ID: 970400361

View in Genome Browser
Species Human (GRCh38)
Location 4:15711633-15711655
Sequence ATCCACAAGGAGCCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970400361_970400367 -4 Left 970400361 4:15711633-15711655 CCCTCACCAGGCTCCTTGTGGAT 0: 1
1: 0
2: 0
3: 13
4: 143
Right 970400367 4:15711652-15711674 GGATTGAGTGGGAAGAACTGTGG 0: 1
1: 0
2: 2
3: 26
4: 288
970400361_970400368 27 Left 970400361 4:15711633-15711655 CCCTCACCAGGCTCCTTGTGGAT 0: 1
1: 0
2: 0
3: 13
4: 143
Right 970400368 4:15711683-15711705 CTTGTACACATTGTACAGAATGG 0: 1
1: 0
2: 1
3: 23
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970400361 Original CRISPR ATCCACAAGGAGCCTGGTGA GGG (reversed) Intronic
900596178 1:3481195-3481217 ATGCACAGGGGGCCTGGTGCCGG - Intergenic
900931571 1:5741304-5741326 CTCCACCTGGAGCCAGGTGAGGG + Intergenic
901134175 1:6982490-6982512 CCCCATAAGGAGCCTGCTGAAGG - Intronic
901209975 1:7519243-7519265 AGCCTCAAGGAGACAGGTGAGGG - Intronic
905145810 1:35886085-35886107 ATCCCCAAGGAGCCCAGAGAAGG - Intronic
905887009 1:41496842-41496864 CTCCACATGGAGGCTGGTGTGGG + Intergenic
906841743 1:49146756-49146778 CTACACAGGGAGCCTGGTGTGGG - Intronic
907948979 1:59162461-59162483 ATCCAGAAGGAGGCTTCTGATGG - Intergenic
914343938 1:146782102-146782124 ACCCACCAGGAGCCCTGTGAGGG + Intergenic
914686447 1:149984158-149984180 AGGCTCAAGGAGCATGGTGAAGG - Intronic
914843330 1:151265994-151266016 ATACACGAAGGGCCTGGTGAAGG - Exonic
916499473 1:165374588-165374610 TTCCACAGGGAGCTTAGTGAAGG - Intergenic
916858709 1:168779508-168779530 TTCCACAAGGAGACAGGGGAGGG - Intergenic
919467195 1:197936407-197936429 ATCCAGAAGGAGGCTGGGCATGG - Intergenic
919840581 1:201606227-201606249 ATCGACCAGGACCCTTGTGAAGG + Intergenic
920221856 1:204410216-204410238 ATGGAAAAGGAGCCTGGAGAGGG - Exonic
1062895947 10:1103458-1103480 CACCACTAGGAGCCTGGTGCTGG - Intronic
1062901356 10:1149072-1149094 CTCCAGAAGGAGGCTGGAGAGGG - Intergenic
1064417223 10:15160356-15160378 AGGCACAAGGAGCCCGGTGATGG + Intronic
1064527402 10:16271832-16271854 ATTCTCAAGGAGCATTGTGAGGG - Intergenic
1065800058 10:29344029-29344051 CTGCAAAAGGAGCCTGGCGATGG - Intergenic
1067973809 10:51001277-51001299 ATCAAGAAGGAGCCTGGAGGAGG - Intronic
1073912509 10:108362836-108362858 ATCCTCAAGGAGGCTGGTCAGGG + Intergenic
1074863367 10:117530255-117530277 ATTCAGAATGAGCCTGATGAGGG + Intergenic
1075287445 10:121199383-121199405 TTCCATAAGGAGTCTGGTGTTGG + Intergenic
1076009693 10:126977603-126977625 ATACACAAGGAGCCTACTCAGGG + Intronic
1076715915 10:132363611-132363633 AGCCACAGCGAGCCTGGTGCAGG - Intronic
1077217446 11:1400854-1400876 CACCACGAGGAGCCTGGGGAGGG - Intronic
1078382447 11:10857079-10857101 ATCCAAAAGGAGACTGTGGAAGG - Intronic
1080266715 11:30408825-30408847 TTCAACAGGGTGCCTGGTGATGG + Intronic
1081907514 11:46679082-46679104 ATCCAGAAGGAACTTGGTGAAGG + Exonic
1083016226 11:59457190-59457212 ATCCACCAGGAACTTGGGGACGG - Exonic
1084148988 11:67279342-67279364 ACCCACAAGCTGCCTGGTGTGGG + Intronic
1084701349 11:70788185-70788207 ATCCACAATGGCCCTGGTGGGGG - Intronic
1085748596 11:79137500-79137522 ACCCACAAGGTGCTTGCTGAAGG + Intronic
1086263367 11:84968506-84968528 ATCCAGAATGAGCCTTTTGAGGG + Intronic
1087789456 11:102391467-102391489 AACCACAAAGAGCATGGTGTGGG - Intergenic
1089151641 11:116369036-116369058 TTCCACAAGGAGCCGGGTGGTGG - Intergenic
1089704187 11:120265506-120265528 CTCCACTTGGAGCCTGATGATGG - Intronic
1091822042 12:3482795-3482817 GTCCACAATGAGCCTGGTTTTGG + Intronic
1095732231 12:45518746-45518768 ACCCACAGGGAGGCTGATGAAGG - Intergenic
1096413802 12:51395550-51395572 TTCCACACGGTCCCTGGTGAGGG + Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1103056831 12:117828117-117828139 ATCCTCATGGAGTTTGGTGATGG - Intronic
1103850079 12:123927405-123927427 ATCCACAATGAGGCTGTTCAGGG - Exonic
1107241476 13:38239963-38239985 ATCAACAAGAACACTGGTGATGG + Intergenic
1108591449 13:51916547-51916569 AGCCACATGGAGCCAGGTGCTGG + Intergenic
1108946193 13:56028103-56028125 CTCCACACTGAGCTTGGTGATGG - Intergenic
1121245842 14:92460271-92460293 ATCCACAAAGTGGCGGGTGACGG + Intronic
1122272535 14:100574684-100574706 ACCCCCAAGGTGCCTGGAGAGGG - Intronic
1123939264 15:25208935-25208957 CTCCACATTGAGCCTGGTGGGGG + Intergenic
1127006591 15:54577566-54577588 GTCCAGAGGGAGCCTGGAGAAGG - Intronic
1129513698 15:76143465-76143487 AGACACAAGGAGGCTGGAGAGGG - Intronic
1135532666 16:23267880-23267902 AGCCACAAGGAGCATAGTGGAGG + Intergenic
1139518512 16:67465944-67465966 CTTCTCAAGGAGCCTGGGGAGGG - Intronic
1140962895 16:79933897-79933919 CTCTGCAAGGAGCCTGGTGAGGG + Intergenic
1141815920 16:86409180-86409202 CTCCAGAAGGAGCCTGGTAGTGG + Intergenic
1144779609 17:17801212-17801234 ATCCAGATGGAGCCTGGCCATGG + Intronic
1145867954 17:28252890-28252912 ATTCTCTAGGAGCCTGGGGATGG - Intergenic
1147155147 17:38540947-38540969 TTCCACAGGGAGGCTGGTGGCGG + Intronic
1149011014 17:51856325-51856347 ATCCACATGAAAACTGGTGAGGG + Intronic
1149812805 17:59693771-59693793 AACCAAAAGGTGCCTGGGGAGGG - Exonic
1150625482 17:66838459-66838481 CCCCACAAGGAGCCTGGCCATGG - Intronic
1152891364 17:82883461-82883483 AAGCCCAAGGAGCCTGGTGGGGG + Intronic
1154376259 18:13812409-13812431 ATACAAAAGGAGCCTGCTGAGGG - Intergenic
1159295409 18:66480478-66480500 ATCCACAAAGAGTCTGCAGATGG + Intergenic
1159750236 18:72291962-72291984 ATGCAGAAGGAACCTGGAGAAGG - Intergenic
1165958111 19:39514831-39514853 CTGGACAGGGAGCCTGGTGAGGG + Intergenic
925052530 2:828403-828425 CTCCAAAAGGAACCTGGGGAAGG + Intergenic
926965939 2:18410997-18411019 ATACTCAAGGAGCCTGGTGCTGG - Intergenic
927656040 2:24947287-24947309 ATCCACAAGGTTCCTGGAGGAGG - Exonic
928552351 2:32385117-32385139 AATCACAAGGAGAGTGGTGAAGG - Intronic
928938118 2:36701709-36701731 AACAAAAAGAAGCCTGGTGAAGG - Intronic
928952335 2:36824175-36824197 AAAAACAAGGAGCCAGGTGATGG - Intergenic
929143774 2:38688768-38688790 ATTCACAAGGACCCTGGAAAAGG + Intronic
929247263 2:39716179-39716201 ATCCAAAAGGAGCATCTTGAGGG + Intronic
932101916 2:68908874-68908896 ACCCACAAGGAGCCTCCTGAAGG - Intergenic
932328726 2:70884000-70884022 ATGCACAAAGAGCTTGATGAGGG + Intergenic
933242704 2:79941018-79941040 AGCCACAAGAAGCCTACTGAGGG + Intronic
934657108 2:96122173-96122195 ATCCCAATGGAGGCTGGTGACGG + Intergenic
936049673 2:109213488-109213510 ATCTGCAGGGAGCCTGGAGAAGG + Intronic
938146875 2:128841859-128841881 ATACAAAAGGACCCTGCTGATGG - Intergenic
938948170 2:136233266-136233288 ATCAACATGGAGCCTGATAAAGG + Intergenic
939235054 2:139480463-139480485 AAGAACAAGGAGCCTGGAGAAGG + Intergenic
941912014 2:170772718-170772740 ATCCTCAGGGAGCTTGGTGGGGG - Intergenic
943370970 2:187015163-187015185 AACCACCAGAAGCCTGGAGAAGG - Intergenic
947247064 2:228060744-228060766 AGCCACAGAGAGCCTGATGAGGG + Intronic
947373153 2:229468783-229468805 TTACAGAAGGAGCCTGGAGAAGG + Intronic
947837196 2:233184358-233184380 TTCCACAATGTGCCTGGAGATGG - Intronic
1168845379 20:940945-940967 ATACAAAAGGAGTTTGGTGAAGG + Intergenic
1170267108 20:14479060-14479082 ACCCACAAGTATCCTGGTGAAGG + Intronic
1171815034 20:29778421-29778443 ACCCAAACTGAGCCTGGTGATGG + Intergenic
1179025642 21:37676413-37676435 ATCCATCAGGTGCCTGGTGTTGG - Intronic
1179904311 21:44414332-44414354 ATCCACAAGGGCCCTGCTCACGG + Intronic
1181979087 22:26753282-26753304 ATTCAGGAGGAGCCTGGTTAAGG + Intergenic
1184116854 22:42427207-42427229 ATCCACAAGGAGCAAGCAGAGGG + Intronic
1184664909 22:45983181-45983203 GTCCACATGGAGCAGGGTGAAGG - Intergenic
1184675974 22:46043811-46043833 ATGAACAAGGAGCCTGGTTGGGG - Intergenic
1184686330 22:46098057-46098079 AGTCACAAGCAGCCTGGAGATGG + Intronic
1185146045 22:49137243-49137265 ATTCCCAGGGAGCCTGCTGAGGG - Intergenic
950096673 3:10334724-10334746 GGCCACAGGGAGCCTGTTGATGG - Intronic
950197945 3:11022410-11022432 ATACACAAGGATCCAGGCGATGG - Exonic
953062141 3:39435845-39435867 ATCCACACAGGGCCTGGTGAGGG + Intergenic
955010004 3:55004605-55004627 ATGAACAAGGAGCCTGGCAAAGG - Intronic
961818479 3:129563334-129563356 ATCCAAAAGGAGACTGTTGGAGG - Intronic
962567190 3:136673464-136673486 ATCCAAAAGGAGCTTCATGAAGG + Intronic
963035225 3:141019861-141019883 ATGTACAAGGGGCCTGGGGAGGG + Intergenic
965057671 3:163743458-163743480 ATTCACAAGAAGCATGGTGGTGG + Intergenic
965633242 3:170755226-170755248 ATCCAACAGGAAGCTGGTGATGG - Intronic
965813211 3:172613058-172613080 AAGCACAAGCAGCCTGGTCAAGG - Intergenic
967259066 3:187624046-187624068 GGCAACAAGGAGCATGGTGAGGG - Intergenic
969398799 4:6939953-6939975 TTTCTCAAGGAGCCTGGTGTAGG - Intronic
970400361 4:15711633-15711655 ATCCACAAGGAGCCTGGTGAGGG - Intronic
970436780 4:16043507-16043529 TTCCAGCAGGGGCCTGGTGAAGG - Intronic
971253805 4:24995555-24995577 ATACTCAAGCAGCCTGTTGAGGG - Intergenic
971693427 4:29867218-29867240 ATGCACATGAAGCCTGGTGTTGG - Intergenic
974166812 4:58214700-58214722 ATACACAAGCTGCCTGATGATGG - Intergenic
975502963 4:75107739-75107761 ATCCACCAGGAGCCTATTGCTGG + Intergenic
981348072 4:143699056-143699078 ATCCACAGGTAGGATGGTGAGGG + Exonic
983120153 4:163873505-163873527 ATCCACAAGGTTCCTGATGGTGG + Intronic
983677122 4:170308751-170308773 ATAGACAAGGAGCAGGGTGAGGG - Intergenic
986897929 5:12393511-12393533 TTCCACAAGGAGACTTGCGAGGG + Intergenic
988346789 5:30047264-30047286 AGCCACAAAGAGCCTCTTGAAGG + Intergenic
988871275 5:35392688-35392710 ATCCAAAAGAAGGCTGGTAAAGG + Intergenic
989392429 5:40915210-40915232 ATCCAGTTGGAGTCTGGTGATGG - Intronic
990255442 5:53964091-53964113 TTCCCCAAGGAGCCTGGTTGTGG + Intronic
995732691 5:115262923-115262945 AACCACAGGGTGCCGGGTGAGGG + Intergenic
999297393 5:150468327-150468349 ATCCCTCAGGAGCCTGGGGAGGG - Intergenic
1005970339 6:30756030-30756052 AGCCACAAGGAGTCTGGGCAGGG - Intergenic
1006669416 6:35720357-35720379 ACCCCCAGGGAGCCTGGTGTGGG - Exonic
1007343624 6:41209795-41209817 AGCCACAAGGGGCCTGGCTAAGG - Intergenic
1017951250 6:159137070-159137092 ATCAACAAGGTGACAGGTGAGGG - Intergenic
1019351759 7:557271-557293 CTCCACCAGGGGCCTGGTCACGG - Intronic
1020785897 7:12571552-12571574 ACCCACAAGCAGCATGGTGCGGG - Intronic
1021659410 7:22904949-22904971 ATCCACAAGACTCCTGGTGAGGG + Intergenic
1026168326 7:67931097-67931119 CTCCACTAGGAGGTTGGTGAAGG - Intergenic
1030885823 7:114935897-114935919 AATCATAAGGAGGCTGGTGAGGG - Intronic
1041337277 8:56800503-56800525 TTCCACAAGGTGCCTGGTGGTGG + Intergenic
1045136932 8:99231604-99231626 ATCAACAACCAGCCTGGAGAAGG - Intronic
1045161943 8:99557782-99557804 AACCACAAGTAGCCTGGGAAAGG - Intronic
1049537391 8:143188721-143188743 AGCCACAAGGACCCTGGGGCAGG + Intergenic
1049748537 8:144273062-144273084 CTCCACAAGCAGCGTGGGGAGGG + Intronic
1050755756 9:9001257-9001279 ATCCCCTTGGAGCCTGGGGAAGG + Intronic
1051088315 9:13377812-13377834 ATCCACTAGGTGCCTGGAAAAGG - Intergenic
1051441827 9:17092771-17092793 AACCACAAGGAGACTGGAAATGG + Intergenic
1057878308 9:98774267-98774289 ATCCAGAAGAAGCCTGGTGTTGG - Intronic
1060481701 9:124019986-124020008 AACCACAAGGAGCCTCATGGGGG - Intronic
1061054977 9:128217765-128217787 AGCCATATGGAGCCTGGAGAAGG + Intronic
1062631098 9:137463519-137463541 CACCACAGGGAGCCTGGGGAGGG + Exonic
1187733927 X:22285007-22285029 TTCCATTTGGAGCCTGGTGAGGG - Intergenic
1187963987 X:24592744-24592766 ATACACTAGGAGACTGGTCAGGG - Intronic
1190654231 X:52597146-52597168 AGGCACTGGGAGCCTGGTGAGGG - Intergenic
1192420957 X:71029983-71030005 ATCTGCAAGGAGCCTGGAAAGGG - Intergenic
1195311086 X:103632463-103632485 TTCCAAAAGGAACGTGGTGAAGG + Intergenic
1197748631 X:129950176-129950198 ATACACAAGGTGTTTGGTGAGGG + Intergenic
1200870197 Y:8089492-8089514 ATCCAAAGGGGGTCTGGTGATGG - Intergenic
1201071983 Y:10155492-10155514 ACCCAGACTGAGCCTGGTGATGG - Intergenic