ID: 970411886

View in Genome Browser
Species Human (GRCh38)
Location 4:15816873-15816895
Sequence AGGGGCTTTGGCCAAAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970411886 Original CRISPR AGGGGCTTTGGCCAAAAACT AGG Intronic
900888811 1:5434367-5434389 GGAGGCTTTGGCCAGAAATTTGG + Intergenic
903683952 1:25117401-25117423 AGAGGCCCTGGCCAAAACCTTGG - Intergenic
904493414 1:30873913-30873935 AGGGACTGGGGTCAAAAACTGGG + Intronic
904845258 1:33408037-33408059 ATAGGCTTGGGCCAAAATCTAGG - Intronic
906921787 1:50072307-50072329 AGACACTGTGGCCAAAAACTAGG + Intronic
911161351 1:94685577-94685599 AGTGGCTTTCCCCAAAAAGTGGG + Intergenic
911201733 1:95051256-95051278 AGTGGCTCAGGCCAAAAACCTGG + Intronic
911370802 1:96992801-96992823 AGTGGCGTAGGCTAAAAACTTGG - Intergenic
913103430 1:115591516-115591538 TAGGGCTTTGACCAAAAGCTTGG - Intergenic
913271967 1:117103142-117103164 AGGGCTGATGGCCAAAAACTAGG - Exonic
914332316 1:146683619-146683641 ATTTGCTTTGGCTAAAAACTGGG - Intergenic
915068520 1:153246030-153246052 AGGTGCTTTAGCCAAACCCTTGG - Intergenic
916127248 1:161582231-161582253 AGGGTCTTTGGCCAAAATGGAGG + Intronic
916137167 1:161664035-161664057 AGGGTCTTTGGCCAAAATGGAGG + Intronic
924295007 1:242577681-242577703 GGGGTCCTTGGCCAAAAGCTTGG - Intergenic
1063580531 10:7302186-7302208 AGGGACTTTGGCAAAAAAGGAGG - Intronic
1065294222 10:24259305-24259327 AGGTGCTTTGTCAAAATACTTGG + Intronic
1066020678 10:31297621-31297643 AAAGGCTTGGGCCAAAACCTTGG - Intergenic
1067262762 10:44708725-44708747 AGTGGCTTTGGCCATGAGCTGGG - Intergenic
1067681588 10:48445242-48445264 AGAGGCTGTGGTCAGAAACTGGG + Intergenic
1070230173 10:74557890-74557912 AAAGGCTTTGTCTAAAAACTTGG + Intronic
1070515951 10:77206630-77206652 AGTGGAGATGGCCAAAAACTTGG - Intronic
1073142150 10:101255221-101255243 AGGGGCTTTGGCCAGAGTCCAGG + Intergenic
1074117304 10:110466023-110466045 AGTGGCTTTGGAAAACAACTGGG + Intergenic
1075825260 10:125351329-125351351 AGGTTCTTTGGCTATAAACTAGG + Intergenic
1077167915 11:1152085-1152107 AGGGGCTGTGCCCGGAAACTGGG + Intergenic
1078280771 11:9898894-9898916 AGGGGCTAAGGACAGAAACTTGG + Intronic
1078562314 11:12383910-12383932 AGGGGCTATGGACAACAACATGG - Intronic
1080766833 11:35305077-35305099 GGGGCATTTGGCCAAAACCTGGG - Intronic
1081432790 11:42994957-42994979 AGGGGCTTGGGACAAAAAAAAGG + Intergenic
1083425858 11:62585416-62585438 TGGGGCTTTGGTTACAAACTTGG - Intronic
1085257229 11:75182032-75182054 AGGGGCTGGGGCCAAAAGATGGG - Intronic
1085848754 11:80096298-80096320 GGGGGCTTTAACCAAAAAGTTGG - Intergenic
1086157689 11:83685894-83685916 AGTTGCTCTGGCCAAAAACCTGG + Intronic
1087421727 11:97935834-97935856 AAAGCCTTTGGCCAAAAAGTGGG - Intergenic
1089311192 11:117559353-117559375 TGAGGCTTTGTCTAAAAACTCGG - Intronic
1090585070 11:128202467-128202489 AGGGGCTGTGGCCAAAGCCCAGG + Intergenic
1091611295 12:2012144-2012166 AGAGGCTTTGGAAAAATACTTGG + Intronic
1092284867 12:7122920-7122942 TAGGGCTCTGGCCAAGAACTAGG - Intergenic
1095571850 12:43692458-43692480 AGGGGAGTTGGCAATAAACTAGG + Intergenic
1101213234 12:102555540-102555562 AGTGGTTATGGGCAAAAACTTGG + Intergenic
1101451344 12:104781847-104781869 AGTTGCTGAGGCCAAAAACTTGG - Intergenic
1101572324 12:105965351-105965373 ATGGGCTGTGGCCAATAATTTGG - Intergenic
1103369703 12:120409498-120409520 AGAGGATTTGCCCAAAGACTTGG - Intergenic
1103597940 12:122035466-122035488 CGGGGCCTTGGCCAAGCACTCGG + Intronic
1104149356 12:126067595-126067617 AGGGGCTTTGGCAGGAAACAAGG - Intergenic
1108056438 13:46489931-46489953 AGGGCATTTGGGCAGAAACTTGG - Intergenic
1108367355 13:49729334-49729356 AGGTGGTTTGGCAAAATACTGGG + Intronic
1109263154 13:60166935-60166957 AGGCACTTTGGACAAAAACTTGG + Intergenic
1110159989 13:72364161-72364183 AAGGGCCTTGGCCAAAATGTAGG + Intergenic
1110311425 13:74054294-74054316 AGATGCTTTGGCCAAAAATTTGG + Intronic
1111876940 13:93909637-93909659 AGGGGCTGGTGCCAATAACTAGG - Intronic
1113552182 13:111201118-111201140 TGGGGATTTGGACAAACACTGGG - Intronic
1114274967 14:21134742-21134764 AGTTGCTGTGGCCAAAACCTAGG + Intergenic
1114282035 14:21201985-21202007 AGGGGCATTATCCAAAAAGTTGG - Intergenic
1114594577 14:23900396-23900418 AGGAGCTATGGCCAATAGCTGGG - Intergenic
1117079240 14:52134255-52134277 AGGAGCTTTGGGCTAAGACTGGG - Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1118626281 14:67662299-67662321 AGGGGGTTTGGCAAACAAATGGG - Intronic
1119767270 14:77198193-77198215 TGGGGCTGTGGCCAAAACCTTGG + Intronic
1120688512 14:87566210-87566232 AAGGGCTTGGGCCAAGCACTTGG + Intergenic
1121948495 14:98146879-98146901 AAAGGATTTGGCCAAAAGCTTGG + Intergenic
1121972842 14:98374621-98374643 ACGTGCTTTGGCCAAACACCAGG + Intergenic
1128754701 15:70173683-70173705 AGGGGCTTTGCCAATACACTTGG - Intergenic
1130353310 15:83109374-83109396 AGTGGCTGAGGCCAAAACCTAGG - Intronic
1133050256 16:3113368-3113390 AGGGGGCTTGGCCAAAAAGAGGG + Exonic
1133443396 16:5839356-5839378 AAGGGCTTTTGGCAAAAAGTGGG - Intergenic
1135503368 16:23016053-23016075 AGTGGCTTAGGCCACACACTGGG - Intergenic
1138120621 16:54398226-54398248 AGGGGCTATTGCCCAAAGCTGGG - Intergenic
1138841076 16:60507395-60507417 AGGGGCTTTGGCTAAAGTCTTGG - Intergenic
1139029648 16:62863678-62863700 AGGGGTTTTTGCCAAAAGCATGG + Intergenic
1140001237 16:71027300-71027322 ATTTGCTTTGGCTAAAAACTGGG + Intronic
1140612898 16:76622569-76622591 AGCTGCTTTGGCCAAAAACTTGG - Intronic
1145061257 17:19735729-19735751 AGTGGCTGAGGCCAAAACCTAGG - Intergenic
1145209875 17:21004876-21004898 AGGGCCTCTGGCCAAGAGCTGGG - Intronic
1146637448 17:34517004-34517026 AAGGGCTTAGGCCAGAAACCCGG - Intergenic
1146708287 17:35018393-35018415 AGGAGGTTTGGCCAAAGAGTAGG + Intronic
1147623398 17:41883314-41883336 ACGGGCTTTGGCCAAATAAAAGG + Intronic
1148140331 17:45323539-45323561 AGGGGCTTAGGCCTGAAACTTGG + Intergenic
1148339983 17:46867612-46867634 GGAGGCTTTTGCCAAAACCTGGG + Intronic
1150137258 17:62702901-62702923 AGGGCCCTTGGCCAAAGGCTGGG - Intronic
1150299984 17:64039824-64039846 GGGGGCTTTGGCCAAAGTGTTGG + Exonic
1150858574 17:68777067-68777089 AGGGGTCTGGGCCCAAAACTCGG + Intergenic
1151342034 17:73477702-73477724 AGGGGCTTCAGCCAAGCACTAGG + Intronic
1151807653 17:76416516-76416538 AGGGGCTGTGTCCAAGAAGTGGG + Intronic
1154016315 18:10620966-10620988 ATGGGCTTTGGCATAAAACATGG + Intergenic
1154189199 18:12214686-12214708 ATGGGCTTTGGCATAAAACATGG - Intergenic
1163839536 19:19598103-19598125 AGGGCATTAGGGCAAAAACTGGG + Intronic
1165133121 19:33645619-33645641 AGGGGCTTAGGCTAAACATTCGG + Intronic
1167241806 19:48348268-48348290 AGGGCTTTGGGCCAAAAACCTGG + Intronic
1167539665 19:50077256-50077278 AGGGGCTTTGGACCAATCCTGGG - Intergenic
1167630044 19:50620614-50620636 AGGGGCTTTGGACCAATCCTGGG + Intergenic
1167666201 19:50823857-50823879 AAGGGCCTTGGCCAACATCTGGG - Intergenic
924981732 2:228831-228853 AGGGACTTGGGCTCAAAACTGGG + Intronic
926329758 2:11814722-11814744 AGGGGCTCTAGCCAAGAGCTGGG + Intronic
927040800 2:19228573-19228595 AGGGGCACTGGCCAAAATGTGGG - Intergenic
930295142 2:49544831-49544853 ATGGGCTTTAGCCAATGACTTGG - Intergenic
931853944 2:66282006-66282028 AGGGGCTTTGGGCATAATCTAGG - Intergenic
935113454 2:100112863-100112885 AGGAGCTTTGGAAAAACACTGGG - Intronic
937468942 2:122158703-122158725 AGTTGCTTTGGCCAGAAGCTAGG + Intergenic
939152408 2:138488463-138488485 AGGTGCTCAGGCCAAAAACTAGG - Intergenic
946859548 2:223987738-223987760 AGGGGCTTTCTGGAAAAACTGGG - Intronic
1169914460 20:10672593-10672615 AAGGGCTTTGGCTTGAAACTAGG - Intronic
1172432512 20:34904384-34904406 TGGTGCTTTTGCCAAACACTGGG + Intronic
1175065892 20:56288135-56288157 AGGTGCCTTGTCCAAAAAGTAGG + Intergenic
1178292483 21:31380856-31380878 AGGGGCTTTAGAATAAAACTAGG + Intronic
1179743047 21:43428186-43428208 AGGGGAGTTGGCACAAAACTTGG + Intergenic
1181688250 22:24543710-24543732 AGGGGCTTTGGGGAAAAGGTAGG + Intronic
1183183474 22:36277708-36277730 GGGGGCTTGGGCCAAAATCTTGG + Intergenic
1183833727 22:40434947-40434969 AGGTGCTGTGGCAGAAAACTTGG + Intronic
1185130230 22:49034844-49034866 AGGTGCCTTGGCCAAAAGCAAGG - Intergenic
950901938 3:16505765-16505787 CTGGTGTTTGGCCAAAAACTAGG + Intronic
953862716 3:46558678-46558700 CGGGCCTCTGGCCAAAAACTTGG + Intronic
954293255 3:49660806-49660828 AGAGTCTTTGGCCAAAGACCGGG + Exonic
956014306 3:64865174-64865196 AGAGGCTTTGGACCAAAATTGGG + Intergenic
956468934 3:69544650-69544672 AGGGGCTTTGGCTTAAAAATGGG + Intergenic
961180998 3:124877357-124877379 CGGGGATTTGACCAAAAAATGGG - Intronic
962262786 3:133925592-133925614 AGGTGATTAGACCAAAAACTTGG - Intergenic
967594526 3:191314260-191314282 ACAGGCTTTGACCAAAGACTTGG + Intronic
969181655 4:5446613-5446635 AGGGGTGGTGGCCATAAACTGGG + Intronic
969206844 4:5653589-5653611 AGGGGCATTTGGTAAAAACTAGG + Intronic
970411886 4:15816873-15816895 AGGGGCTTTGGCCAAAAACTAGG + Intronic
970737043 4:19184010-19184032 ACAGGCTTTGACCAAAATCTAGG + Intergenic
986605145 5:9515505-9515527 AGGGGAGTTGGCAAAGAACTTGG + Intronic
988543246 5:32131852-32131874 AGCAGCTTTGGCCATAAATTTGG + Intronic
990382265 5:55229531-55229553 AGGGGCTATGCAGAAAAACTTGG - Intergenic
994078609 5:95681326-95681348 TGGGGGTTAGGCCAAAAAGTAGG - Intronic
994332779 5:98526844-98526866 AGGGGCTGTGGGCAGAAGCTGGG - Intergenic
995738070 5:115324784-115324806 AGGGGTTTTGGCCAAAAGAAAGG - Intergenic
995756107 5:115506172-115506194 AGGGGCTCTAGACAAATACTTGG - Intergenic
997194025 5:131965828-131965850 AGTGGTTTTGGCTAAAAGCTGGG + Intronic
997263796 5:132483362-132483384 AGGGGCTTGGGAAAAAAACTTGG - Exonic
998158091 5:139797302-139797324 GGGGGCTCTGGCCAAACCCTAGG - Intronic
998334595 5:141360249-141360271 AGAGGAGCTGGCCAAAAACTCGG + Exonic
999268681 5:150283654-150283676 AAGGGCTTTGGCCACACACATGG - Intronic
1001279890 5:170379088-170379110 CGGGGCTTTGGTCTAAAGCTTGG + Intronic
1003974996 6:11333960-11333982 AAGGGCTTTAGCCCAAAAGTTGG + Intronic
1008062227 6:47010487-47010509 AGAAGCTTTGGGCAAAATCTTGG + Intronic
1015043252 6:128746691-128746713 AAGTGCTTTGGCCAAGAACTTGG + Intergenic
1015906796 6:138125539-138125561 AGGAGCTTTGGGCCAAGACTAGG - Intergenic
1018282831 6:162206429-162206451 GGGGGCTTTGGACAAAGGCTTGG - Intronic
1018961888 6:168455133-168455155 TGGGGCTTTGTCCAAGAACCAGG + Intronic
1021101881 7:16593701-16593723 AGAGGGTTTGGCTAAAAGCTGGG + Intergenic
1021612219 7:22468646-22468668 AGGGGCTTAGGTTAAAAATTTGG + Intronic
1022394354 7:29972440-29972462 AGGTGCCTTGGCCAAACAATAGG - Intronic
1029177612 7:98675902-98675924 AGGGGCTCTGGCCACAGAATTGG - Intergenic
1030318510 7:108140730-108140752 AGGGGCTCTGGTCAGAAATTTGG + Intergenic
1032456086 7:132074635-132074657 AGGGACTTGGGCCAGACACTTGG + Intergenic
1044323606 8:90834380-90834402 AGGGCCTTTGGCAAATGACTAGG + Intronic
1045186286 8:99841818-99841840 AGGCGCTATGGCTAAAATCTGGG - Intronic
1045536861 8:103037974-103037996 AGGGGCTTTGGAGAACAATTTGG + Intronic
1045748652 8:105455332-105455354 GGGGGGTTTGAGCAAAAACTGGG + Intronic
1046131186 8:109970543-109970565 TGGGTTTTTGGCCAGAAACTAGG - Intronic
1046499849 8:115061428-115061450 AGGGACTTTGGCCAAGAGTTTGG + Intergenic
1046993362 8:120486676-120486698 AGCGGCTGTGGCCAAAAAGATGG - Intronic
1047410265 8:124618762-124618784 AGGGGCTTTTCCCAGATACTTGG + Intronic
1051399520 9:16664462-16664484 AGAGGCCTTGAGCAAAAACTTGG - Intronic
1052188795 9:25631797-25631819 AGGGGCTAAGGCCAAAATCATGG + Intergenic
1055052067 9:71991011-71991033 AGGGGCTTTGGCTAAGATCTGGG - Intergenic
1057384228 9:94593468-94593490 AGGTGCTTTGGCAAGAAACTGGG - Intronic
1057415744 9:94860679-94860701 AGCGGCTTCTGCCAGAAACTCGG - Intronic
1060202734 9:121661154-121661176 AGGGGTTTTGGCACAAGACTGGG + Intronic
1061217550 9:129230473-129230495 AGTGCCTTTGGCCAAAGTCTAGG - Intergenic
1061962080 9:133993350-133993372 CAGGACTTTGGCCAAAAGCTGGG - Intergenic
1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG + Intronic
1062173014 9:135145730-135145752 AGGATCTTTGGCTAAAAACCTGG - Intergenic
1062189121 9:135238264-135238286 AGGAGCTTGGGCCAACAACCAGG - Intergenic
1186724129 X:12338691-12338713 AGGAGCTTTGGCCAAACAGTTGG + Intronic
1187006671 X:15239489-15239511 AGGGATGTTGGCCAAAAGCTAGG + Intronic
1188803655 X:34560811-34560833 TAGGGCTTTGACCCAAAACTTGG + Intergenic
1189097153 X:38152401-38152423 AAAGGCTTTGGTAAAAAACTAGG + Intronic
1191916871 X:66210820-66210842 AGGTGCTTAATCCAAAAACTTGG - Intronic
1192542762 X:71989137-71989159 TGGTGCTTTGGCAAAACACTTGG + Intergenic
1194221891 X:91204544-91204566 AGGGGCTTTCCCTAAAAATTTGG + Intergenic
1195209423 X:102638317-102638339 AGAGGCTGAGGCCACAAACTGGG - Intergenic
1195704875 X:107731696-107731718 AGAGGCGTTGGCCAAGAGCTGGG + Intronic
1195963872 X:110413031-110413053 TTGGGCTGTGGCCAAGAACTGGG - Intronic
1196760575 X:119197455-119197477 AGGGGCATTTGGCAAAATCTGGG - Intergenic
1197365834 X:125563574-125563596 TAGGGCTTTGGCCCAAAGCTTGG + Intergenic
1200558413 Y:4668309-4668331 AGGGGCTTTCCCTAAAAATTTGG + Intergenic
1201367518 Y:13224438-13224460 AGGGGCTAAGGACAAAAACCTGG + Intergenic