ID: 970399406

View in Genome Browser
Species Human (GRCh38)
Location 4:15703230-15703252
Sequence GGGCGCGCGCGCGGTGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 10, 3: 94, 4: 520}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970399395_970399406 27 Left 970399395 4:15703180-15703202 CCAGCTGCTGCTGCAGCTTCTGC 0: 1
1: 7
2: 130
3: 417
4: 1671
Right 970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG 0: 1
1: 0
2: 10
3: 94
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970399406 Original CRISPR GGGCGCGCGCGCGGTGGCGC GGG Exonic