ID: 970399737

View in Genome Browser
Species Human (GRCh38)
Location 4:15705684-15705706
Sequence CTACAGAAATGGATGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970399734_970399737 7 Left 970399734 4:15705654-15705676 CCATCTTGGGTAAAACTGTGTTC 0: 1
1: 0
2: 0
3: 14
4: 209
Right 970399737 4:15705684-15705706 CTACAGAAATGGATGGTGCATGG 0: 1
1: 1
2: 1
3: 19
4: 174
970399730_970399737 30 Left 970399730 4:15705631-15705653 CCAGAGATAAGGTAACACCACAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 970399737 4:15705684-15705706 CTACAGAAATGGATGGTGCATGG 0: 1
1: 1
2: 1
3: 19
4: 174
970399733_970399737 13 Left 970399733 4:15705648-15705670 CCACAACCATCTTGGGTAAAACT 0: 1
1: 0
2: 1
3: 6
4: 158
Right 970399737 4:15705684-15705706 CTACAGAAATGGATGGTGCATGG 0: 1
1: 1
2: 1
3: 19
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970399737 Original CRISPR CTACAGAAATGGATGGTGCA TGG Intronic
900338964 1:2178845-2178867 CAGCAGGAATGGATGGTGAAAGG + Intronic
903363642 1:22792813-22792835 CTACAGACAGTGAAGGTGCAGGG + Intronic
904548983 1:31299305-31299327 CTAGAGAAATGTAGGATGCAAGG + Intronic
906002849 1:42442010-42442032 CTACAAATATGGAGGGTGTAGGG + Intronic
906750999 1:48259796-48259818 CTAGAGAAAGGAATGGTCCAGGG - Intergenic
907054823 1:51356338-51356360 CTACAGAACAGGGTAGTGCAGGG + Exonic
907428887 1:54399157-54399179 CTACAGAGATGAATAGTTCACGG + Intronic
908176074 1:61556312-61556334 CTACAGACATGTTTGGTGGATGG - Intergenic
915116063 1:153600520-153600542 ATAAATAAATGGATGGTGGAGGG - Intergenic
918796073 1:188898368-188898390 CAACAGAAATGGATAGGGGAAGG + Intergenic
918976119 1:191488692-191488714 ACATAGAAATGAATGGTGCATGG + Intergenic
919013749 1:192000836-192000858 CTGAAGAAATCGGTGGTGCAAGG + Intergenic
921273585 1:213494139-213494161 CTACAGAAATGGTTGGGACTAGG + Intergenic
921709773 1:218362271-218362293 CTATAAACATGGAAGGTGCATGG + Intronic
922205416 1:223442218-223442240 CTAAGGAAAGGGATGGAGCATGG - Intergenic
1067812885 10:49444163-49444185 CCACAGAAATGTCTGGGGCAGGG - Intergenic
1070736541 10:78867178-78867200 CTGCAGAAGTGCCTGGTGCATGG - Intergenic
1071423994 10:85529787-85529809 CTACAGGGATGGACGGTGCAGGG + Intergenic
1071470448 10:85980435-85980457 CTACAGAAATGACTTGTCCAAGG + Intronic
1071490573 10:86133822-86133844 ATACAGAAACGGATGGTGCCTGG + Intronic
1073568402 10:104555340-104555362 CTACAGAACTGGAAGCTGGAGGG - Intergenic
1074119963 10:110486761-110486783 TTTCAGAAATGGGTGGTGGAGGG - Intergenic
1074271084 10:111954073-111954095 CTTTAGAAATGGATGGTTTAGGG + Intergenic
1075663111 10:124212029-124212051 CCACAGACATGGAGGGTGGAGGG - Intergenic
1076142443 10:128090609-128090631 CCAAAGAAATGTAAGGTGCAGGG - Intergenic
1077384881 11:2264118-2264140 ATGCAGAAAGGGATGGGGCAGGG - Intergenic
1078228435 11:9415541-9415563 CTACAGAAATGGTTGGGGCCGGG + Intronic
1079132571 11:17756136-17756158 CTAGGGAAATGCAAGGTGCAAGG - Intronic
1080133315 11:28822390-28822412 ATACAGAAATGAATGAAGCATGG + Intergenic
1080143711 11:28953657-28953679 ATACAGGCATGGATGGTTCATGG - Intergenic
1084057667 11:66646939-66646961 CTAAACAAATAGATGGTGAAAGG - Intronic
1084654290 11:70506167-70506189 CTACAGACAAGGAAGGTGCTGGG - Intronic
1084678400 11:70650340-70650362 GGACAGAAATGAAAGGTGCAGGG + Intronic
1086105093 11:83138773-83138795 CTAAATAAATGAATGGTGCCAGG + Intergenic
1088021968 11:105130592-105130614 CTACAGGAATGTTTGCTGCAGGG - Intergenic
1090377940 11:126304570-126304592 ATACATAAATGGATGATGAATGG - Intronic
1091360404 11:134974781-134974803 ATCCAGAAAAGGATGGTGCAGGG + Intergenic
1091610993 12:2009038-2009060 CAACAGAAATGGAAGTTACACGG - Intronic
1091721926 12:2820199-2820221 CTCAAGAAATGGATGCTGGAGGG + Exonic
1092116946 12:6016177-6016199 CTTCAGAAATGCATGGTGCCAGG - Exonic
1093817317 12:23565417-23565439 CTACAAAAATGTATGATGCCAGG - Intronic
1098517225 12:71391277-71391299 CTACAAAAATTAATGGGGCATGG + Intronic
1100522152 12:95385499-95385521 CTACCGAAATGCACGGTGGATGG - Intergenic
1100691070 12:97038953-97038975 CTACAGAGATGAAGGCTGCATGG + Intergenic
1102793448 12:115667927-115667949 CTACTGAAAGGGATGATCCAAGG - Intergenic
1104996353 12:132660054-132660076 CTGCAGAAAAGGATGTTGCTCGG + Intronic
1106374007 13:29166170-29166192 CTAGAGAAATAGATATTGCAAGG - Intronic
1108515514 13:51199101-51199123 CTATACAAATGGATTGTGCTGGG + Intergenic
1109412778 13:61995150-61995172 CTAAAGAAATGAATGTTGGAGGG + Intergenic
1112235910 13:97636394-97636416 CTACAGAGATGACTGGGGCATGG + Intergenic
1113766774 13:112886457-112886479 CTAAAGAAATGTAGGATGCAAGG - Exonic
1114415400 14:22539539-22539561 GTACTGGAATGGATGGTACAGGG + Intergenic
1115078121 14:29415635-29415657 CTGCAGAAGTGGGTGGTGGATGG + Intergenic
1115317002 14:32035433-32035455 GTACAGAACTGGAGGGTGGAGGG + Intergenic
1115871434 14:37808261-37808283 CTACAGAAATGGGTGATATAAGG + Intronic
1117200896 14:53388934-53388956 CTAAAAAAATTGATGGAGCATGG - Intergenic
1117779557 14:59218218-59218240 CTACTGTAGTAGATGGTGCAGGG + Intronic
1118916533 14:70112169-70112191 CGAGAAGAATGGATGGTGCAAGG + Intronic
1120285124 14:82490675-82490697 GTACAGAAATTGCAGGTGCAGGG + Intergenic
1120474078 14:84964733-84964755 CTATAACAATGGATGGTACATGG + Intergenic
1120662660 14:87269238-87269260 ATAAAGAAATGGAAGGTGGATGG + Intergenic
1120813786 14:88831774-88831796 CCAGTGAAATGGATGGTGAAAGG + Intronic
1125977768 15:43970750-43970772 CTTCAGAAATAGATGGGGTATGG - Intronic
1127393718 15:58527077-58527099 CTCCAGATATGGGTGGTGAAGGG + Intronic
1128707985 15:69851403-69851425 CTAATTAAATGGAAGGTGCAGGG - Intergenic
1128884970 15:71278339-71278361 GTACAAAAATGTATAGTGCATGG - Intronic
1129273061 15:74429437-74429459 CTGCAGAGATGGAAGGAGCATGG - Intronic
1130404690 15:83587929-83587951 CTGCAGAAGTGGATGCTTCAGGG - Intronic
1136132574 16:28233062-28233084 ATACAGATATGGTTGGTGCATGG - Intergenic
1136395411 16:29989862-29989884 TTAGAGAAATGGACGGTGCAGGG + Intronic
1136606185 16:31335541-31335563 CTACAGACATGGAGGGTGAAAGG - Intergenic
1139595790 16:67957635-67957657 CTACAGAACTGCTTGGGGCAGGG + Intronic
1140273982 16:73492281-73492303 CTACAGAATTGGGTGGTGTGTGG - Intergenic
1140750285 16:78017301-78017323 TTACAGAAAGGGATGGTGACAGG - Intergenic
1144087444 17:11823453-11823475 CAAAAGAAATGAATGGTGAAAGG + Intronic
1146537910 17:33669042-33669064 CTTCAGAGATGGAGGATGCAGGG - Intronic
1149427763 17:56571136-56571158 TTACATAAAATGATGGTGCAGGG - Intergenic
1149656985 17:58315330-58315352 GTAGAGAATTGGATGGGGCATGG - Intronic
1152504452 17:80738355-80738377 CCACAGAAAGGGATGGTGCATGG - Intronic
1152672427 17:81617025-81617047 CTACAGCAATGCAGGGGGCAGGG + Intronic
1152859887 17:82690212-82690234 CTGCAGAATTGGAGGGAGCACGG + Intronic
1152859909 17:82690370-82690392 CTGCAGAATTGGAAGGAGCATGG + Intronic
1152859917 17:82690450-82690472 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859927 17:82690530-82690552 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859939 17:82690610-82690632 CTGCAGAATTGGAGGGAGCATGG + Intronic
1155195581 18:23471059-23471081 ATACAGCAATGAATGGTACAAGG + Intronic
1155952316 18:31927017-31927039 CTACAGAAATTGGTGGGGCAAGG + Intronic
1156224079 18:35085150-35085172 CTACAGAAATACATGCTGTAAGG - Intronic
1156668910 18:39443687-39443709 CTATAAAAATAGATGTTGCAGGG + Intergenic
1160520322 18:79504641-79504663 CCACAGACATGCCTGGTGCAGGG + Intronic
1162787729 19:13046100-13046122 CAACAGGAATGAATGGTGGAAGG - Intronic
1163443120 19:17331573-17331595 CTTCAGAAATTGTAGGTGCAGGG + Intronic
1163816473 19:19467979-19468001 CTACATAAATTGAGGGTGGAGGG + Intronic
1164556991 19:29260916-29260938 CTACTAAAATGGATGGTGTAAGG - Intergenic
1165678151 19:37746351-37746373 ATACAGAAATAAATGGTGGACGG + Intronic
1168494056 19:56835815-56835837 ATACTGAAATGGATGGTGTGAGG + Intronic
925472592 2:4178899-4178921 CTACAAGAATGGATAATGCAGGG + Intergenic
934739478 2:96709376-96709398 CTTGAGAAATGGCTGATGCAGGG - Intronic
935468614 2:103430143-103430165 CTCCAGAAATGAATGATACAAGG - Intergenic
935563046 2:104578108-104578130 CAACAGAAATGTATTCTGCATGG + Intergenic
936120264 2:109736324-109736346 CCAAAGAAATGGAAGGTGCCTGG - Intergenic
938716784 2:134028299-134028321 CTACAGGAAGGGATCTTGCAGGG + Intergenic
938768367 2:134479136-134479158 CAACAGAAATGGATCTTTCATGG - Intronic
939085522 2:137714410-137714432 CAACAGGAAGGGATGGGGCAAGG + Intergenic
940021351 2:149159412-149159434 CCACAGAAATGTATGTTGTAAGG - Intronic
940128866 2:150358935-150358957 TTACCAATATGGATGGTGCAGGG + Intergenic
940163472 2:150740539-150740561 CTACAGAAAGTGATTGTGTATGG + Intergenic
940205013 2:151193131-151193153 ATACAGAAATAAATGGTCCAGGG + Intergenic
942253397 2:174067046-174067068 CTACTGAATTGGACAGTGCAGGG - Intergenic
946928093 2:224645509-224645531 CTAAAGAAATGTATGTTTCAGGG + Intergenic
1169347269 20:4838794-4838816 CTGCAGAGCTGGAAGGTGCACGG + Intergenic
1170230647 20:14043375-14043397 CTAAAGAGATGGATAGGGCAAGG + Intronic
1173471829 20:43329973-43329995 CAAGAAAAATGGATGGAGCAAGG + Intergenic
1173864685 20:46306648-46306670 GTAGAGAAATGGCTGGGGCAGGG + Intronic
1175269612 20:57724580-57724602 CTGCAAAAAGGGATGGTGCTGGG - Intergenic
1176008205 20:62877496-62877518 CTCCAGAGCTGGATGGTGCTGGG + Intergenic
1177450475 21:21259016-21259038 CTTCAGCAATGAATGGGGCAAGG - Intronic
1179119462 21:38529406-38529428 CTACAGAACTTGTTGGTGGATGG + Intronic
1180568371 22:16694666-16694688 CTTCAGAAATGCATGGTGCCAGG - Intergenic
1181106992 22:20581486-20581508 CTACAGAAATGGATGGTCCAGGG + Intronic
1183416125 22:37682993-37683015 GTATAGAAATGCATGGTGCCTGG + Intronic
950175599 3:10871843-10871865 ATGCAGAAATTGGTGGTGCAGGG + Intronic
952217504 3:31292411-31292433 CTACAAATATGGATGGGGCTTGG + Intergenic
952479771 3:33749123-33749145 CTCCAGAAAGGGATGGGGAAGGG + Intergenic
952655929 3:35785452-35785474 CTAGAGGAATGGATCATGCACGG - Intronic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
957799410 3:85055853-85055875 CTACTGAATTGGAAGCTGCATGG + Intronic
958437752 3:94118642-94118664 ATGCAGAAATGGATGTTGCTTGG + Intronic
963485196 3:145927094-145927116 CTACAGAGATGGATGAGGGAGGG + Intergenic
963524262 3:146396521-146396543 CTACACAAATGGTAGGGGCATGG + Intronic
965102438 3:164317389-164317411 ATAGAGAAATGGATTTTGCATGG + Intergenic
965162652 3:165154376-165154398 CTAAGTAAATGGATGGTGGATGG + Intergenic
966236341 3:177705858-177705880 CTACTGAAAGAGATGGTACAGGG + Intergenic
967177910 3:186876820-186876842 CTACAGAAATCAAGAGTGCATGG + Intergenic
967349596 3:188498030-188498052 CTAGGGAAATGGCTGTTGCATGG + Intronic
967453814 3:189657603-189657625 TTAAACAAATGGATGGTACATGG + Intronic
967913590 3:194561783-194561805 GTTAAGAAATGGATGGAGCATGG + Intergenic
968897608 4:3413883-3413905 CTACACACAGGGATGGAGCAGGG - Intronic
969556751 4:7916764-7916786 CAGCAGAAAGGGATGTTGCAAGG + Intronic
970399737 4:15705684-15705706 CTACAGAAATGGATGGTGCATGG + Intronic
972368111 4:38394806-38394828 AAACAGTAATGGATGGAGCAGGG - Intergenic
973866247 4:55116782-55116804 CTTCAGCAATGGATGGAGCCAGG - Intronic
976204825 4:82614794-82614816 CTATAGAAATGCATCCTGCAAGG - Intergenic
977405053 4:96587378-96587400 CTACTAAAATTGAAGGTGCAAGG - Intergenic
977966794 4:103160365-103160387 CTACAGAAATGGCTGCTACATGG + Intronic
981504553 4:145484517-145484539 CTTCAGATATGGGTGGTACATGG + Intronic
982639373 4:157937942-157937964 CAACAGAAATGGTTTGTGGACGG - Intergenic
984331049 4:178319344-178319366 GTGCAGAAATGGGTGGGGCAAGG - Intergenic
985161403 4:187048250-187048272 GTTCAAAAATGGATGGTGCTTGG - Intergenic
985232043 4:187829012-187829034 CTACATAAATGGATTATGGAAGG - Intergenic
986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG + Intergenic
986441231 5:7783631-7783653 AAATAAAAATGGATGGTGCATGG - Intronic
989467585 5:41775117-41775139 TTACAGAATTGGGTGGTGTAAGG - Intronic
989471957 5:41830283-41830305 CTTCAGAAAGGGTTGGTGGAAGG + Intronic
990273448 5:54170754-54170776 ATCCAGAAATAGATGGGGCATGG - Intronic
990591809 5:57273281-57273303 CTAAATAAATGTATGTTGCATGG + Intergenic
996087864 5:119322583-119322605 CTACAGAAATGGGAGCAGCATGG - Intronic
1003069318 6:2932202-2932224 CTGCAGAAATGGCTGTTGCATGG + Intergenic
1004560645 6:16746599-16746621 CTCCAGAAATGGATGTTGTTTGG + Intronic
1006558800 6:34891025-34891047 CTAAATAAATGGATGGTGGATGG + Intronic
1007769514 6:44181306-44181328 CTCAAGAAATGGATGGTAAAGGG + Exonic
1008360461 6:50611314-50611336 CTTAAGAAATGAATGATGCATGG - Intergenic
1013948839 6:115754788-115754810 ATACATAAATGAATTGTGCATGG + Intergenic
1014105696 6:117558284-117558306 CTACAGAAATGGATGGAGGGGGG - Intronic
1016804130 6:148195851-148195873 CAACAGAAATGGATTTTGGAGGG + Intergenic
1022652539 7:32290293-32290315 CTACATAAGTGGCTGGTGGAGGG + Intronic
1023730185 7:43184517-43184539 CTAAAGAAATGGCTGGTGGCTGG + Intronic
1023881217 7:44322758-44322780 CAGCAGAAAAGGATGGGGCAAGG + Intronic
1030000210 7:105051477-105051499 TTAAAGAAATAGATGATGCAGGG - Intronic
1034837124 7:154362914-154362936 CTGCAGTGATGGTTGGTGCAGGG - Intronic
1035992889 8:4511621-4511643 CTACAGAAAGTGATGGTACCAGG + Intronic
1036682635 8:10886578-10886600 CTGCAGAGATTGGTGGTGCAGGG + Intergenic
1040541476 8:48360926-48360948 CTACAGAAAGGGATCCTTCAGGG - Intergenic
1041791983 8:61706668-61706690 CTAGAGAAATGGATGAGGAAAGG + Intronic
1042675388 8:71315379-71315401 CTACAGAATTGTATGGTTCTGGG - Intronic
1042743549 8:72077324-72077346 CTCCAGCAATGGATGGTTGAGGG + Intronic
1042759318 8:72253428-72253450 CTCCAGCAATGGAGGGTGGAGGG + Intergenic
1044590276 8:93907618-93907640 CTAGGTAAATGGATGATGCATGG - Intronic
1045708352 8:104954537-104954559 CTACAGAAATGGATGGAGGGAGG + Intronic
1045941754 8:107746912-107746934 CTAAAGAAATGCATGATGGATGG - Intergenic
1047382532 8:124376491-124376513 CTACAGAAATGGAAGATAGAAGG + Intergenic
1048814614 8:138320698-138320720 ATACAGAGATGAATGGTGCATGG - Intronic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1055984958 9:82048865-82048887 GTATAGAAATGAATGGTGCCTGG + Intergenic
1056040666 9:82662775-82662797 CTACAGAAATGGATACTTGAAGG + Intergenic
1058581961 9:106467994-106468016 CCACAGATATGGATGATGAAAGG + Intergenic
1059295914 9:113270539-113270561 CTACAGAGATGGAGGCAGCATGG + Intronic
1061009000 9:127944344-127944366 CTCCAGCAATGCCTGGTGCAGGG - Intronic
1061036843 9:128118875-128118897 GTACAGGGATGGAGGGTGCAGGG + Intergenic
1061036865 9:128118938-128118960 GTACAGGGATGGAGGGTGCAGGG + Intergenic
1186432894 X:9520153-9520175 CTACATAAAAGGAAGGTGCGGGG - Intronic
1189054742 X:37686716-37686738 CAAGAGAAAAGAATGGTGCATGG - Intronic
1190640697 X:52481203-52481225 CTACAGAAAATGATGGAGCAGGG + Intergenic
1190646975 X:52531662-52531684 CTACAGAAAATGATGGAGCAGGG - Intergenic
1192085339 X:68090756-68090778 CTGCAGACATGGATGGTTGAAGG - Intronic
1198642385 X:138770673-138770695 ATGCAGAGATGGATGGGGCATGG - Intronic