ID: 970408099

View in Genome Browser
Species Human (GRCh38)
Location 4:15782867-15782889
Sequence CTGTGTGACAGGCAGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 4, 2: 6, 3: 61, 4: 516}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970408099_970408105 11 Left 970408099 4:15782867-15782889 CCCCTCTCCTGCCTGTCACACAG 0: 1
1: 4
2: 6
3: 61
4: 516
Right 970408105 4:15782901-15782923 GTGCCACAGTATAGTAGTAAGGG 0: 1
1: 0
2: 2
3: 9
4: 76
970408099_970408104 10 Left 970408099 4:15782867-15782889 CCCCTCTCCTGCCTGTCACACAG 0: 1
1: 4
2: 6
3: 61
4: 516
Right 970408104 4:15782900-15782922 AGTGCCACAGTATAGTAGTAAGG 0: 1
1: 0
2: 1
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970408099 Original CRISPR CTGTGTGACAGGCAGGAGAG GGG (reversed) Intronic
900384400 1:2402977-2402999 CAGTGTGACTGACTGGAGAGCGG + Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900634962 1:3658439-3658461 CTCTGTGACAGAAAGGAAAGGGG + Intronic
901076097 1:6555554-6555576 CTGTGTGACAGGTGAGTGAGGGG + Exonic
901084142 1:6600602-6600624 CTGTGTGAAAGGCAGCTGAAAGG + Intronic
901139391 1:7018679-7018701 CTACATGACAGGAAGGAGAGCGG - Intronic
901434639 1:9239695-9239717 CTGTGCGCCAGGCAGGAGGAAGG - Intronic
901641780 1:10696261-10696283 CTGTGTGACGGCCAGGAGTGGGG - Intronic
902622572 1:17659080-17659102 CAGTGTGTCAGGGAGTAGAGAGG + Intronic
902755503 1:18546804-18546826 CTGTGTGTGGGGCATGAGAGAGG - Intergenic
902870197 1:19309486-19309508 CTGTGAGTCAGGAAGGGGAGGGG - Intronic
902883448 1:19388068-19388090 CAGTGTGCCTGGCAGGAGAAGGG - Intronic
903582470 1:24382018-24382040 ATTTGTGAAAGGGAGGAGAGGGG + Intronic
904298309 1:29538206-29538228 CAGTGGGACAGGGAAGAGAGAGG - Intergenic
905782672 1:40726432-40726454 CTGGGTGACAGTGTGGAGAGAGG - Intronic
905976744 1:42181036-42181058 CTGTGTGGCAGACAGCAGTGAGG - Intronic
906256975 1:44357853-44357875 CTGTGTGACAGGGAGAAGGAAGG + Intergenic
907265239 1:53255350-53255372 CTGTGAGGCAAGCAGGACAGAGG + Intronic
908476476 1:64493742-64493764 GTGTGTGGCAGGGAGGAGGGAGG - Intronic
908542845 1:65137897-65137919 CTGAGTGACAGGCATGTGATAGG - Intergenic
909007276 1:70291506-70291528 TTGTGTGACAGTAAGGAAAGGGG - Intronic
909764196 1:79334322-79334344 CTGTGTGACTGGGAGGAGACTGG + Intergenic
911055321 1:93703528-93703550 CTCTGTCACAGGCTGGAGTGTGG - Intronic
911360719 1:96873124-96873146 CTCTGTGACAGGGAGGTGATAGG - Intergenic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG + Intronic
912415600 1:109506559-109506581 CTGTGTGTCAGGCCAGAGTGGGG - Exonic
912446247 1:109739345-109739367 TTCTGTACCAGGCAGGAGAGAGG + Intronic
912700079 1:111871456-111871478 TTGTGTGACAGGAAGGACAACGG + Intronic
913135913 1:115888894-115888916 GTGTGTCCCAGGCTGGAGAGAGG - Intergenic
914224779 1:145711460-145711482 GTGGGTGACAGGCTGGAGACGGG + Intergenic
914802673 1:150972725-150972747 CTGAGGCACAGGCTGGAGAGGGG + Intronic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
915870221 1:159551346-159551368 TTGAGTGACATGCAGGAGACAGG - Intergenic
916809072 1:168289841-168289863 CTGCCTGCTAGGCAGGAGAGAGG - Intronic
918647427 1:186919871-186919893 CTTAGGGACAGGCAGGAGGGGGG + Intronic
918845693 1:189608317-189608339 CTGTGAGAGATGCTGGAGAGAGG + Intergenic
919131451 1:193455997-193456019 CTGAGTGGCAGGCAGGCAAGAGG + Intergenic
919603031 1:199646732-199646754 GAGTGTGAGAGGCAGGAGAAAGG - Intergenic
919974787 1:202603358-202603380 GTGTCTCAGAGGCAGGAGAGTGG - Intronic
920128362 1:203711862-203711884 CTTTGTGGCAGACAGGAGAAAGG - Intronic
920365757 1:205447631-205447653 CTGAGTGACAAGCAGGACGGGGG + Intronic
921328839 1:214015266-214015288 GTGTGAGGCACGCAGGAGAGGGG + Intronic
922593973 1:226799410-226799432 CTGAGGGACAGCCAGGAGAAGGG + Intergenic
922741524 1:228016796-228016818 GTGTGTCACACGCGGGAGAGGGG + Intronic
923017385 1:230137295-230137317 CTGTGTGACAGCCTGCACAGAGG + Intronic
923737214 1:236621894-236621916 CTGTGTGCCAGGAAGGAGCATGG + Intergenic
924645516 1:245873813-245873835 CTGTGTGACAGGCAGCACTACGG + Intronic
924771583 1:247085174-247085196 CTGTGTGCCAGGCTGGAGGTGGG - Intergenic
1062983187 10:1743067-1743089 CTGTGTGACAGCAGGAAGAGAGG + Intergenic
1063168169 10:3482631-3482653 TTGTGCCACAGTCAGGAGAGGGG + Intergenic
1063906843 10:10788913-10788935 GGGTGTGGCAAGCAGGAGAGAGG - Intergenic
1064008264 10:11714952-11714974 CAGTGAGAAGGGCAGGAGAGGGG + Intergenic
1064534516 10:16345051-16345073 CTGTGGCCCAGGCTGGAGAGTGG + Intergenic
1065163464 10:22948496-22948518 CATTGTTACAGGCAGTAGAGTGG - Intronic
1066255169 10:33671526-33671548 CTGTGTGTCAGGCAGGTGACAGG - Intergenic
1066784100 10:38983259-38983281 CTGTGAGAGAGGGAGTAGAGAGG + Intergenic
1067039758 10:42943009-42943031 CTGTGTTCCAGGCAGGAGAAAGG + Intergenic
1067148903 10:43713445-43713467 CTGTGTGCCAGGCACTGGAGAGG - Intergenic
1067455984 10:46419565-46419587 TTGTGTCACAGGCAGCAGGGGGG - Intergenic
1067631216 10:47965074-47965096 TTGTGTCACAGGCAGCAGGGGGG + Intergenic
1067734893 10:48842807-48842829 GAGTGTGACTGGCAGGAGATAGG - Intronic
1067739857 10:48887211-48887233 TGGTGTCACAGGGAGGAGAGAGG + Intronic
1067817731 10:49495320-49495342 GTGTGTGAGAGGCAGGCGTGTGG - Intronic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1070771582 10:79085457-79085479 CTGAGTGCCAGGCAGGAGTCAGG - Intronic
1070976640 10:80610601-80610623 CTGGGTGAGAGGCAGGGGTGAGG - Intronic
1071282000 10:84111692-84111714 CTTAGGGACAGGCAGGAGGGGGG - Intergenic
1071293864 10:84205382-84205404 GAGTGGGACAGGCAGGAGATGGG - Intronic
1071680769 10:87703150-87703172 CTCTGTGACAGCCAGGACAAGGG + Intronic
1072557667 10:96535045-96535067 GTGTGTGACAGGCAATTGAGTGG + Intronic
1073209481 10:101787711-101787733 CTGTTGGCCAGGCTGGAGAGGGG + Intronic
1073214090 10:101827105-101827127 CTGGGTGTCAGGCAGGAAGGGGG + Intronic
1073329094 10:102659342-102659364 CTCTGTGACAAGCAGCAGGGAGG - Intergenic
1073447907 10:103592084-103592106 CTGTGTGGCAGGCAGGGCATGGG + Exonic
1074191775 10:111144417-111144439 ATGTGGGACGGGGAGGAGAGGGG - Intergenic
1074869045 10:117562688-117562710 CAGGGTGGCAGCCAGGAGAGGGG + Intergenic
1075326187 10:121533961-121533983 CTGTTGGACTTGCAGGAGAGGGG - Intronic
1076007084 10:126956435-126956457 CTGAGTGAGTGGGAGGAGAGGGG + Intronic
1076065587 10:127445245-127445267 CTGTGCCACAGGAAGGAGAGTGG - Intronic
1076258384 10:129046367-129046389 CTGTTTGACAGCCAAGAGAAAGG - Intergenic
1076280946 10:129245114-129245136 CTCAGAGACAGGCAGCAGAGTGG - Intergenic
1076434310 10:130429658-130429680 CTGTGTGTCTGGGTGGAGAGAGG + Intergenic
1076548346 10:131260882-131260904 CTGTGGGCCAGGGTGGAGAGAGG + Intronic
1076866510 10:133168933-133168955 CTGTGTGGCCGGCTGGAGAGGGG + Intronic
1077025742 11:439158-439180 CTGTGGGACAGGAAGGATGGGGG - Intronic
1077229177 11:1450957-1450979 CTGTGCGACAGGTAGGACACAGG - Intronic
1077529566 11:3088826-3088848 GCGTCTGCCAGGCAGGAGAGAGG + Intronic
1078338151 11:10480067-10480089 CTCTGTGCCAGCCAGGAGACTGG - Intronic
1078540332 11:12208000-12208022 CTGTCAGGCAGGAAGGAGAGAGG - Intronic
1078857936 11:15221574-15221596 CTGGGTGACGGGCAGGTGTGGGG - Exonic
1079245022 11:18745537-18745559 GTGTGTGGGAGGCAGGGGAGGGG - Intronic
1080393655 11:31871010-31871032 CTGTGTGGCCAGGAGGAGAGAGG + Intronic
1080401526 11:31940840-31940862 GTGTTAGCCAGGCAGGAGAGCGG + Intronic
1080943350 11:36944013-36944035 GTGTGTGAAAGGAAGGAGAGGGG + Intergenic
1081690498 11:45074656-45074678 ATGTGTGAGAGGCAGGGCAGAGG + Intergenic
1083614124 11:64018127-64018149 ATTTGCCACAGGCAGGAGAGTGG + Intronic
1084243853 11:67842069-67842091 TTGTCTGGCAGGCAGGAGTGGGG + Intergenic
1084482028 11:69427560-69427582 CTGGGTGTCAGGCAGGAAAAGGG - Intergenic
1085079700 11:73624148-73624170 CAGTGTGATAGGCAGGGGAGGGG + Intergenic
1085715053 11:78865010-78865032 CTGTGTGACAGGCAGTATGTGGG + Intronic
1086251998 11:84826965-84826987 CTGTGTGACAGGGGAGAGACTGG + Intronic
1086433824 11:86762131-86762153 CTGAGTTACAGGCAGGAAACTGG - Intergenic
1087048133 11:93861487-93861509 TTGTGTGAAAGGTAAGAGAGAGG - Intergenic
1087765371 11:102146361-102146383 GTGTCTCACAGGCAGGAGAGAGG - Intronic
1088083103 11:105944386-105944408 CTGTGAGACATGAAGGAGAGTGG - Intronic
1088332205 11:108665503-108665525 CAGTGTGGCAAGCAGAAGAGTGG - Intronic
1088422177 11:109660386-109660408 CAGAATGATAGGCAGGAGAGGGG + Intergenic
1088596494 11:111444877-111444899 CTCTGTGAGAGGCAGGGGAGTGG + Intronic
1089306937 11:117532364-117532386 CTCTGTGACAGGTAGGGGAGAGG - Exonic
1089339445 11:117747583-117747605 CTGAGTGACACAAAGGAGAGAGG + Intronic
1089727649 11:120496730-120496752 ATGCATGACAGGCTGGAGAGCGG - Intergenic
1090260055 11:125312970-125312992 CCGTGTGAAAGGCAGGGGGGAGG + Intronic
1090477541 11:127037212-127037234 CTGTGACACAGGCAGGAGGCTGG - Intergenic
1091275253 11:134345343-134345365 TTGTGTGACAGGCAGCAGCAGGG + Intronic
1091331037 11:134730990-134731012 CTGTGAGGCATTCAGGAGAGGGG - Intergenic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1092062905 12:5565415-5565437 ATGTGTGGCAGGCAGAAGTGAGG - Intronic
1092285638 12:7127945-7127967 CAGTGTCACAGGCTGGAGGGTGG + Intronic
1092535169 12:9380095-9380117 CTGAGTGACAGGCTGTGGAGAGG + Intergenic
1094332802 12:29314611-29314633 CTGGGTGCCAGGAAGGGGAGGGG - Intronic
1095980849 12:47973923-47973945 CTGAGTGACAGGTGAGAGAGAGG - Intronic
1096385607 12:51193023-51193045 CTGTGACACAGGCAGGCGAGAGG + Intronic
1096589693 12:52649359-52649381 CAGTGTCTCAAGCAGGAGAGAGG - Intronic
1096718437 12:53504589-53504611 CTAGGTGAGAGGAAGGAGAGAGG - Intronic
1097101113 12:56590211-56590233 ATGTGTAACAGGGAAGAGAGGGG - Exonic
1097107998 12:56636366-56636388 CTGTGTGACAGACTGGGGTGGGG + Exonic
1097113416 12:56679709-56679731 CGGAGTGACAGGCTGGAGAACGG + Intronic
1097369366 12:58757883-58757905 CTGTGTGCCAGGTATGAGGGTGG + Intronic
1098185050 12:67887912-67887934 ATCTTTGAGAGGCAGGAGAGCGG + Intergenic
1098295785 12:69002691-69002713 CTATGTGACAATCAGGAGACTGG + Intergenic
1099240499 12:80132828-80132850 CTGCTTGACATGCAGGTGAGAGG - Intergenic
1100212014 12:92407349-92407371 TTGGGAGACAGGCAGGAGAATGG + Intergenic
1100275630 12:93069260-93069282 CTCTGCTACAGGGAGGAGAGAGG + Intergenic
1101578723 12:106022314-106022336 CTGTGTGTCAGGCAAGACCGAGG - Intergenic
1101581972 12:106049737-106049759 CTGTGTGCCAGGCTGGAGGATGG - Intergenic
1101848963 12:108387224-108387246 CTGTGTGGGAGGCAGGGGTGGGG - Intergenic
1102233455 12:111279321-111279343 CTGTGAGACAGGCAGGACCGAGG - Intronic
1103188138 12:118979628-118979650 CTGAGTCACTTGCAGGAGAGAGG - Intergenic
1103489302 12:121304522-121304544 CTGTTTTACAGGCAGGAAAGCGG - Intergenic
1103940870 12:124500534-124500556 CTGTGTGCCAGGCACCAGAAGGG - Intronic
1104185026 12:126422330-126422352 CAGAGTGGGAGGCAGGAGAGGGG + Intergenic
1104413610 12:128579715-128579737 CTCTGTGCTGGGCAGGAGAGAGG + Intronic
1104487760 12:129166341-129166363 CTGTTTGACAGGCATGAATGCGG + Intronic
1105408324 13:20149990-20150012 CTGGGTGACAGGCAGACGAATGG + Intronic
1107278532 13:38705843-38705865 CTGTGAGAAAGACAGGAGAAAGG - Intronic
1108452310 13:50579564-50579586 CTGCGTTACAGACAGGAGAGAGG + Intronic
1108622884 13:52201253-52201275 CAGTTTGACAGGTAGGAGAGGGG - Intergenic
1108663846 13:52609789-52609811 CAGTTTGACAGGTAGGAGAGGGG + Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1112578696 13:100659974-100659996 CAGTGTGAAATGCTGGAGAGTGG + Intronic
1112579838 13:100669203-100669225 CTGTGTGTGTGGCAGGGGAGAGG + Intronic
1112712331 13:102143844-102143866 AGGTGTGACAGCCAAGAGAGAGG - Intronic
1112966028 13:105195431-105195453 ATGAGTGAGAGGCAGGAGATGGG - Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114034689 14:18612160-18612182 CTGGGTGCCAGGAAGGGGAGGGG - Intergenic
1114123953 14:19702856-19702878 CTGGGTGCCAGGAAGGGGAGGGG + Intergenic
1114214441 14:20645553-20645575 CTGGGTGTCATGCAGGAGAAGGG - Intergenic
1114446729 14:22794328-22794350 CTGAGTTCCAGGAAGGAGAGCGG - Intronic
1115612389 14:35061319-35061341 CTGAGTGAGAGGCAGAAGGGCGG - Intronic
1115763412 14:36598206-36598228 ATGTGTGATTGGCAGGAGACAGG - Intergenic
1117619293 14:57568075-57568097 GTGTGTAACAGGCTGGAGGGAGG + Intronic
1118012307 14:61622362-61622384 ATGTCTGAGAGCCAGGAGAGAGG + Intronic
1118284225 14:64456674-64456696 GTGTGAGACAAGTAGGAGAGAGG - Intronic
1118312725 14:64705188-64705210 CTGTCCGGCAGGGAGGAGAGTGG + Intronic
1119034937 14:71221620-71221642 CTGTGTCTCAGGCAGCAGTGAGG - Intergenic
1119328221 14:73774876-73774898 CTCTGTGACAGGAACGAGAAGGG - Intronic
1119590659 14:75884508-75884530 CTTTGTGACAGGCAAGAGTGTGG + Intronic
1121097147 14:91225459-91225481 CTGGGTGACTGGCAGGCGGGTGG - Intronic
1121332112 14:93056158-93056180 GTGTGTGCAAAGCAGGAGAGTGG + Intronic
1121971030 14:98355994-98356016 CCCTGTGATAGGCAGAAGAGTGG - Intergenic
1122114043 14:99518830-99518852 CAGTGAGGCGGGCAGGAGAGGGG - Intronic
1122121420 14:99555466-99555488 CTGTGTGCCAGGGAGGAGAAGGG - Intronic
1122143737 14:99676807-99676829 CTCTGTGCCAGGCCGCAGAGGGG + Exonic
1123662571 15:22577269-22577291 CAGTGTGACTGGCAGCAGAAAGG + Intergenic
1123800112 15:23810568-23810590 CTAAGTGAGAGGCAGGAAAGGGG + Intergenic
1124261712 15:28198642-28198664 CAGTGTGACTGGCAGCAGAAAGG - Exonic
1124316373 15:28671570-28671592 CAGTGTGACTGGCAGCAGAAAGG + Intergenic
1124949429 15:34302923-34302945 CTGGGTGACAGACGGGAGAAGGG + Intronic
1125745246 15:41993181-41993203 CTGTGTGCCAGGCATAACAGTGG + Intronic
1126106096 15:45148005-45148027 CTCTGGGACAGCCAGGAGAATGG + Intronic
1126152912 15:45539186-45539208 ATGGGTGCCATGCAGGAGAGTGG - Intergenic
1126251765 15:46575629-46575651 GTAGGTGACAGGAAGGAGAGAGG - Intergenic
1127494128 15:59493622-59493644 CTGTCTGCCAGGCTGGAGAGCGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1129163563 15:73761827-73761849 ATTTGAGGCAGGCAGGAGAGAGG - Intergenic
1129394230 15:75235544-75235566 CTGTGTCAGAGGCTGGGGAGGGG - Intergenic
1129779791 15:78263131-78263153 CTGTGAGAAAGGCAGGCAAGTGG + Intergenic
1130442811 15:83972684-83972706 ATGTTTGGCAGGCAGGAGTGGGG - Intronic
1130806118 15:87324981-87325003 ATGTGTGTGAGGCAGGTGAGGGG + Intergenic
1131492790 15:92877366-92877388 CTGTCTTCCAGGTAGGAGAGTGG - Intergenic
1131594334 15:93781634-93781656 TTGTGTGAGAGACAGGTGAGTGG + Intergenic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1132313592 15:100875250-100875272 CTGTGTTCCAGGCAGCAGAAAGG + Intergenic
1133025347 16:2986819-2986841 CTGTCTGCCAGGCAGGACGGTGG + Intergenic
1133613054 16:7451056-7451078 CTGAGTGACAAGGAGGAGACTGG + Intronic
1134473469 16:14549363-14549385 GTGTGTGTCAGGTATGAGAGAGG + Intronic
1135037979 16:19094262-19094284 CAGTGTGACTGTCAGCAGAGAGG + Intergenic
1135131934 16:19860284-19860306 CTGTGTGTGTGGCAGGGGAGGGG + Exonic
1135532291 16:23265130-23265152 CTGTGTGGCAGGCAGAATAATGG - Intergenic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1136057889 16:27704123-27704145 CTGTGTGCCAGGGAGGGGGGGGG - Intronic
1136082285 16:27860121-27860143 CTGAGAAACAGGCAAGAGAGGGG + Intronic
1136590144 16:31213779-31213801 GTGGGTGACAGGCTGGGGAGGGG + Intergenic
1137669238 16:50269727-50269749 CAGTGGGAGAGGTAGGAGAGAGG - Intronic
1137695056 16:50456008-50456030 CTCTGTGAGAGCCAGGGGAGTGG + Intergenic
1138565113 16:57827508-57827530 CTGAGGGACAGGCAGGAGAAGGG - Intronic
1138615871 16:58165992-58166014 CTGGGTGGCATGCAGAAGAGTGG + Intronic
1139469383 16:67170229-67170251 CTCTGTGACAGGCAGAGAAGAGG + Intronic
1139908460 16:70381927-70381949 CGGGATGACAGGGAGGAGAGGGG + Intronic
1140283500 16:73577551-73577573 CTGAGGGACAGGCAGGTGAGCGG - Intergenic
1140540822 16:75754970-75754992 CCATGTGCAAGGCAGGAGAGAGG + Intronic
1140859998 16:79010227-79010249 CTGTGTGCCAGACAAGAGTGAGG + Intronic
1141635028 16:85310090-85310112 CTGAGTGCCAGGCGGGACAGGGG - Intergenic
1141910584 16:87056083-87056105 CTGTCTGACAGGTAGGAGGTGGG - Intergenic
1142203904 16:88773681-88773703 CTGGGTGACAGGCAGGTCGGGGG + Intronic
1142203912 16:88773723-88773745 CTGGGTGACAGGCAGGTCGGCGG + Intronic
1142287571 16:89177632-89177654 CTGGGGGAGAGGCAGGGGAGAGG - Intronic
1142333777 16:89473450-89473472 CTGAGAGGCAGGCAGGACAGTGG + Intronic
1142850137 17:2700824-2700846 CCCTGTGGCAGGCAGGGGAGGGG + Exonic
1142960287 17:3548235-3548257 CTGTGTCACATTCAGGAGGGAGG + Intronic
1143278789 17:5734493-5734515 ATGTGAGACATGTAGGAGAGAGG - Intergenic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144707792 17:17380865-17380887 CTGGGCGTCAGGCAGGACAGGGG + Intergenic
1144839850 17:18179179-18179201 CTGTGTCATAGGCAGGAGTTAGG - Exonic
1146611356 17:34307887-34307909 CTGTAGGACAGGCAGGATAGTGG - Intergenic
1146695998 17:34909554-34909576 CAGAGTGACAGCCAGGAGAAAGG + Intergenic
1146954798 17:36931297-36931319 GTGTGTGAGAGGCAGGAAGGTGG - Intergenic
1146967772 17:37047498-37047520 CTGGGGAACAGGGAGGAGAGGGG - Intronic
1147178350 17:38670483-38670505 CCTTGTGACAGACAGGAGAGGGG + Intergenic
1147323608 17:39660022-39660044 CTATGGCACTGGCAGGAGAGAGG - Intronic
1147719125 17:42527486-42527508 CTGTGTGATAGGCAGGCAACTGG + Intergenic
1148148819 17:45384009-45384031 CTGGGGGACTGGGAGGAGAGAGG + Intergenic
1148273355 17:46281424-46281446 CTGTGATTCAGGCTGGAGAGCGG + Intronic
1148486271 17:47992877-47992899 CTGTGTGACATGGAAAAGAGGGG - Intergenic
1148897207 17:50845880-50845902 CTGGGAGGCAGGCAGGAGAGGGG - Intergenic
1149544386 17:57492559-57492581 CTGTGTGCCAGTCTGGGGAGGGG + Intronic
1149596748 17:57868702-57868724 CTGTGTGGCGGGGAGGTGAGGGG + Intronic
1151508064 17:74542285-74542307 CTGCGAGAGAGGCAGGGGAGAGG + Intronic
1151624317 17:75267203-75267225 GTGTGTGGGAGGCAGGAGAGTGG - Intronic
1151666361 17:75547301-75547323 CTATGTGCCAGGCATCAGAGGGG + Intronic
1152250381 17:79209393-79209415 GAGTGTGGCAGGCAGGACAGAGG + Intronic
1152351425 17:79785871-79785893 CTGGGACACAGGCAGGAGGGAGG - Exonic
1153949863 18:10049370-10049392 GTGTGTGTCAGACAGCAGAGAGG + Intergenic
1155019412 18:21881289-21881311 CTGTGTCACAGGCTGGAGCGCGG - Intergenic
1155155222 18:23151874-23151896 CTGTGGGCCAGGCAGGACATGGG + Intronic
1155307503 18:24492855-24492877 CTGTGTAACAGGCGAGAGATGGG + Intergenic
1156426769 18:37022001-37022023 CTGTTGCACAGGCAGGAGTGCGG - Intronic
1157380510 18:47211103-47211125 ATTTGTGATAGGCAGAAGAGAGG + Intergenic
1157426528 18:47588993-47589015 TTGTGTGAGAGGCAGCTGAGTGG + Intergenic
1157814421 18:50720624-50720646 TTGTGTGTCACACAGGAGAGGGG + Intronic
1158069096 18:53449641-53449663 CTGAGTGACAAGAACGAGAGAGG - Intronic
1158510406 18:58085331-58085353 CCGTGTGCCAGGCAGCAGTGTGG + Intronic
1158796612 18:60854070-60854092 CTGTTTTACAGACAGGAAAGAGG + Intergenic
1159123896 18:64200952-64200974 CTGAATGACAGGCAGGGGAGAGG - Intergenic
1160323664 18:77919837-77919859 ATTTGTGAGAGGCAGGAGACGGG + Intergenic
1160541515 18:79626452-79626474 CTGAGTGGCAGGGAGGAGGGTGG - Intergenic
1160570898 18:79816978-79817000 CCATGTGACAGGCATGTGAGTGG - Intergenic
1160570933 18:79817322-79817344 CCATGTGACAGGCATGTGAGTGG - Intergenic
1161475719 19:4483719-4483741 GCGTGTGACAGGCTGGAGTGGGG - Intronic
1161933887 19:7359121-7359143 GTGTGTGACAGGGAGGTAAGAGG + Intronic
1162018628 19:7858630-7858652 CTGTGTCACAGGCAGCAGACAGG + Intronic
1162248760 19:9425249-9425271 CTGTGGGATAGGAATGAGAGAGG - Intronic
1162786334 19:13037190-13037212 CTGTGTGTCAGGGAGAAGAGGGG + Intronic
1162853529 19:13450431-13450453 ATGTGTGGCAGGCAGGGGTGAGG - Intronic
1163062647 19:14771549-14771571 CTGAGTGCCAGCCAGGAGTGTGG + Intronic
1163353459 19:16794327-16794349 CTGTCTCCCAGGCAGGAGTGCGG - Intronic
1163913379 19:20216350-20216372 CTGTGTGATAGGCAAGAAAAGGG - Intergenic
1164306575 19:24009129-24009151 CTGTGACCCAGGCAGGAGTGCGG - Intergenic
1164827834 19:31297298-31297320 CTGTGTGGCAGGCAGGACAATGG + Intronic
1164832004 19:31330272-31330294 CTGAGGGCCAGGCAGGTGAGGGG - Intronic
1165335708 19:35168341-35168363 CAGAGTGACAGGGAAGAGAGGGG + Intronic
1165604853 19:37093145-37093167 GTGTGTCACTGGCAAGAGAGGGG + Exonic
1165897298 19:39150477-39150499 CTGTGAGGCAGCCAGGACAGTGG - Intronic
1165999266 19:39868339-39868361 CTGTCTTTCAGGCAGGAGTGCGG - Intronic
1166035194 19:40163197-40163219 CTGTGTGAGAGAGGGGAGAGGGG + Intergenic
1166850282 19:45756780-45756802 ATGGGTGAAGGGCAGGAGAGAGG - Intronic
1166872868 19:45881543-45881565 CTGTGAGACAGGCAGGGAACTGG - Intergenic
1166881900 19:45934942-45934964 CTGTGTGTCCGGCAGGGGGGAGG - Exonic
1167056322 19:47113200-47113222 CCGTGTCACGTGCAGGAGAGGGG + Intronic
1167932429 19:52877068-52877090 CTGTTGGCCAGGCATGAGAGCGG - Exonic
924964906 2:67021-67043 GTGTGTGACACACAGGTGAGCGG - Intergenic
924964917 2:67129-67151 TTGTGTGACACACAGGTGAGCGG - Intergenic
924964965 2:67604-67626 TTGTGTGACACACAGGTGAGCGG - Intergenic
924964998 2:67919-67941 TTGTGTGACACACAGGTGAGCGG - Intergenic
924965017 2:68130-68152 TTGTGTGACACACAGGTGAGCGG - Intergenic
924965027 2:68236-68258 TTGTGTGACACACAGGTGAGCGG - Intergenic
924965031 2:68288-68310 GTGTGTGACACACAGGTGAGCGG - Intergenic
924965035 2:68342-68364 GTGTGTGACACACAGGTGAGCGG - Intergenic
924965054 2:68556-68578 GTGTGTGACACACAGGTGAGCGG - Intergenic
925380346 2:3420598-3420620 CTGTGTTGAAGGCAGGAGAGTGG - Intronic
925410134 2:3635093-3635115 ATGGGGGACAGGCAGGGGAGAGG - Intronic
926056032 2:9774558-9774580 CGGAGTCACGGGCAGGAGAGTGG - Intergenic
926121519 2:10243568-10243590 CTGTGGCATAGGCAGGACAGAGG + Intergenic
926425452 2:12735301-12735323 CTGCATCCCAGGCAGGAGAGGGG - Intronic
927111173 2:19864726-19864748 CTGTGTGAGAGGAAGGGCAGAGG - Intergenic
927688567 2:25190665-25190687 CTATGTGCCAGGCAGGAGAGAGG + Intergenic
927832907 2:26369607-26369629 ATGAATGACAGGCTGGAGAGAGG - Intronic
929909217 2:46074841-46074863 CTGTGTCCCAGGCAGGACATAGG - Intronic
930508987 2:52320974-52320996 ATGGGTGACAGGGAGGAGTGGGG + Intergenic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
931630558 2:64294801-64294823 CTGAGTAACAGGCATTAGAGAGG + Intergenic
931945617 2:67303374-67303396 CTGTGTGGCAGGCAGGTTAATGG + Intergenic
932984954 2:76714668-76714690 CTGTGAGACAGTCAGCAAAGTGG + Intergenic
933691318 2:85181501-85181523 CTGTGTGGTGGCCAGGAGAGAGG + Intronic
933978459 2:87530532-87530554 CCCTTTGACAGGCAGGACAGCGG + Intergenic
934615449 2:95767924-95767946 CAGTGGGCCAGGCAGGAGAGAGG + Intergenic
934645454 2:96056634-96056656 CAGTGGGCCAGGCAGGAGAGAGG - Intergenic
934681365 2:96286232-96286254 CTCTGTGGCAGGCAGGGGAGTGG - Intronic
934838858 2:97612723-97612745 CAGTGGGCCAGGCAGGAGAGAGG - Intergenic
935410552 2:102757392-102757414 CTCTGTGACACGAAGGACAGAGG - Intronic
935643394 2:105311546-105311568 CTGTTTCCCAGGCTGGAGAGCGG - Intronic
936315374 2:111420269-111420291 CCCTTTGACAGGCAGGACAGCGG - Intergenic
937960773 2:127456429-127456451 CTGTGCGTCAGGCAGGCTAGAGG + Intronic
938276567 2:130030687-130030709 CTGGGTGCCAGGAAGGGGAGGGG + Intergenic
938362415 2:130700029-130700051 CTGGGTGCCAGGAAGGGGAGGGG - Intergenic
938438805 2:131306671-131306693 CTGGGTGCCAGGAAGGGGAGGGG - Intronic
938802395 2:134775142-134775164 CCATGTGACAGGCAGGATAAAGG + Intergenic
939465335 2:142547352-142547374 CTCTGTGCCAAGCAGGAGAGAGG - Intergenic
939984441 2:148815796-148815818 CTGGATTACAGGCAGGAGGGCGG - Intergenic
940697087 2:156993208-156993230 GTTTATTACAGGCAGGAGAGGGG + Intergenic
942166957 2:173250994-173251016 CAGTTTTAAAGGCAGGAGAGTGG - Intronic
943934922 2:193903928-193903950 CTGTGAGCCAGGCAGAAGACGGG + Intergenic
944348784 2:198702328-198702350 CTATGTGCCAGGCATGTGAGGGG - Intergenic
944554680 2:200875915-200875937 CTGTGTATCAGGGAGGAAAGGGG - Intronic
944686616 2:202123220-202123242 CTGTGTGTCAGGCGAGAGGGCGG - Intronic
945152634 2:206807016-206807038 TTCTCTGACAGGCAGGAGTGGGG + Intergenic
946326767 2:218988658-218988680 CTGTGAGACAGGCAGGACAGTGG + Intergenic
947077350 2:226359770-226359792 GTGTCTTACAGGCAGGAGAGAGG + Intergenic
947501690 2:230675558-230675580 CAGTGTGACTGGCTGCAGAGGGG + Intergenic
947910992 2:233800717-233800739 CTCTGTGAAAGACAGGACAGAGG + Intronic
948233374 2:236368225-236368247 CTGTCTGACATCCAGGAGGGAGG + Exonic
948317499 2:237039569-237039591 CTCTGTCCCAGGCAGGAGGGAGG + Intergenic
948366055 2:237455495-237455517 CTCAGTGACAGGCTGGAGATGGG + Intergenic
948523641 2:238557683-238557705 CTCTGGGTCAGGCAGGAAAGTGG + Intergenic
948564431 2:238874798-238874820 CTGTGATTCAGGTAGGAGAGGGG + Intronic
948589265 2:239038918-239038940 CTGGTTGGCAGGAAGGAGAGGGG + Intergenic
948887398 2:240891121-240891143 GTCTGTGAGAGGAAGGAGAGGGG - Intronic
948984856 2:241514657-241514679 CAGTGTGGTAGGCAGGAGAGGGG + Intergenic
1168844991 20:938268-938290 ATGAGTGAAAGGAAGGAGAGAGG + Intergenic
1168946841 20:1767903-1767925 CTGGGTGACAGGCTGGCAAGAGG - Intergenic
1169143023 20:3236758-3236780 CTGTGTGAAGGGCAGTGGAGGGG - Intronic
1169265394 20:4164252-4164274 CCGGGTGACAGGCAGGGGTGGGG - Intronic
1169437707 20:5607779-5607801 CTGTCACACAGGCAGGAGTGTGG - Intronic
1170188962 20:13625607-13625629 CTTTCTGACAGTCAGCAGAGAGG - Intronic
1170403407 20:16011559-16011581 CTGTGTGAGAGGAAAGAAAGAGG + Intronic
1170775565 20:19371942-19371964 CTGTGTCTCAGGCAGCAGTGAGG + Intronic
1171012952 20:21518382-21518404 CCGGGGGAAAGGCAGGAGAGGGG + Intergenic
1171032700 20:21691615-21691637 CGGAGTCACAGCCAGGAGAGGGG + Intergenic
1172543714 20:35742632-35742654 CTGTGTGGGAGGCCGGAGCGGGG - Intergenic
1172770476 20:37379409-37379431 CTCTGTGCCAGGGAGGAGGGTGG + Intronic
1173289487 20:41701913-41701935 TTGTGTGAAAGGAAGGAGGGAGG + Intergenic
1173564964 20:44032076-44032098 CGGTGTGAGGGGCAGGGGAGCGG + Intronic
1174447899 20:50602633-50602655 CTGTAGGACAGACTGGAGAGGGG + Exonic
1174518518 20:51112118-51112140 CTGAGTGGCAGGCTTGAGAGCGG + Intergenic
1174894528 20:54434754-54434776 CTCTGTTGCAGGCAGGAGTGTGG - Intergenic
1175287331 20:57845588-57845610 AGGTGTGACAGGCAGAAGAATGG + Intergenic
1175815023 20:61878779-61878801 CTGTGTGCAAGGCGGGAGACAGG - Intronic
1176411266 21:6450737-6450759 CAGTGTGACAGGCAGGAGAGCGG - Intergenic
1176411279 21:6450786-6450808 CAGTGTGACAGGCAGGAGAGCGG - Intergenic
1176412653 21:6457423-6457445 CTGTGTCCCAGGCAGGGGCGGGG - Intergenic
1176424239 21:6538173-6538195 CTGTGGGTGAGGCAGGAGTGTGG + Intergenic
1176710771 21:10147476-10147498 CTGTGAGACCTGCAGGACAGGGG - Intergenic
1177452289 21:21285982-21286004 CTGAGTGACAAGGAAGAGAGAGG + Intronic
1178233308 21:30812538-30812560 CTGTGTGATAAGCAGGTAAGAGG - Intergenic
1178537408 21:33421759-33421781 TAGGGTGACAGGCAGGACAGAGG - Intronic
1178881640 21:36454665-36454687 CTGTGTCTCAGGCAAGAAAGGGG + Intergenic
1179505285 21:41835911-41835933 CTGTGGGGGAGGGAGGAGAGTGG - Intronic
1179505296 21:41835941-41835963 CTGTGGGGGAGGGAGGAGAGCGG - Intronic
1179505309 21:41835971-41835993 CTGTGGGGGAGGGAGGAGAGTGG - Intronic
1179686759 21:43059059-43059081 CAGTGTGACAGGCAGGAGAGCGG - Intronic
1179686772 21:43059108-43059130 CAGTGTGACAGGCAGGAGAGCGG - Intronic
1179688147 21:43065745-43065767 CTGTGTCCCAGGCAGGGGCGGGG - Intronic
1179699732 21:43146488-43146510 CTGTGGGTGAGGCAGGAGTGTGG + Intergenic
1180458810 22:15539208-15539230 CTGGGTGCCAGGAAGGGGAGGGG - Intergenic
1180721584 22:17913166-17913188 CCGGGTGACAGGCAGGAGAGGGG - Intronic
1181028234 22:20137799-20137821 CTGTGTGCCAGGCAGGGCTGGGG + Intronic
1181085276 22:20436873-20436895 GTGTGGGACAGGCAGGCGACAGG - Intronic
1181617159 22:24062797-24062819 CTGAGTGGCAGGCATCAGAGAGG - Intronic
1181673815 22:24439187-24439209 TTGGGAGACAGGCAGGAGAATGG - Intronic
1182215621 22:28715036-28715058 CTGTGTCTCAGGCTGGAGTGCGG - Intronic
1182486375 22:30641438-30641460 CTGTCTGGCAGGCAGCAGACAGG - Intronic
1183150668 22:36034670-36034692 GTGTGTTCCAGGCAGGAGAAAGG - Intergenic
1183426225 22:37740884-37740906 CTGTTTGACAGGCAGACAAGAGG + Exonic
1185274232 22:49943515-49943537 CTGCTTGACAGGCGGGTGAGTGG + Intergenic
950203472 3:11060964-11060986 GTCTGTGCCAGGCTGGAGAGCGG + Intergenic
950726876 3:14922451-14922473 GTGTGTGACAGGCACCAGGGTGG - Exonic
953393660 3:42549325-42549347 CATTGTGACATGCAGGACAGTGG - Intronic
953754688 3:45636154-45636176 CTGTGTGAAATGCAGCAAAGGGG + Exonic
954156788 3:48689530-48689552 GTGTGTGGCATGCAGGTGAGGGG - Exonic
954274908 3:49535823-49535845 CTGATTCACAGGCAGAAGAGGGG - Intergenic
954301094 3:49701227-49701249 CTGTGGGACAAGCTGGAGAGAGG - Intronic
954421385 3:50420835-50420857 GTGTGTGACAGGCAGGCTGGGGG - Intronic
955410586 3:58653019-58653041 CTCTGTGCCAGGCACTAGAGAGG + Intronic
955977136 3:64490005-64490027 TTGTTCCACAGGCAGGAGAGAGG + Intergenic
956691088 3:71878022-71878044 CTGAATGTGAGGCAGGAGAGCGG - Intergenic
956815860 3:72907685-72907707 ATGAGAAACAGGCAGGAGAGGGG - Intronic
957406051 3:79776131-79776153 CTTAGGGACAGGCAGGAGGGGGG - Intergenic
958131841 3:89436606-89436628 GTGAGTGACAGGCAGAATAGAGG + Intronic
960223817 3:115147173-115147195 TTGTGGGACGGGCGGGAGAGAGG - Intronic
960378549 3:116932438-116932460 CTGGGTTCCAGGCAGGAGAAAGG - Intronic
960569463 3:119171374-119171396 CTGTGTGAGTGGCCAGAGAGAGG - Intronic
961814829 3:129544101-129544123 CTGCATGACCGGGAGGAGAGAGG + Intronic
961982303 3:131093458-131093480 CTGTCTGTCAGGCTGGAGTGTGG + Intronic
962199055 3:133386501-133386523 ATGTGTGACAGGAAGAAGAGGGG - Intronic
962210412 3:133472543-133472565 CTGCTGGACAGGGAGGAGAGCGG + Exonic
962821677 3:139054678-139054700 CAGTGGGCCAGGCAGGTGAGTGG + Intronic
962854159 3:139329272-139329294 CTCTGTGGCAGGAAGGAGAGAGG + Intronic
962974600 3:140434753-140434775 CTGTATGACTGACAGGAGACAGG + Intronic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
963827942 3:149974981-149975003 CTGTGTAAGAGTCTGGAGAGAGG - Intronic
963908658 3:150796008-150796030 CGCTGTGTCAGGCAGGAGACTGG - Intergenic
964188115 3:153971283-153971305 TTCTCTGAAAGGCAGGAGAGAGG - Intergenic
964404894 3:156338875-156338897 CAGTGTCACAGGCAGGATTGGGG + Intronic
965597380 3:170422070-170422092 CTGTGGGTGAGGCAGGAGATGGG + Intronic
965920386 3:173906278-173906300 CAGTGGGACAGGGAGGAGAAAGG - Intronic
966729286 3:183136969-183136991 CTGTGTCCCAGGCTGGAGTGTGG - Intronic
967191210 3:186986328-186986350 CTATGTGCCAGGCATGATAGAGG - Intronic
968640223 4:1711012-1711034 CTGTCTCACAGGCTGGAGTGCGG - Intronic
968801616 4:2746795-2746817 GTGTGTGGCAGGCAGGGGAATGG - Intronic
969003345 4:4000256-4000278 TTCTGTGGCAGGCAGGAGTGGGG + Intergenic
969411862 4:7033724-7033746 CTGAGGGAGAGGCGGGAGAGCGG - Intergenic
970109100 4:12617637-12617659 CTGGCTGACTGGCAGGAGTGTGG + Intergenic
970408099 4:15782867-15782889 CTGTGTGACAGGCAGGAGAGGGG - Intronic
970586472 4:17519029-17519051 CTGTGAGGCAGGAAGTAGAGAGG - Intronic
971975635 4:33682729-33682751 CTGTGTTACAGGGAGGAGTGTGG + Intergenic
972264375 4:37444882-37444904 CTCTGTGACATGCAGGTGACTGG - Exonic
972282509 4:37616436-37616458 CTGTGTGGCAGGCAACAGAAAGG + Intronic
972550541 4:40129084-40129106 CTTTGTTACAGGCTGGAGTGCGG + Intronic
974875744 4:67701041-67701063 CTGGGGGACTGGCAGGTGAGAGG - Exonic
975041900 4:69755437-69755459 CTCTGTGACAAGCAGGACAAAGG + Intronic
976057336 4:81083435-81083457 CTGTGTTCCAGGCTGGAGTGCGG - Intergenic
976305465 4:83555168-83555190 CTATGTGACAGGAAAGGGAGAGG - Intronic
976393579 4:84531767-84531789 CTAGGTGAGTGGCAGGAGAGGGG + Intergenic
979113062 4:116783091-116783113 CTGTGGGACAGAAAGGAAAGAGG - Intergenic
980154372 4:129086915-129086937 ATGTGTGTCAGGCAGAAAAGTGG - Intronic
980158680 4:129135098-129135120 TTGTGATACAGACAGGAGAGTGG + Intergenic
980609449 4:135138576-135138598 CTGTATAACAGGCAAGATAGGGG - Intergenic
980779920 4:137481542-137481564 CTTAGGGACAGGCAGGAGGGGGG - Intergenic
982175880 4:152705022-152705044 CTTAGTGACAGGCAGCAGATTGG - Intronic
983720697 4:170848058-170848080 CTTATTGGCAGGCAGGAGAGTGG + Intergenic
984849423 4:184141238-184141260 CTGTGGGAGATACAGGAGAGGGG - Intronic
985200119 4:187476064-187476086 CTGGATGCCAGGCAGGAGAAAGG + Intergenic
985485570 5:146475-146497 CTGTGTGGAGGGGAGGAGAGAGG - Intronic
987377775 5:17252454-17252476 CTGTGTGCCATGCAGCAGAAAGG + Intronic
988182851 5:27819686-27819708 ATGTGGGACAGGAAGGAAAGAGG + Intergenic
988509827 5:31855448-31855470 GTGTGTGACGGGCAGGGAAGGGG + Intronic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
988882342 5:35517001-35517023 TTGTATGATAGGCAGGAGTGTGG - Intergenic
989436433 5:41418679-41418701 CAGTGTGGCAGGAAGAAGAGAGG - Intronic
989730391 5:44641417-44641439 GTGGGTGACAGGAAGGAGAGAGG - Intergenic
992267415 5:75032762-75032784 TTGTGTGTCAGGCAAGGGAGTGG - Intergenic
995442114 5:112203499-112203521 CAGTGTGACAGGTACAAGAGAGG - Intronic
995767993 5:115639651-115639673 CTGTGTGCCAGGCAGTAGGTGGG - Intergenic
996746827 5:126853214-126853236 GTGTGGGAGAGGGAGGAGAGGGG + Intergenic
996971011 5:129367791-129367813 CAGAGTGCCAGGGAGGAGAGAGG + Intergenic
998132420 5:139658104-139658126 AGGTGGGTCAGGCAGGAGAGGGG - Intronic
998282218 5:140822833-140822855 CTCTTTGACAGGCAGGAAAAGGG - Exonic
998830341 5:146150900-146150922 CTGTCTCACAGGCTGGAGTGCGG - Intronic
999921985 5:156331321-156331343 CTGTCTGAGAGGCAGGTCAGAGG - Intronic
1000817635 5:165943319-165943341 CTATGTAACAGTCATGAGAGTGG + Intergenic
1003552983 6:7115357-7115379 CTGTGTGATAGGCTGGGGGGTGG - Intronic
1004258840 6:14089892-14089914 CTGGAGGCCAGGCAGGAGAGAGG - Intergenic
1004632675 6:17436812-17436834 GTGAGTGGCAGGCAGGTGAGCGG + Intronic
1005219601 6:23571794-23571816 ATGTGTCACATGCAGCAGAGAGG - Intergenic
1005824973 6:29627346-29627368 TTGTGTGACTGGCAGGAGATGGG - Intronic
1006393286 6:33771500-33771522 ATCTGCGGCAGGCAGGAGAGGGG - Exonic
1006411737 6:33877858-33877880 CTGGGGGAGAGGCAGGAGAAGGG - Intergenic
1006604261 6:35244829-35244851 CTGTGCAAAAGGGAGGAGAGAGG + Intronic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007753472 6:44083883-44083905 ATGGGTGAGAGGCAGCAGAGGGG + Intergenic
1009057624 6:58356120-58356142 CTGGGTGCCATGGAGGAGAGTGG + Intergenic
1009233198 6:61090964-61090986 CTGGGTGCCATGGAGGAGAGTGG - Intergenic
1009359815 6:62797253-62797275 TTCTCTGACAGGCAGGAGTGGGG - Intergenic
1011823389 6:91278588-91278610 CTGAGTAACAGGGAGAAGAGAGG - Intergenic
1014285768 6:119495625-119495647 ACGCGTGACAGGCAGCAGAGGGG + Intergenic
1014577957 6:123097113-123097135 CTGTGTGGGAGGCAGAAAAGAGG - Intergenic
1015826449 6:137317455-137317477 CTTTGTGACAGGCATGAGGTAGG + Intergenic
1016328982 6:142936227-142936249 CTGTCAGACAGGCTGGAGTGCGG + Intronic
1016699910 6:147042628-147042650 TTGAGAGACAGGTAGGAGAGAGG + Intergenic
1016758788 6:147715561-147715583 GTGGGTGACAAGAAGGAGAGGGG - Intronic
1017287045 6:152687884-152687906 CTCTGTGCCAGGCTGGAGTGCGG + Intergenic
1018268166 6:162048345-162048367 CTGTGTGACTGTCAGGTGTGAGG + Intronic
1018936715 6:168278613-168278635 CTGTGAACCAGGCAGGAGTGGGG + Intergenic
1019702530 7:2480845-2480867 CTGTGTGCCACGCAGGAGGGCGG - Intergenic
1020003314 7:4767995-4768017 TTGGGTGACAGGGAGGACAGAGG - Exonic
1020102542 7:5402496-5402518 CTCTGTCACAGGCTGGAGTGTGG - Intronic
1020322300 7:6948366-6948388 CTCTCTGGCAGGCAGGAGTGGGG + Intergenic
1021777750 7:24070297-24070319 CCATGTGCCAGGCAGGAGAAAGG - Intergenic
1021855868 7:24855180-24855202 GTGTGTGGCAGGCAGGGGAGGGG - Intronic
1022744247 7:33153783-33153805 CTTTGTGACAGGCTGGATTGCGG + Intronic
1023301927 7:38782356-38782378 CTGTGTGAGAGAAAGCAGAGGGG - Intronic
1023357372 7:39380916-39380938 CTGTGTGGCATTCAGGAGACAGG + Intronic
1024061324 7:45700694-45700716 CTGTGTCACTTGCAGGAGGGAGG + Intronic
1024073729 7:45808028-45808050 CTGGGAGACAGGCAGGAATGTGG - Intergenic
1024358562 7:48444017-48444039 CTCTGTAACAGGAAGGAAAGAGG - Intronic
1024751861 7:52475674-52475696 CTCAGTGGCAGGCAGAAGAGAGG + Intergenic
1024761863 7:52607852-52607874 CTATGGAGCAGGCAGGAGAGAGG - Intergenic
1025017769 7:55453519-55453541 TTGTGTGTCAGGGAAGAGAGTGG + Intronic
1026913966 7:74108759-74108781 GTGTGGCAGAGGCAGGAGAGGGG + Intronic
1027984098 7:85263356-85263378 CTATGAGACAGGCAGGACAGTGG - Intergenic
1028451397 7:90988754-90988776 TTGTGTGACAGTCATGACAGAGG + Intronic
1029175350 7:98660746-98660768 CTGTAAGACAGCCAGGAGACAGG - Intergenic
1029541421 7:101184787-101184809 CAGTGGGACAGGGAGAAGAGGGG - Intergenic
1030289492 7:107858248-107858270 GTGCTTGACAGGGAGGAGAGTGG - Intergenic
1030326362 7:108222839-108222861 CTCTGTGTCAGGCAGAAGACAGG + Intronic
1032009763 7:128337191-128337213 CTGCTTGACAGGCCGGACAGTGG - Exonic
1032240171 7:130153833-130153855 CTGTGGGGGAGGAAGGAGAGTGG + Intergenic
1032501075 7:132400378-132400400 CTGGGTGACAGGTAGGAGACAGG - Intronic
1033244299 7:139705265-139705287 CTGTGTGCCAGGCATGGCAGAGG + Intronic
1034274203 7:149816956-149816978 GCATGTGACAGGCAAGAGAGGGG - Intergenic
1034391651 7:150791983-150792005 GTGTGGGACAGGTAGGAGTGCGG - Intronic
1034551679 7:151824631-151824653 CTGTGAGAGGAGCAGGAGAGAGG - Intronic
1035703017 8:1651608-1651630 CTGTGGGCCAGGCAGGAGCCCGG - Intronic
1037665908 8:20969963-20969985 CTGTGGCACAGGAAGGAGAGAGG - Intergenic
1037855683 8:22369091-22369113 CTGTGTGGTAGCCAGGAGATAGG + Intronic
1038005605 8:23427362-23427384 CTGTGTGACTGGAAGGGGAAAGG - Intronic
1038359257 8:26861134-26861156 CTGTGTCACATGCAGCTGAGAGG - Intronic
1038700042 8:29841367-29841389 CTGTGTGGCTGGCAGGAGAGAGG - Intergenic
1038903125 8:31866247-31866269 ATCTGTGACAGGCAGTTGAGAGG + Intronic
1039536481 8:38319231-38319253 GTGTCTGGAAGGCAGGAGAGGGG + Intronic
1039967254 8:42292421-42292443 CTGGGTGACAGCAAGGACAGGGG - Intronic
1040395639 8:46997573-46997595 CTTTGTCACAGGTAGGAGAATGG + Intergenic
1040447530 8:47510989-47511011 CTGTGAGAAACACAGGAGAGAGG + Intronic
1041305127 8:56449678-56449700 TTGGGTGACAGGAAGGGGAGGGG - Intergenic
1042375802 8:68050803-68050825 CTGTGAGGCAGAGAGGAGAGTGG + Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043185631 8:77145289-77145311 CTGTATGAAACACAGGAGAGTGG + Intergenic
1043877704 8:85505206-85505228 CTGTCTGTCAGGCTGGAGTGCGG + Intergenic
1044019191 8:87083623-87083645 CTGTGTCCCAGGCTGGAGTGCGG + Intronic
1045405758 8:101865369-101865391 CAGTGAGGCAGGGAGGAGAGAGG - Intronic
1045559329 8:103245748-103245770 ATCTGTGACTGGAAGGAGAGAGG + Intergenic
1047523581 8:125614436-125614458 GTGTGTGACAGGTGTGAGAGGGG + Intergenic
1047920317 8:129628572-129628594 CTGTGGCACGGGCAGGAGATAGG - Intergenic
1048770188 8:137886728-137886750 CTGGGGGACAAGCAGGAAAGAGG + Intergenic
1048919012 8:139210908-139210930 CTGTGTGACAGACAGGGCAGAGG - Intergenic
1048925383 8:139266630-139266652 ATGTGTGAGAAGCAGGAAAGTGG + Intergenic
1048948375 8:139472009-139472031 CTTTGACACAGGCAGGACAGGGG - Intergenic
1049010117 8:139881886-139881908 CTGGGGGACAGTAAGGAGAGGGG - Intronic
1049360757 8:142211595-142211617 CTGGGTGGCAAGCAGCAGAGAGG + Intergenic
1050547197 9:6718967-6718989 CACTGTGTCAGGCAGGTGAGTGG + Intergenic
1051095753 9:13463567-13463589 CTGTCTGCCAGGCTGGAGTGCGG - Intergenic
1051358775 9:16263665-16263687 CTGAGTGACAAGCAGGGGAGCGG + Intronic
1052406674 9:28070045-28070067 CTGTGTGACATTAAAGAGAGTGG - Intronic
1052914691 9:33915912-33915934 CTGAGTGACAGGAAGGAGCCAGG + Intronic
1053647754 9:40133172-40133194 CTGTGAGACCTGCAGGACAGGGG - Intergenic
1053757977 9:41330671-41330693 CTGTGAGACCTGCAGGACAGGGG + Intergenic
1054460266 9:65458723-65458745 GTGTGAGGCAGGCGGGAGAGGGG - Intergenic
1054536826 9:66242998-66243020 CTGTGAGACCTGCAGGACAGGGG + Intergenic
1054789941 9:69247333-69247355 CTGTGCTGCAGGGAGGAGAGAGG + Intronic
1055033258 9:71791924-71791946 CTGCGTGACAGGGAGCAGTGAGG + Intronic
1055235744 9:74120722-74120744 CTGTGAGGCAGGCAGGAGTAGGG + Intergenic
1055322028 9:75091524-75091546 CTGGTTGACAGCAAGGAGAGTGG + Intronic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1057523298 9:95777721-95777743 CTGTGTTCCAGGCAGCAGAATGG + Intergenic
1058569112 9:106321795-106321817 TTATGTTACAGGCAGAAGAGGGG - Intergenic
1058839314 9:108890884-108890906 CTGTGGGGAAGGAAGGAGAGTGG - Intronic
1059391492 9:114002217-114002239 CAGGGTGCCAGGCAGGAGAAGGG + Intronic
1059846503 9:118283200-118283222 CTGTGTGCCAGGAAAGAGACTGG + Intergenic
1060405707 9:123372154-123372176 CTGTGGGAGAGGCAGGGCAGGGG - Intronic
1060439575 9:123626345-123626367 CTGTGTGTCTGGGGGGAGAGGGG + Intronic
1060668513 9:125447957-125447979 ATGTGTGGCAGGCAGGTGGGAGG + Intronic
1061202107 9:129143855-129143877 CTGTGGGACAGGCGGGGGTGGGG - Intronic
1061468801 9:130805851-130805873 CTTTTAGACAGGCAGGACAGAGG + Intronic
1061860398 9:133465012-133465034 CTGTGTGACATGGAGGAAAGGGG - Intronic
1062068161 9:134540041-134540063 CTGTGGGACAGGGAGGAGGTAGG - Intergenic
1062646241 9:137549995-137550017 AGCTGTGACAGGCAGCAGAGAGG + Intronic
1202795531 9_KI270719v1_random:116464-116486 CTGTGAGACCTGCAGGACAGGGG - Intergenic
1185552868 X:997949-997971 CTGTGTTACTGGCGGGAGAAGGG - Intergenic
1186225510 X:7395156-7395178 CTGTGTGTCTAGCAGTAGAGAGG + Intergenic
1186397742 X:9226583-9226605 CTGAGTCACAGGGAGGTGAGAGG + Intergenic
1187202329 X:17146869-17146891 CTGGGTGAAAGGCAGAAAAGAGG - Intronic
1187474823 X:19601639-19601661 CTGTGGGTGAGGCTGGAGAGGGG + Intronic
1187506612 X:19883531-19883553 CTATGTGACAGGCAGGGGCAGGG - Intronic
1188329198 X:28847705-28847727 GACTGTGACAGGCAGGGGAGCGG - Intronic
1189222450 X:39384003-39384025 CTGTGTGGCAGGCACTATAGAGG - Intergenic
1189240201 X:39518994-39519016 CTGTGTCACGGGCAGGAGGTCGG - Intergenic
1189467477 X:41288354-41288376 TTGGGTCACAGGAAGGAGAGAGG + Intergenic
1191999512 X:67133668-67133690 ATGAGTGTCAGGCAGGGGAGAGG - Intergenic
1193070275 X:77299119-77299141 TTGTGTGCCAGGCAGAACAGTGG - Intergenic
1194454808 X:94089858-94089880 CTGTGTGCCAGGCACTAAAGTGG + Intergenic
1194665856 X:96676728-96676750 CTGTGTGCATGGCAGGGGAGGGG + Intergenic
1199683393 X:150242979-150243001 CTGGGAGACAGGCAGGAGGGAGG + Intergenic
1199715835 X:150506832-150506854 TTGTGTGCTGGGCAGGAGAGAGG - Intronic
1200777089 Y:7179146-7179168 TTGTGTGGCAGGCAGGACAGAGG - Intergenic
1201017760 Y:9623407-9623429 CTGTGGGACAGGAAGGGGCGGGG - Intergenic
1202140831 Y:21720118-21720140 CTGTCTGCCAGGCTGGAGTGCGG - Intergenic
1202146034 Y:21783680-21783702 CTGTCTGCCAGGCTGGAGTGCGG + Intergenic