11:1556992-1557014 GGGGGAGCGCGCGGGGGAGCCGG + Exonic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1080503771 11:32893168-32893190 GGGGGCGCGGGCGGCGGCGGCGG - Exonic
1081528848 11:43944374-43944396 GGGTGCGCGCTCGCTGTCGCGGG + Intergenic
1081831914 11:46121547-46121569 GGGGGCGCGCACGGCGGCGGCGG - Intergenic
1081938151 11:46918619-46918641 GGGCCCAGGCGCGGTGGCGGTGG - Exonic
1083039091 11:59668960-59668982 GGACCCGCGCGCGGAGGAGCCGG - Exonic
1083171987 11:60928637-60928659 GGGCGCCTGCGTGGTGGAGCTGG + Exonic
1083431018 11:62613482-62613504 GGCAGCGGGCGCGGTGGCTCTGG + Exonic
1083657001 11:64234604-64234626 GGGCGGGCGGCCGGTGGCGGCGG - Exonic
1083766671 11:64844711-64844733 GGGCGCGCTGGCGGCGGCGGAGG - Intergenic
1083995225 11:66268452-66268474 GGGAGTGGGCGCGGAGGCGCGGG + Intergenic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1084146155 11:67266435-67266457 GGGCGCGCGGGCGGCGGCGGCGG + Exonic
1084146261 11:67266836-67266858 GGGCGCCCGCGGGGTCGGGCCGG - Intronic
1084517014 11:69642760-69642782 GGCGGCGTGCGCGGCGGCGCGGG - Intronic
1085641617 11:78196530-78196552 AGGCGAGCGCGCGGGGGCCCGGG - Exonic
1086724632 11:90167267-90167289 GGGCCCGCCCTCGGAGGCGCCGG + Intronic
1086887744 11:92224602-92224624 GGGCGCGCGGGAGGGGGCGGCGG - Intergenic
1088223174 11:107591041-107591063 GGGCGCGGGCGCGGTGCTGGGGG - Intergenic
1088462173 11:110093323-110093345 GGGCGGGCGCGGCTTGGCGCGGG + Intergenic
1090788362 11:130069616-130069638 GGGCGTGCGCGCGGCGGGTCTGG - Intergenic
1090788590 11:130070389-130070411 GGGCGGGCGCCCGGGGGCACTGG - Intronic
1091286572 11:134411774-134411796 CGGGGCGCCCGCGGGGGCGCGGG + Intronic
1091558671 12:1594423-1594445 GGGCGTGGGCGCGGCGGCGCGGG - Intronic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1091823113 12:3491077-3491099 GGGGGCGGGCCCGGGGGCGCTGG + Intronic
1092045943 12:5431983-5432005 GGGCGCGCGCGGCGCGGCGCGGG + Intergenic
1092270450 12:7018954-7018976 GGGCGCGCGAAAGGCGGCGCGGG - Intronic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092843344 12:12562962-12562984 GGGGGCGGGCGCGCGGGCGCGGG - Intergenic
1093435323 12:19129669-19129691 GGGCGCGCGCGGGGGCGCGCCGG + Intergenic
1093894694 12:24562752-24562774 GGGCGCGGGGGCGGTGCCGGGGG + Intergenic
1093894792 12:24563205-24563227 GGGCGCGCGCGGGGGGCTGCGGG + Intergenic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094051670 12:26226984-26227006 GGGCGGAGGCGCGGTGGCCCCGG - Intronic
1094564984 12:31591019-31591041 GGGCTCGCGCGCGGCGGGTCCGG + Exonic
1095349189 12:41188884-41188906 GGGCGCGCGCGGGGGGCCGCCGG + Exonic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096337057 12:50764408-50764430 GGGGTCGCGCGCGGTGGTGGCGG + Intronic
1096435908 12:51591098-51591120 GGGGGCGCGCGCGGAGGGGTAGG + Intronic
1096459480 12:51814366-51814388 GGGCACGCGGGCGGCGGCGCCGG + Intergenic
1096460876 12:51821001-51821023 GCGCGCGCCCTCGGCGGCGCCGG + Intergenic
1096460925 12:51821201-51821223 GGGCGCGCTCAAGGCGGCGCTGG - Intergenic
1096482412 12:51951570-51951592 GGGGGCGCGCGCGGCGGCCGCGG + Intergenic
1096482447 12:51951678-51951700 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
1096495464 12:52037172-52037194 GGCCGCGGGCGCGGGGGCGGGGG + Intronic
1096647635 12:53047332-53047354 GGGCGGGGGCGCGGCGGGGCGGG - Intronic
1096647681 12:53047439-53047461 GGGCGGGCGCCAGGGGGCGCGGG + Intronic
1096710632 12:53452629-53452651 GGGCGCGCGCGCGGTAGGGGGGG + Intronic
1096769762 12:53927724-53927746 GGGCGGGCGGGCGGTGGCTAGGG - Intergenic
1097033226 12:56104549-56104571 GAGCGCGCGGGCTGAGGCGCAGG - Exonic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1098425846 12:70365766-70365788 GGGCTGGCGCGCGGTGGTGCCGG - Intergenic
1100565323 12:95789845-95789867 GGGCGCGCGTGGGCTGGGGCCGG - Intronic
1100869398 12:98894871-98894893 GGGGGCGCGCGCGCGGGCCCGGG - Intronic
1101892823 12:108731558-108731580 GGGCCTACGCGCGGTGGCGGGGG - Intronic
1102278392 12:111599519-111599541 GGGCGGGCGCGCCGAGGCGCCGG + Exonic
1102375715 12:112419290-112419312 GGGTGGGGGCGCGGTGGGGCCGG - Intronic
1102854127 12:116278029-116278051 GGGCGCGCCCGTGGTGGCCGCGG + Intergenic
1103758817 12:123233134-123233156 GGGCGCGCGCGCGCTCCCTCGGG - Exonic
1104046714 12:125168361-125168383 GGGGCCGGGCGCGGTGGCTCAGG + Intergenic
1104568420 12:129904361-129904383 GCGCGGACGCGCGGTGGCGGCGG + Intergenic
1104854298 12:131894888-131894910 GGGCGCGGGGCCGGGGGCGCGGG - Exonic
1105472081 13:20703763-20703785 GGGGGCGCGCGGGCCGGCGCCGG + Intronic
1105517594 13:21104382-21104404 GGGAGCGCGAGCTGGGGCGCGGG + Intergenic
1106109041 13:26760828-26760850 GGGCGCGCGCGGGGCGGGGGCGG - Intergenic
1106516973 13:30464811-30464833 GGGTGCGGGCGCGGCGGCGGCGG + Intronic
1106776695 13:33016371-33016393 GGGCGGGCGCGGCGGGGCGCGGG + Intergenic
1107058559 13:36131453-36131475 GGGCGCGCACGCGGAGGAGGAGG - Intergenic
1107467546 13:40664822-40664844 GCGGGCGCGGGCGGTGGCGGTGG - Intronic
1107851485 13:44576788-44576810 GGGCGGGCGCGCAGAGACGCCGG + Intronic
1108408305 13:50125434-50125456 GGGGGCGGGCGCGGCGGCGCGGG - Intronic
1109506198 13:63306065-63306087 GGGACCGGGCGCGGTGGAGCAGG - Intergenic
1112290903 13:98143394-98143416 GGCCGAGGGCGCGGCGGCGCCGG - Intronic
1112752558 13:102597220-102597242 GGGCCCGGGCGCGGGGGCGCGGG + Intronic
1113473216 13:110561536-110561558 GGGAGAGGGCGCGGGGGCGCTGG - Exonic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113541930 13:111115703-111115725 GGGGGCGCGGGCGGGGGCGCGGG - Intronic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1113660465 13:112103841-112103863 GGGGGCGGGGGCGGGGGCGCGGG + Intergenic
1113779726 13:112969180-112969202 GGGGGCGCGCGCTGCGCCGCGGG - Intronic
1113917778 13:113884428-113884450 GGGCCAGCGCGCGGGGGCGCCGG + Intergenic
1114485240 14:23057888-23057910 GGGCGAGCGCGCGGTGAGGTGGG + Intergenic
1114516185 14:23301726-23301748 GAGCGCGCGCGTGGTGGACCTGG - Exonic
1115474567 14:33800606-33800628 GGGGGCGGGGGCGGCGGCGCGGG + Exonic
1116824456 14:49658355-49658377 GGGGCCGGGCGCGGTGGCTCAGG - Intronic
1116950149 14:50872077-50872099 GAGGGCGGGCGCGGTGCCGCCGG + Intronic
1117119708 14:52553622-52553644 GGGCGGGTGCGCGGGGCCGCCGG + Intronic
1117402059 14:55367459-55367481 GGGGCCGGGCGCGGTGGCTCAGG + Exonic
1117547838 14:56808031-56808053 GGGGGCGCGGGCAGTGGAGCGGG - Intronic
1118621682 14:67619866-67619888 GGGCGGGCGGACGCTGGCGCGGG + Exonic
1119219371 14:72893602-72893624 GGCCGCGGGCTCGGGGGCGCGGG + Intronic
1120866184 14:89297279-89297301 GGGGCCGGGCGCGGTGGCTCAGG + Intronic
1121616993 14:95319929-95319951 GGGCGCGGGCGGGGCGGGGCGGG + Intergenic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122275120 14:100587200-100587222 GGGCGCGGGCGCGGGCGCGGAGG - Intronic
1122300145 14:100726871-100726893 GGCGGCGCGCGCGGCGGCGGCGG + Exonic
1122582054 14:102777314-102777336 GGGCGCGCGCGGGGGGCCGGCGG + Intergenic
1122736601 14:103847268-103847290 GGGCGGGCGGGAGGTGGCGGCGG - Intronic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1123004451 14:105314677-105314699 GGGCGCGCGCGGGGCGGCCGGGG + Exonic
1123024041 14:105415228-105415250 AGCCGCGCGGGCGGGGGCGCGGG + Intronic
1123037942 14:105478905-105478927 GGGCACGCGCGGGCTGGGGCTGG + Intronic
1123630711 15:22258127-22258149 GGGCGCGCGCGGGGCGCCGTAGG - Intergenic
1124014219 15:25862606-25862628 GAGCGAGCGCGCGGTGGCGCAGG - Intronic
1124922219 15:34038606-34038628 GGGGGCGCGCCTGGTGGCGGGGG - Intronic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1125429413 15:39580726-39580748 GAGGGCCCGCGGGGTGGCGCAGG - Intergenic
1127142620 15:55993359-55993381 GGGAGCGCGCGAGGCGCCGCGGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127931645 15:63600988-63601010 CGGCGGGCGCGCGCGGGCGCGGG - Intronic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1129710714 15:77819169-77819191 GGCCGCGCGCGCCGCGCCGCCGG + Intronic
1129894188 15:79091414-79091436 GGGTGCACGGGGGGTGGCGCCGG - Intergenic
1131233598 15:90677580-90677602 GGGGCCGGGCGCGGTGGCTCAGG - Intergenic
1131515351 15:93073166-93073188 GGGCGCGCGGGGGGCGGCGCGGG - Intronic
1131517483 15:93088942-93088964 CGGCCCGCGGGGGGTGGCGCTGG + Intronic
1132498780 16:275746-275768 GGGGGCGCGCGGGGCGGGGCGGG - Intronic
1132560227 16:590128-590150 GGGCGCGGGCGGGGCGGGGCCGG + Intronic
1132585957 16:705836-705858 GGGGGCGCGCGCGGCGCCGGCGG - Intronic
1132642741 16:985139-985161 GGGGGCGGCCGGGGTGGCGCTGG - Exonic
1132683854 16:1154155-1154177 GGCCGGGCGCGCGGGGGTGCAGG + Intronic
1132741294 16:1414576-1414598 GGGCGCGGGCGGGGGGCCGCAGG + Intronic
1132828895 16:1918138-1918160 GGGGGCCGGCGCGGGGGCGCGGG + Exonic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134539953 16:15056082-15056104 GGCAGCGCCCGCGGTGGGGCGGG - Intronic
1134587909 16:15428042-15428064 GGGCTCGGGGGCGGTGGCGGGGG + Intronic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1135034855 16:19068368-19068390 GAGCCCGGGCGCGGTGGCTCCGG + Intronic
1135691211 16:24539515-24539537 CGGCGCGCGCGAGGCGGGGCTGG - Intronic
1135745840 16:25015405-25015427 GGGCGGGCGGGCGGTGCCACTGG - Intronic
1136399871 16:30011441-30011463 GCGCGCGCGGGCGGGGGCGGGGG - Intronic
1137300537 16:47144040-47144062 GGGCGCGCGAGGCGCGGCGCGGG - Intergenic
1137531762 16:49282407-49282429 GCGTGCGCGCGCGGCGGGGCGGG + Intergenic
1138450776 16:57092572-57092594 GGGCGGGCGGGCGGCGGCGGCGG - Exonic
1139644311 16:68316984-68317006 GGGCGGGCGGGCGGTGGAGGGGG + Intronic
1140442635 16:74999293-74999315 GGGCGGGCGCGGGGAGGCGCCGG - Exonic
1141972343 16:87492452-87492474 GGGCGCGCGCGGGGCGCCGGGGG + Intergenic
1141972497 16:87492898-87492920 GGGCCCGAGCGCGGCGGCGGCGG + Intergenic
1141989638 16:87602659-87602681 GGGCCCGCGGGCGGCGGCGGCGG - Intronic
1142429746 16:90019569-90019591 GGGCGCGCGCGGGCCGGGGCGGG - Intronic
1142863348 17:2776607-2776629 GGGCGCGCCCCGGGTGGCGGAGG + Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143183488 17:4997900-4997922 GCGAGCGCGCGCGGAGGGGCGGG - Intergenic
1143212262 17:5197097-5197119 GGGCCCTGGCGCGGTGGCTCAGG - Intergenic
1143747270 17:9003590-9003612 GGGCGCGGGCGCGGCAGGGCCGG - Intergenic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147743154 17:42680008-42680030 GGGGGCGAGCGCCGTGGCGCAGG - Exonic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1147900283 17:43779058-43779080 GAGCGCGGGCGCCGTGACGCGGG + Intergenic
1147990005 17:44326802-44326824 GCACGCGCGGGCGGTGGCGGAGG + Intergenic
1147994632 17:44354049-44354071 GGGGGCGCGGGCGGCGGCGGCGG + Exonic
1148284058 17:46372676-46372698 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148284092 17:46372782-46372804 GGGCGCGCGCGCGGCGGGGGCGG + Intergenic
1148306279 17:46590597-46590619 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148306313 17:46590703-46590725 GGGCGCGCGCGCGGCGGGGGCGG + Exonic
1149799813 17:59557003-59557025 GGGACCGGGCGCGGTGGCTCAGG + Intergenic
1151296914 17:73192845-73192867 GGGCGGGCGCGAGGGGGCGGGGG - Intronic
1152103565 17:78316341-78316363 GGGCGAGTGCGTGGTGGAGCAGG + Intergenic
1152357353 17:79813560-79813582 GGGCGGGCGGGCGCTGTCGCCGG + Intergenic
1152541914 17:80981135-80981157 GGGCGCGGGGGCGGGGGCACGGG - Intergenic
1152551993 17:81034767-81034789 AGGCGGGGGCGGGGTGGCGCAGG - Intergenic
1152581187 17:81166236-81166258 GAGCGCGCGCGGAGCGGCGCGGG + Intergenic
1152708932 17:81860584-81860606 GCGCGCGCGGGCGGGGGGGCAGG - Exonic
1152923988 17:83079423-83079445 GGGCGCGGGCGCCGGGGCGGGGG - Intergenic
1153688116 18:7566933-7566955 GGCCGCGCCCGCGGGGTCGCAGG + Exonic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1154073681 18:11178455-11178477 GGGGCCGGGCGCGGTGGCTCAGG - Intergenic
1154241612 18:12658143-12658165 GGGCGGGCGCTGGGCGGCGCTGG - Intronic
1154996003 18:21640917-21640939 GGGGCCGGGCGCGGTGGCTCAGG - Intergenic
1156099675 18:33578492-33578514 AGGCGCGCGGGCGGTGGCGGCGG - Intergenic
1156275780 18:35581677-35581699 GGGGGCGGGCGCGGCGGAGCGGG + Intronic
1157610104 18:48950614-48950636 CGGGGCGCGCGCGGGGGCCCGGG + Exonic
1158954145 18:62523560-62523582 GGGCCCGCGGGCGGCGGCGGCGG - Exonic
1160164299 18:76496152-76496174 GGGCGGGCGCGCGGGGGCGGGGG + Intronic
1160204503 18:76822283-76822305 GGGCGCATGCGCGGCGCCGCGGG - Exonic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1160204518 18:76822323-76822345 GGGCGCGGGCGCGGGCGCGGTGG - Intergenic
1160204582 18:76822520-76822542 GGGCGCGCACGCGCGGGCACCGG - Intergenic
1160453035 18:78978795-78978817 GGGCGCGGGCGCGGCGACGACGG + Intergenic
1160499790 18:79395996-79396018 GGGCGCGGGCACCGGGGCGCGGG + Intronic
1160500714 18:79400127-79400149 GCGCGCGCGCGAGGGGGCGGGGG + Intronic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160680340 19:409215-409237 GGGGGCGCGGGCGCGGGCGCGGG - Intergenic
1160719168 19:590015-590037 GGGGGCGCGGGCGGCGGCGGCGG - Exonic
1160719182 19:590054-590076 GGGGGCGCGGGCGGCGGCGGCGG - Exonic
1160726796 19:620982-621004 GGGGGAGGGCGCGGGGGCGCCGG + Intronic
1160864074 19:1249535-1249557 GGGCGCGCCCCGGGGGGCGCGGG - Intronic
1160873142 19:1286002-1286024 GGTCGCGCGCGCGGAGGCGGGGG + Intergenic
1160896942 19:1407560-1407582 GGGCGGCGGCGCGGCGGCGCGGG + Intronic
1160907266 19:1457216-1457238 GGGCCCGAGGGAGGTGGCGCCGG + Exonic
1160921865 19:1524368-1524390 GGGCGCGCGTCCGGAGCCGCGGG + Intronic
1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG + Intergenic
1160996685 19:1885310-1885332 GGGGGCGGGCGCGGCCGCGCGGG - Intronic
1161118130 19:2510949-2510971 GGGGCCGGGCGCGGTGGCTCAGG - Intergenic
1161207206 19:3047301-3047323 GGGCGGGCGGGCGGAGGCGCGGG - Intronic
1161264779 19:3359282-3359304 GTGCGCGCGCGCCGCGGCGAAGG + Intergenic
1161265373 19:3361149-3361171 GTTCGGGCGCGAGGTGGCGCCGG + Intronic
1161461567 19:4400590-4400612 GGGGGCGCGCGCGGGGGCCGGGG - Intergenic
1161753004 19:6110834-6110856 GGTCGCGCGCGCGGCGCCGTGGG + Intronic
1162562409 19:11424214-11424236 GGGCGCGGGGGCGGTGGCTGTGG + Intronic
1162733790 19:12734587-12734609 GGCCCCGCGGGCGGTGGCGGTGG - Exonic
1162909910 19:13842988-13843010 GGGCGGGCGCGGGGCGGGGCAGG + Intergenic
1162954504 19:14090787-14090809 GGGCGCGCGTGCGGCGGCGGCGG - Intronic
1163027158 19:14518852-14518874 GGGCTCCCGCCCGGTGACGCCGG + Intronic
1163117323 19:15196285-15196307 GGGAGGGCGAGCGGTGGGGCCGG - Intronic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163607240 19:18281932-18281954 GGGCGGGCGCCTGGTGGCCCGGG - Intergenic
1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG + Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1164692680 19:30222736-30222758 GGCCGCGCTCCCGGTGGCCCGGG - Intergenic
1165058531 19:33194141-33194163 GGGCGCGGGCGGGGCGGGGCTGG + Intronic
1165079997 19:33301681-33301703 GCGCCCGCGCTCGGTGCCGCCGG - Exonic
1165349523 19:35268525-35268547 CTGCGCGCGCGCGGCGGCGGCGG - Intergenic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1165349924 19:35269726-35269748 GGGCGGGCGGGCGGGCGCGCCGG + Intronic
1165745983 19:38229626-38229648 GGGCCCGCGCGCGGCGGCAGCGG - Intronic
1165803114 19:38565123-38565145 GGGCGCGGGCGCGGCGGAGGCGG + Exonic
1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG + Intergenic
1166064327 19:40348323-40348345 GGGCGCGGGCCCGGTGGGCCAGG - Intronic
1166371177 19:42302176-42302198 GGGGGCGCGGGGGGTGGCTCAGG - Intronic
1167001201 19:46746511-46746533 GGGCGCGCGCGCGGTGGTTGCGG - Exonic
1167036204 19:46996381-46996403 GGGGCCGGGCGCGGTGGCTCAGG - Intronic
1167072771 19:47230534-47230556 GGGCGCGCGCCCGCTGGGGGCGG - Intronic
1167134529 19:47608989-47609011 GGGCGCGCGGGCCTGGGCGCGGG + Intronic
1167293668 19:48637476-48637498 AGGGGCGCGCGCTGTGGCGTCGG - Intergenic
1167368090 19:49065082-49065104 GGGCGGGGGCGGGGCGGCGCCGG + Intergenic
1167792021 19:51689094-51689116 GGGCGGGCGAGCGGGAGCGCCGG + Intergenic
1168247035 19:55117589-55117611 GGGCGGGCGGGTGGTGGCGGCGG - Intergenic
1168293002 19:55366116-55366138 GGGGGCGCCAGCGGGGGCGCCGG + Exonic
1168305619 19:55433542-55433564 GCGCGCGCGCCTGGTGTCGCAGG - Exonic
1168336526 19:55600356-55600378 GTGCGCGCGCGCGGGGGCAACGG - Intronic
1202696830 1_KI270712v1_random:132051-132073 GGGCGCGCGGGCAGAGGTGCGGG + Intergenic
1202710754 1_KI270714v1_random:18293-18315 GGGCGGGCGGGCGGGGGCGGCGG + Intergenic
925005723 2:441666-441688 GGGCAAGCGCGTGGTGGAGCAGG + Intergenic
925609797 2:5693163-5693185 GGGAGCGCGGGCGGAGGCGCGGG + Exonic
925730598 2:6917517-6917539 GCGCGGGCGCGGGGAGGCGCGGG + Exonic
927213198 2:20651115-20651137 GGGCGGGGACGCGGTGACGCGGG - Intergenic
927714210 2:25341907-25341929 GGGCGCGCGGGCGGCGGCGGCGG - Intronic
928186469 2:29115475-29115497 GGGCGCGCGCGCAGTGCAGGCGG - Exonic
929075736 2:38077289-38077311 GGGCGCGCTTGCGGTCGCGAAGG + Intronic
929808666 2:45169952-45169974 GGGCGTGCGGGCCGCGGCGCGGG - Intergenic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
931253853 2:60554151-60554173 GGGAGCGAGCGCGGCGGCGGCGG - Intergenic
931348970 2:61471282-61471304 GGGCGAGCGCGCGGAGGGGGTGG - Intergenic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
933791827 2:85889098-85889120 GGCCGCGCGCCCGGGGGCGGGGG - Intergenic
933902901 2:86861987-86862009 GGGACCGGGCGCGGTGGCGGCGG + Intergenic
934277986 2:91589065-91589087 GGGCGCGCGGGCGGAGGTGCGGG + Intergenic
934746143 2:96760947-96760969 GGGGCCGCGCGGCGTGGCGCGGG + Exonic
934846387 2:97663778-97663800 GGGGGCGCACGCGGCGGCGCAGG - Intronic
935137818 2:100322491-100322513 GGACGCGCGCGCAGTCGCGCAGG - Exonic
935301661 2:101698144-101698166 GGGCCCGCGAGCGGGCGCGCGGG + Intronic
935971506 2:108534412-108534434 GGCCGGCCGCGCGGGGGCGCGGG - Intronic
936452841 2:112646178-112646200 GGGCGCGGACGCCGTGGCGCTGG + Intronic
936512163 2:113157340-113157362 AGGCGGGCGGGCGGCGGCGCAGG - Intronic
937221734 2:120346046-120346068 GGGCGGGCGGGCGGAGGCCCGGG + Intergenic
937221973 2:120346901-120346923 GGACGCGCGCCCAGAGGCGCTGG - Intronic
937439826 2:121906302-121906324 GGGGGTGGGGGCGGTGGCGCGGG - Intergenic
938258352 2:129877758-129877780 GGGCGCGCGTGTGGGGGGGCGGG + Intergenic
938258366 2:129877797-129877819 GGGCGCGCGTGTGGGGGGGCGGG + Intergenic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938338996 2:130523052-130523074 GGGGGCGCGGGAGTTGGCGCCGG + Intronic
938350842 2:130597698-130597720 GGGGGCGCGGGAGTTGGCGCCGG - Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
939153803 2:138501753-138501775 GCGCGTGCGCGCGGCGGCGGCGG - Intergenic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
942799741 2:179861446-179861468 GGGCGGGCGTGCGGCGGGGCCGG - Exonic
943669862 2:190649081-190649103 CGGCGCGCGGGCGGCGGCGGCGG - Intronic
944725768 2:202469762-202469784 GGGGCCGGGCGCGGTGGCTCAGG - Intronic
945297223 2:208182680-208182702 GGGGCCGGGCGCGGTGGCTCAGG - Intronic
946281665 2:218670412-218670434 GGGGCCGGGCGCGGTGGCTCAGG + Intronic
946286906 2:218710867-218710889 GGGCGCGCGCGGTGTGTGGCAGG + Exonic
947353633 2:229271305-229271327 CGGCGAGCGCGCGGCGGCGGCGG + Intergenic
947549899 2:231038225-231038247 GCGCGGGCGGGCGGTGGCTCGGG + Intronic
948046856 2:234951939-234951961 GGGGGCGGGGGCGGGGGCGCGGG - Intergenic
948046916 2:234952082-234952104 GGGGGCGCGCGCGGCTCCGCGGG - Intronic
948492226 2:238320848-238320870 GGGCCCGGGCCGGGTGGCGCCGG + Intronic
948609640 2:239158711-239158733 GGGCGGGTGCGCGGTGGGGCGGG - Intronic
949014529 2:241702016-241702038 GCGCGGGCGGGCGGTGCCGCGGG - Intronic
949040079 2:241844033-241844055 GGTCGGGGGCGCGGGGGCGCGGG + Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079860 2:242088451-242088473 GGGCGGGGGCGGGGGGGCGCAGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1169262574 20:4149129-4149151 GGGCGCTCGGGCGGGGGTGCGGG + Intronic
1169278455 20:4248794-4248816 GGGGGCGCGGGCGGCGGCGGCGG - Exonic
1169758605 20:9068387-9068409 GGGGGCGCACGGGATGGCGCTGG - Intergenic
1172404450 20:34677170-34677192 GGGTGGGCGCGCGCTGCCGCTGG + Intergenic
1173411111 20:42810009-42810031 GGGGCCGGGCGCGGTGGCTCAGG + Intronic
1173649049 20:44651552-44651574 GTGAGCGCGCGCGGGGGCTCCGG - Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1173843658 20:46174837-46174859 GGGGGCTCGGGCGGGGGCGCGGG - Exonic
1174467865 20:50731430-50731452 GTGCGCGCGCGCGGGCTCGCGGG + Intergenic
1174494575 20:50930797-50930819 GGGTCCGCGCGCGGCGGCGCCGG + Intronic
1175030342 20:55947294-55947316 GGGGACGGGCGCGGTGGCTCAGG + Intergenic
1175562044 20:59939257-59939279 AGGCGGTGGCGCGGTGGCGCGGG - Exonic
1175847304 20:62065549-62065571 GGGCGCGCCCGGAGCGGCGCCGG - Exonic
1175847476 20:62066124-62066146 GGGCGCGGGCGCCGGGGCGGTGG + Intergenic
1175859625 20:62143382-62143404 GGGCGCGGGCGTAGTGGCGCCGG - Exonic
1175911505 20:62407318-62407340 CGGCGGGCGCGCGGGCGCGCGGG - Intergenic
1175983896 20:62754861-62754883 GGACGCGCACGCCGTGCCGCAGG - Exonic
1176005862 20:62861919-62861941 GGGCGTGCGGGCGGTTGGGCGGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176207094 20:63895102-63895124 GGGAGCGCGCGCGCCGGTGCGGG + Intergenic
1176547891 21:8209278-8209300 GGGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176549957 21:8216880-8216902 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176567882 21:8396419-8396441 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176568883 21:8399914-8399936 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176575786 21:8440638-8440660 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176576797 21:8444149-8444171 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1179444227 21:41420286-41420308 GGGGGCGCGGGCGCGGGCGCGGG + Intronic
1179512049 21:41879482-41879504 GGGCGCGCGCGGGGCGGGTCTGG + Exonic
1179882662 21:44300024-44300046 AGGCGCGCGCGGGGCGGGGCGGG + Intergenic
1180014748 21:45074750-45074772 GGGCGCGCGTGCGGAGGACCAGG + Intronic
1180064290 21:45405049-45405071 GGGCGGGCGCGGGGCGGGGCCGG - Intergenic
1180259775 21:46661448-46661470 TGGGGCGGGCGCGGTGGCGCCGG + Intronic
1180782400 22:18528601-18528623 GGAGGCGCGCGAGGCGGCGCGGG + Exonic
1181094324 22:20495534-20495556 GGGCGCGGGCGCGTAGGGGCCGG - Intronic
1181162046 22:20965147-20965169 GGCCGCGGGCGCGGGGGGGCGGG - Exonic
1181239289 22:21467936-21467958 GGAGGCGCGCGAGGCGGCGCGGG + Intergenic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182237006 22:28883820-28883842 GGCCGCGGGGGCGGCGGCGCAGG - Exonic
1182532129 22:30968867-30968889 CGGCGCGCGGGCGGCGGCGGAGG - Intergenic
1182586343 22:31346160-31346182 GCGCACGGGGGCGGTGGCGCGGG + Exonic
1182903912 22:33920611-33920633 GGGCGCGGGGCCGGGGGCGCGGG + Intronic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183683637 22:39349798-39349820 GGGCGCGCGTGCTGCGGCCCGGG - Intergenic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1184035144 22:41914658-41914680 AGGCGCGGGCCCGATGGCGCGGG - Exonic
1184086910 22:42270716-42270738 GGGAGGGCGCGCGGCGGGGCGGG + Intronic
1184164857 22:42720989-42721011 GGGCGCGCGGGCGGGGTCGCGGG - Intronic
1184523001 22:45007086-45007108 GGGCGCGCGGCCGGGGGCGGGGG + Intronic
1184523797 22:45009848-45009870 GGGCGCGCGCGGGGCTGCGCGGG - Intronic
1184663577 22:45976436-45976458 GGGCGCGCGGGCGGTCCGGCCGG - Intronic
1185037932 22:48489460-48489482 GGGCCCGGGCGCGGCGGCGGCGG + Exonic
1185322304 22:50207403-50207425 GGGGCCGGGCGCGGTGGCTCAGG - Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203254847 22_KI270733v1_random:133206-133228 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203262903 22_KI270733v1_random:178285-178307 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
949089562 3:11434-11456 GAGGGCGCGCGCGCCGGCGCAGG + Intergenic
949292823 3:2485289-2485311 GGGCGGGCACGCGGTGGCACGGG + Intronic
949501585 3:4685158-4685180 GGGCGCGCACGCCGTGGTGCTGG + Exonic
949993744 3:9600680-9600702 GGGCGGGGGCGCTGGGGCGCTGG + Intergenic
950087662 3:10272009-10272031 GGGGGCGGGCGCAGTGGCTCAGG - Intronic
950438520 3:12994257-12994279 CGGCGCACGGGCGGTGGGGCGGG - Intronic
950710559 3:14810597-14810619 GGGCGCGAGCGCGGGGGCGGCGG - Intergenic
951544481 3:23810795-23810817 GGGCGCGCGCGGGGTGGGGGCGG + Intronic
951558860 3:23946027-23946049 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
951640600 3:24830445-24830467 GTGCGCGCGCGCCGTGGCTAAGG + Intergenic
952706191 3:36380402-36380424 GGCCGCGGGCGCGGCGGGGCGGG + Exonic
952867067 3:37861655-37861677 GGCCGCGCGCGCGGGGGCCCGGG - Intergenic
953705142 3:45225509-45225531 GGGCGCCCCGGCGGTGGCGGCGG + Exonic
954367815 3:50155520-50155542 GGGCGCCCGGGCGGCGGCGGCGG - Exonic
959462504 3:106644107-106644129 GGGAGCGGGCGCGGGGGAGCAGG - Intergenic
959539497 3:107523537-107523559 GGGCACGGGCGCCGGGGCGCGGG + Intronic
960223766 3:115146984-115147006 GGGCGCGGGCGGGGCGGGGCGGG + Intronic
961545297 3:127629141-127629163 GGCCGCGCGGGCGGCGGCGGCGG - Intergenic
962277910 3:134029817-134029839 GGCCGGGCGCGGAGTGGCGCGGG + Exonic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
965558134 3:170038073-170038095 GGGAGCGCGCGGGGCGGGGCGGG + Exonic
966355190 3:179071963-179071985 GGCCGCGAGCGCAGGGGCGCGGG + Exonic
966874519 3:184314758-184314780 GGGCGCCGGGGCGGCGGCGCAGG - Intronic
967055488 3:185825562-185825584 GGGAGCGCGCGAGGGGGCGACGG + Intergenic
968051463 3:195657912-195657934 GGACCCGCGGACGGTGGCGCTGG - Intergenic
968302654 3:197628011-197628033 GGACCCGCGGACGGTGGCGCTGG + Intergenic
968508977 4:987138-987160 GGCCGCGCCCCCGGTGGCCCCGG + Exonic
968514715 4:1011351-1011373 GGGCGCGCGGGCGGGGCCGGGGG + Intronic
968640621 4:1712667-1712689 GGCCGCGCGCGACGCGGCGCAGG + Intergenic
968831403 4:2934464-2934486 GGGGGCGCGCGGGGTGGGGGCGG - Intronic
968831459 4:2934594-2934616 GGGCGCGCGGGGTGTGGGGCTGG - Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
969032751 4:4227271-4227293 GGGCGCGCGGGCGGAGGTGCGGG - Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
970593236 4:17577391-17577413 GGGCGGGCGCGCCTTGGGGCGGG - Exonic
970967881 4:21948854-21948876 GGGGGCGCGCGGGGTGGCGGGGG + Intergenic
971196298 4:24473460-24473482 GGACACGCGCGCGGGGGGGCTGG - Intergenic
972533051 4:39977569-39977591 GGGCGGGCGGGCGGCGGCGGCGG - Exonic
972686854 4:41360597-41360619 GGGAGCGAGCGCGGAGGCGCCGG - Intronic
972793703 4:42397132-42397154 GGGCGCGCGAGTGGAGACGCTGG - Intergenic
972920202 4:43929864-43929886 GGGGCCGGGCGCGGTGGCTCAGG - Intergenic
973907602 4:55546783-55546805 GGGAGCGCTCGCGGCGGCGGCGG + Intronic
974424200 4:61719882-61719904 GGGGGCGGGAGCGGTGGCTCAGG - Intronic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
975701981 4:77075641-77075663 GGGGGCGCGGGCGCGGGCGCTGG + Exonic
975778927 4:77819523-77819545 GGGCTCGCGGGCGGGCGCGCAGG + Intronic
977937854 4:102827161-102827183 GGGCGCGCGCGGGAGCGCGCTGG - Intronic
978754261 4:112285827-112285849 GGCCGCGCGCGCGGGAGCGCGGG - Exonic
983919809 4:173333826-173333848 CGGGGCGCGGGCGGGGGCGCGGG - Intronic
984167447 4:176319908-176319930 GGGCGCGCGCGCGCTCGCGTCGG + Intergenic
984966364 4:185143509-185143531 GGGCGCGGGCGCGGCGGGCCGGG + Intronic
985995619 5:3595647-3595669 GGGCGCGCGCGTCGGGGCGGCGG - Intergenic
986297071 5:6448683-6448705 GGGCAAGCGCGCGGCGGAGCTGG + Exonic
986813627 5:11385042-11385064 GAGCCCCCGCGCGGCGGCGCGGG + Exonic
987340448 5:16935475-16935497 GGCGGCGCGCGCCGGGGCGCGGG - Intronic
989178893 5:38556739-38556761 GGGGGCGCGCGGGTTGGGGCGGG - Intronic
992304697 5:75424298-75424320 GGGGCCGAGCGCGGTGGCTCAGG + Intronic
993726949 5:91380226-91380248 GGGCGCGCGGGCGGCAGCGGCGG - Intronic
994367111 5:98928818-98928840 GAGCGCGCGCGCGACGGCGGCGG - Exonic
995342299 5:111073208-111073230 GAGCCCGAGCGCGGAGGCGCCGG - Intronic
997265169 5:132490981-132491003 GGGCGGGCCCGCGGTGGCCCCGG - Intergenic
997582966 5:135028714-135028736 GGGCGCGGGCGCGGGCGCGGAGG - Exonic
997963274 5:138338390-138338412 GGCCGCGCGGGCGGTCGGGCTGG - Intronic
998130288 5:139648334-139648356 GGGCGGGCGCGCGGCGGCGGCGG + Exonic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998353003 5:141513330-141513352 GGGCGGGGGCGGGTTGGCGCCGG + Intergenic
998583232 5:143402759-143402781 GGGCTCGCGCTCGGGCGCGCCGG + Intronic
999252358 5:150190364-150190386 GGGCACGAGGGCGGGGGCGCTGG + Intronic
999696235 5:154190637-154190659 GGGCCCGGGGGCGGTGGCGGCGG + Intronic
1000643806 5:163737470-163737492 GGGGCCGGGCGCGGTGGCTCAGG + Intergenic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1002487610 5:179550519-179550541 GGGCGGGCGCGGGGTGGGGGCGG - Intergenic
1002691373 5:181053008-181053030 GGGGGCGCGCGCGGCGGAGGGGG - Intronic
1002691383 5:181053032-181053054 GGGAGCGCGCGCGGCGGAGGGGG - Intronic
1002928645 6:1619297-1619319 GGGGGCGCGCCCGGTGTCCCGGG + Intergenic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003175765 6:3751561-3751583 GGGCGGGCGGGCGGCGGGGCTGG - Exonic
1003645417 6:7910254-7910276 GGGCGCGGGCGCCGCGGCTCGGG - Intronic
1004043991 6:12009260-12009282 GGGGGCGGGCAGGGTGGCGCGGG + Intronic
1004069728 6:12287754-12287776 AGGCGCGCGCGCGCGCGCGCAGG + Intergenic
1004627977 6:17394094-17394116 GGCCGGGCGGGCGGCGGCGCTGG - Intronic
1005303840 6:24495289-24495311 GGCAGCGCGCACGGCGGCGCGGG - Exonic
1005864263 6:29926578-29926600 GGGCCCGCGCACTGGGGCGCAGG + Intergenic
1005964878 6:30720285-30720307 GGGCGCGCGTGCGCCGGGGCTGG - Exonic
1006271991 6:32972088-32972110 GCGCGCGCGCGCGGAGGGGGTGG + Exonic
1006369221 6:33633828-33633850 GGGCGGGCGCGGGGCGGGGCCGG + Intronic
1006606251 6:35259741-35259763 GGGCGGGCGGGCTATGGCGCAGG + Exonic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1007623525 6:43229249-43229271 GGGCGCGCGCGGTGAGGCCCTGG - Exonic
1008013246 6:46491008-46491030 GGGGGCGGGGGCGGTGGCGGGGG - Intronic
1011226611 6:85114979-85115001 GGGGGCGGGGGCGGGGGCGCCGG + Intergenic
1012245787 6:96924493-96924515 GGGAGCGAGCGCGCTGGCGGCGG + Intergenic
1013170831 6:107635083-107635105 GGGGGCGCGGGCGGCGGCGGCGG - Exonic
1013619286 6:111872883-111872905 GGCGGCGTGCGCGGGGGCGCCGG + Intronic
1014913376 6:127118841-127118863 GGGCGGGCGAGCGGCGGCGGCGG - Exonic
1015626036 6:135181568-135181590 GGGGGCGCGCGGGGGCGCGCGGG + Intronic
1015842346 6:137488917-137488939 GTCCGCGCTCGCGGTGGCCCCGG - Intergenic
1015898484 6:138039701-138039723 AGGCCCGGGCGCGGTGGCTCAGG - Intergenic
1019111928 6:169724012-169724034 GGGGGCCCGCGCGGCGGCGGCGG - Exonic
1019491583 7:1316270-1316292 GGGGGGGCACGCGGTGGGGCTGG + Intergenic
1019562534 7:1665780-1665802 GGGCGCGGGCGCAGTGGTGGCGG - Intergenic
1019562567 7:1665878-1665900 GGGCGAGCGCGGGGCGGCGGCGG - Intergenic
1020278231 7:6637287-6637309 GGGCGCGGGCGGGGCGGGGCCGG + Intergenic
1021454877 7:20819071-20819093 GGGGCCGGGCGCGGTGGCTCAGG + Intergenic
1023937264 7:44748863-44748885 GGGCGGCGGCGCGATGGCGCGGG + Intronic
1024043793 7:45574378-45574400 GGGCGCGCGCGCGGGGCAGCCGG + Intronic
1024043823 7:45574465-45574487 CGGGGCGCGGGCGGCGGCGCCGG - Intronic
1026000350 7:66556272-66556294 GGGCGCGGGCGCGGGCGCGAGGG - Intergenic
1026850323 7:73719573-73719595 GGGCGGCCGCGCGCTGGGGCCGG + Intronic
1026850375 7:73719747-73719769 GGGCCCGGGCGGGGTGGGGCGGG - Intergenic
1029238728 7:99143810-99143832 GGGCTGGGGGGCGGTGGCGCTGG - Exonic
1029363182 7:100101424-100101446 TGGCCCGCACGCAGTGGCGCCGG - Exonic
1029496326 7:100896993-100897015 GTGCGCGCGCGCGGCGGTGCGGG + Intergenic
1029814006 7:103075287-103075309 GGGCGCGGGCTGGGTGGCGGCGG + Exonic
1030033358 7:105388579-105388601 GGGGGCGCCCGCGGCCGCGCAGG - Intronic
1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG + Intergenic
1031919065 7:127588349-127588371 GGGCGGGCCCGCGGTGACGTCGG + Exonic
1031986544 7:128167693-128167715 GGGCGCCGGCGAGGTGGCGAGGG + Intergenic
1034179574 7:149126763-149126785 TGGGGGGCGCGCGGTGGCCCGGG + Intronic
1034347649 7:150397202-150397224 GGGCGCCCCCGCGGCGGCCCCGG - Exonic
1034418801 7:150978414-150978436 TCGGGCGCGCGCGGTGGGGCGGG - Intergenic
1035169516 7:157009899-157009921 GGGGGCGCGCAGGGCGGCGCGGG - Exonic
1035265157 7:157686004-157686026 GGGCGACCGCGCGGGGCCGCGGG + Intronic
1036068295 8:5409704-5409726 GGGGCCGGGCGCGGTGGCTCAGG - Intergenic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1036930488 8:12951597-12951619 GGGCTGGCGCGCGGCGGAGCCGG - Intronic
1037825302 8:22156823-22156845 GGGCGCGCGCGGGGCGGCGCGGG + Exonic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038035364 8:23682478-23682500 GGGCGCGCGCGTGGCTGCGGAGG + Intronic
1038204959 8:25457903-25457925 GGGCGCGGGGACGGGGGCGCGGG - Intronic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1039493587 8:37965336-37965358 GGCCGGGCGGGCGGCGGCGCAGG + Exonic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1039843259 8:41308527-41308549 GGGCGGGCGTAGGGTGGCGCGGG + Intronic
1039843398 8:41309201-41309223 GGACGCGCGCGGGGAGGCGGCGG - Exonic
1039903261 8:41767655-41767677 GGGGGTGCGCGCGGGGGCGCGGG + Intronic
1040032974 8:42842956-42842978 GGGCGCGCGGCCGGCGGGGCCGG - Intronic
1041068159 8:54101907-54101929 GAGCGTGCGCCCGGTGGGGCCGG - Exonic
1041108825 8:54467014-54467036 GGGGGCGCCCGCAGTGTCGCTGG + Intergenic
1041505828 8:58596646-58596668 GGGGCCGAGCGCGGTGGCTCAGG + Intronic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1041690374 8:60680362-60680384 CGGGGCGGGCGCGGCGGCGCGGG + Intronic
1042903028 8:73746963-73746985 GGGCGCGGGAGCGGCTGCGCAGG - Intronic
1044692901 8:94896271-94896293 GGGCGCGCTGGCGGCGGCGGCGG - Intronic
1044840540 8:96333260-96333282 AGGAGCACACGCGGTGGCGCGGG - Intronic
1045336110 8:101205598-101205620 CGGCGGGCGCGCGGCGGCGGCGG - Intronic
1045488524 8:102653855-102653877 GGAAGCGCGGGCGGAGGCGCGGG + Intronic
1045663970 8:104466631-104466653 GGGCGGGGGCGCGGCGGGGCGGG + Intronic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1047961750 8:130016316-130016338 GGGCGCGCGCGCGGGCCGGCCGG + Intronic
1048308013 8:133297065-133297087 GGCCGCCCGTGCGGTGCCGCTGG - Exonic
1049405892 8:142451704-142451726 GGCCGCGCGGGCGGAGGCGGGGG + Intronic
1049423839 8:142528554-142528576 GGGCGCGCCCGAGGGGGTGCGGG - Intronic
1049548537 8:143246097-143246119 GGGCGCGCACGCGGTGGCGGCGG + Intergenic
1049724286 8:144138329-144138351 GGGCGCGCGGGCGTTGTAGCCGG - Exonic
1050552130 9:6757949-6757971 CGGCGCGCGCGCCCTCGCGCAGG + Intronic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1055945748 9:81689611-81689633 GGGCGCGAGCGCGGAGCCGGCGG + Intergenic
1056386303 9:86099672-86099694 GGGCGCGCGCACCGTGGGGCCGG - Intronic
1057259744 9:93576934-93576956 GGGCGCGCAGCCGGGGGCGCGGG - Intronic
1057546223 9:96021773-96021795 GGGCGGGAGGGCGGAGGCGCCGG + Intergenic
1057619104 9:96619418-96619440 CGGCGGGCGCGCGGGCGCGCGGG - Exonic
1057758365 9:97854102-97854124 GGGCGCGTGCGCGATGGCCATGG - Exonic
1057869751 9:98708820-98708842 CGGCGCCCGCGCAATGGCGCCGG + Exonic
1058058547 9:100473236-100473258 GGGCGCGCGCGCGGCGGGCGGGG - Exonic
1058885840 9:109320705-109320727 GGGAGAGCGCGCGGCGGCGGCGG - Exonic
1058923595 9:109640759-109640781 CGCCGCGCGCGAGGTGGAGCTGG - Intergenic
1060514576 9:124257917-124257939 GGGCGGGCGCGCGGGCGCGCGGG + Intronic
1060979725 9:127785431-127785453 GAGCGGGCGGGCGGTGGCGGCGG + Intergenic
1061158986 9:128882453-128882475 GGGCTCGCGCGCCGCGGAGCCGG - Intronic
1061415384 9:130444696-130444718 GGGCGCGCCGGCGGGGGCGCAGG - Intergenic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1062022685 9:134326739-134326761 CGGCGCGCGCGGGGGGTCGCCGG + Intronic
1062346771 9:136118610-136118632 GGGCGCGCGGCTGGGGGCGCTGG + Exonic
1062659180 9:137619292-137619314 GGGGGAGCGGGCGGGGGCGCAGG + Intronic
1203793032 EBV:161681-161703 GGGCACGCGGGCGGTGGAGTCGG - Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203470237 Un_GL000220v1:112840-112862 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1203471248 Un_GL000220v1:116351-116373 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203478058 Un_GL000220v1:156812-156834 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1203479069 Un_GL000220v1:160323-160345 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1185747463 X:2584180-2584202 CGGGGGGCGCGCGGGGGCGCGGG + Intergenic
1186441770 X:9593118-9593140 GGGGTCGGGCGCGGTGGCTCAGG + Intronic
1186669961 X:11758204-11758226 CGGAGCGCGCGCGGTGGGGGAGG - Exonic
1186821340 X:13291168-13291190 GGGGGGGCGCGGGGGGGCGCGGG - Intergenic
1187067416 X:15854599-15854621 GGGCGCGCGCGGGGTGGCGGGGG + Intronic
1187648324 X:21374143-21374165 GTGCGCGTGCGCGGCGGCGGAGG - Intergenic
1188007164 X:25023124-25023146 GGGCGCCCGCGAGAGGGCGCAGG + Intergenic
1196001985 X:110795955-110795977 AGGCGCGGGCGCGGCGGCCCGGG + Intergenic
1199772406 X:150983475-150983497 GGGCGCGCTCACGGCGGCGCGGG - Intronic
1200058751 X:153474719-153474741 GGGGGCGGGGGCGGGGGCGCGGG + Intronic
1200058754 X:153474731-153474753 GGGGGCGCGGGCGCTGGCGCGGG + Intronic
1200138514 X:153886187-153886209 GGGCGTGCGCGCAGGGGCGGGGG + Intronic
1200229438 X:154436843-154436865 GGGCGCGCGCGGGGCGGGGCGGG + Intergenic