ID: 970410216

View in Genome Browser
Species Human (GRCh38)
Location 4:15798641-15798663
Sequence CCATTTGGCCATATGCAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970410216_970410220 17 Left 970410216 4:15798641-15798663 CCACGTTGCATATGGCCAAATGG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 970410220 4:15798681-15798703 TCACTTTATTTTCACAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970410216 Original CRISPR CCATTTGGCCATATGCAACG TGG (reversed) Intronic
900914258 1:5623688-5623710 CCATTTGGCCAAATGAAGGGAGG + Intergenic
908039473 1:60093207-60093229 CCAGTTTGCAATATGCAATGTGG + Intergenic
917833677 1:178922022-178922044 CCATTTGTCCACATGCGAGGTGG - Intergenic
920797138 1:209150356-209150378 CCATGTTGCCATATGCGATGAGG - Intergenic
921956960 1:220994846-220994868 CCAGTTGGCCCTTTGCAATGGGG - Intergenic
922593617 1:226797468-226797490 CCATTTCTCCATCTGCAAAGTGG + Intergenic
924252020 1:242142438-242142460 CCATTTGGAAATATACAAAGGGG - Intronic
1073946043 10:108751773-108751795 CCATTAGTCCATATTCAAAGAGG - Intergenic
1074869746 10:117567326-117567348 CCATTTGCTCATCTGCAAAGTGG - Intergenic
1076603052 10:131671420-131671442 GCAAATGGCCACATGCAACGTGG + Intergenic
1082015074 11:47479550-47479572 TCATTTGGTCATCTGCAACAGGG - Intronic
1088937583 11:114419283-114419305 TCATTTGGCCAGATTCAACAGGG + Intronic
1092299409 12:7231241-7231263 CCATTTGGCCACATGCCAGTTGG + Intergenic
1100560059 12:95739392-95739414 CCATTTATCCACATGCAAAGTGG + Intronic
1101135837 12:101742179-101742201 ACATTTGGGAAAATGCAACGTGG + Intronic
1104801501 12:131558055-131558077 CCATCTGGACATTTGCAAAGTGG - Intergenic
1117035556 14:51724750-51724772 CCATTTGGCCTTATGGATCTAGG + Intronic
1135628110 16:24013936-24013958 CCAGGTGGCCATCTGCACCGGGG - Intronic
1141407178 16:83804718-83804740 CCATGTGACCACATGCAATGAGG - Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1145165617 17:20611544-20611566 CCAGTTGGCCATGTGTGACGGGG - Intergenic
1152309789 17:79543089-79543111 CCATTTGGCCACATGTAACCCGG + Intergenic
1153119086 18:1699961-1699983 CCATTTGGCCAGATCCAGCCAGG - Intergenic
1167605301 19:50478801-50478823 CCATTTTGCTATCTGCAAAGTGG - Intronic
925435883 2:3837309-3837331 CCATTTGGCCAAATACAAGCCGG - Intronic
927839527 2:26430628-26430650 CCATTTGGTCTTATGAAACTTGG + Intronic
932449404 2:71799944-71799966 CCATTTGGACAAATGAAACCTGG - Intergenic
936066626 2:109337437-109337459 ACATTTCGCCATATGCGAGGGGG - Intronic
937628108 2:124066891-124066913 CCATTTGGCCATTTAAAACAAGG - Intronic
944057214 2:195535354-195535376 CCTTATGGCTATATGCAACGAGG + Intergenic
945884169 2:215357244-215357266 CCATTGGGCCCTTTGCAACTTGG - Intergenic
948810281 2:240471803-240471825 CCATTTGGCGAGCTGCAACCTGG - Intergenic
1170732521 20:18987173-18987195 CTATTTGTCCACATCCAACGCGG + Intergenic
1170791047 20:19509812-19509834 CCTTTTGGCCATTTGAAAAGTGG - Intronic
952007097 3:28854622-28854644 CCATTTGGCCGTAGGTACCGAGG - Intergenic
954998733 3:54906561-54906583 CCATGTGTCCATATTCCACGTGG + Intronic
955986705 3:64581185-64581207 CCATTTGGCCAATTGCAAATGGG + Intronic
958692878 3:97491004-97491026 CCATGTGGGCATCTCCAACGTGG + Intronic
960701047 3:120439755-120439777 CCATTTGGCCTTATTTAATGCGG + Intronic
964813243 3:160688849-160688871 CAATTTGGCAATATGTATCGAGG - Intergenic
970410216 4:15798641-15798663 CCATTTGGCCATATGCAACGTGG - Intronic
971611896 4:28736461-28736483 CCATCTGGACATATGGAATGAGG + Intergenic
975725964 4:77292075-77292097 CCATTTGGGCAGACCCAACGTGG - Intronic
986264850 5:6182596-6182618 CCATTTCTCCAGATGCCACGGGG - Intergenic
986977343 5:13409690-13409712 CAATCTGGCCATATGAAATGGGG - Intergenic
995708690 5:115012577-115012599 GCATTTGGCCAAATGCAAACAGG - Intergenic
995828335 5:116326653-116326675 GAAGTTGGCCATCTGCAACGTGG - Intronic
1001152845 5:169247259-169247281 CCATTCCACCATATGCAAGGAGG + Intronic
1005593703 6:27356087-27356109 CAGTTTGGCTATATGCAACATGG - Intergenic
1015802923 6:137078695-137078717 CCATTTGGCCAGTTGCAATAAGG - Intergenic
1017380961 6:153829065-153829087 CCATTTCTCCATCTGCAAAGTGG + Intergenic
1023395188 7:39745494-39745516 CCATTTGGCAGTATGCCCCGAGG + Intergenic
1024213410 7:47226920-47226942 CCATTTCCCCATCTGCAAAGTGG + Intergenic
1025599574 7:62978545-62978567 CCAAATGGCTATATGCAAAGTGG - Intergenic
1033643049 7:143280951-143280973 CAATTTGGCCATATGCATTCGGG + Intronic
1036151613 8:6304520-6304542 CCATAGGGCAATATGCAAAGGGG + Intergenic
1044263517 8:90155989-90156011 CCATTTGGCCAAAAGCTAGGTGG + Intergenic
1048951481 8:139500462-139500484 CCATTTGGCCATAAGCAGTTTGG - Intergenic
1055895419 9:81168950-81168972 CCTCTTGGTCATATGGAACGTGG + Intergenic
1056778551 9:89532368-89532390 CCATGTGGCAATATGCAAGATGG + Intergenic
1058581084 9:106458166-106458188 CCATTTGCCCATTTGCTATGAGG - Intergenic
1198107592 X:133476176-133476198 TCATTTGGTCATTTGCAAAGTGG + Intergenic