ID: 970413956

View in Genome Browser
Species Human (GRCh38)
Location 4:15838144-15838166
Sequence GTAAAATCTTTGACAAAAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 328}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970413951_970413956 16 Left 970413951 4:15838105-15838127 CCTGTGATGTGGTCCATGTGATG 0: 1
1: 0
2: 1
3: 9
4: 148
Right 970413956 4:15838144-15838166 GTAAAATCTTTGACAAAAACAGG 0: 1
1: 1
2: 2
3: 24
4: 328
970413953_970413956 3 Left 970413953 4:15838118-15838140 CCATGTGATGCTCAATGGATCCC 0: 1
1: 0
2: 0
3: 10
4: 87
Right 970413956 4:15838144-15838166 GTAAAATCTTTGACAAAAACAGG 0: 1
1: 1
2: 2
3: 24
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970413956 Original CRISPR GTAAAATCTTTGACAAAAAC AGG Exonic
902971550 1:20056091-20056113 GTAAAATCTTTTAAAAGAAGGGG - Intronic
906074683 1:43043256-43043278 GTCAAATGTTTGAAAAGAACGGG + Intergenic
908457350 1:64316750-64316772 GTAAAATCATTGCCACAATCAGG + Intergenic
908626005 1:66043316-66043338 GTTGAATCTTTGAGCAAAACTGG + Intronic
909502476 1:76351031-76351053 GTAAGATCTGGGACAAAATCTGG - Intronic
910211949 1:84802538-84802560 GTAAAATCATGGAAAAAAATGGG - Intergenic
910510662 1:88000520-88000542 GAAAAATGTTTCACAAACACAGG + Intergenic
911962467 1:104323091-104323113 AGAAAATCTTTCACAAAAATTGG + Intergenic
913021697 1:114794433-114794455 TTAAAATTATTGACAAAAATAGG - Intergenic
913253773 1:116935761-116935783 GTACATTCTTTCAAAAAAACAGG - Intronic
914097711 1:144558434-144558456 GTAAAATTTTTAACAAACATTGG + Intergenic
914325249 1:146607897-146607919 TTAAAATGTTTTAGAAAAACTGG - Intergenic
916669737 1:167004035-167004057 GTAAAATCCTTAACAAAAACGGG + Intronic
917052853 1:170943132-170943154 AAAAAATCAATGACAAAAACTGG + Intronic
917184437 1:172337519-172337541 TTAAAGTATTTGAGAAAAACAGG + Intronic
919324300 1:196086871-196086893 GTAAAATATATGACCAAAAAAGG + Intergenic
919401726 1:197126777-197126799 GTAAACTGTTTTTCAAAAACCGG + Intronic
921422116 1:214960335-214960357 CTAAAAGCTTTGACAAACTCAGG - Intergenic
923757690 1:236807919-236807941 GTAAAACTATTTACAAAAACAGG + Intronic
924358101 1:243205512-243205534 GTAAACTCATTGACCAAATCTGG - Intronic
924396007 1:243621632-243621654 GTATAATCAGTGACATAAACTGG + Intronic
1063271250 10:4512653-4512675 ATAACATCTTTGACAAACCCTGG + Intergenic
1064892471 10:20193098-20193120 GTAAAAACTTAGACAAGAGCAGG - Intronic
1066096427 10:32076716-32076738 GTAATATCTTTTATAATAACTGG + Intergenic
1067838370 10:49655632-49655654 ATAAAATCCATGTCAAAAACAGG - Intronic
1068144388 10:53048248-53048270 GTAGAATCTTTGAAAATTACTGG - Intergenic
1068786313 10:60979221-60979243 GTAAATTCTTAGGCAAAAAAAGG - Intronic
1069004150 10:63298330-63298352 GTGACATCTGTGACATAAACAGG + Intronic
1071067595 10:81655100-81655122 ATAAATTCTTTGATAAAAAGAGG - Intergenic
1071410714 10:85391105-85391127 GTAAAATGAATGGCAAAAACAGG + Intergenic
1071536385 10:86435133-86435155 ATAAAATATTTAACAAAAACTGG + Intergenic
1074511182 10:114113782-114113804 GTAAAAGGTTTCACAAAAAGTGG + Intergenic
1076485435 10:130812715-130812737 GTAAAATGTTTGAAAACTACTGG + Intergenic
1079901214 11:26187792-26187814 TGAAAATCTTTGACTAAAAAAGG - Intergenic
1080072264 11:28103778-28103800 GTACAATAGTTGACAACAACAGG + Intronic
1080831948 11:35902998-35903020 GTCAAAGCTTTACCAAAAACTGG + Intergenic
1080928280 11:36781437-36781459 TTAAAATCTATGATCAAAACTGG - Intergenic
1081452222 11:43182243-43182265 CTAAGAGCTTTGACAAACACAGG - Intergenic
1083233465 11:61337627-61337649 GTAAAATATTTTAATAAAACTGG - Intronic
1084513889 11:69624999-69625021 GTAAAATCTCTGAAACAACCTGG + Intergenic
1085661749 11:78374046-78374068 GTCAAATCCTTGCCAAAAATGGG - Intronic
1085661771 11:78374321-78374343 GTGAAACCTGTGACAAATACCGG - Intronic
1087628872 11:100627321-100627343 GTAAAAGTTTTGTGAAAAACTGG + Intergenic
1087727020 11:101731070-101731092 GACAAATCTGTGGCAAAAACTGG - Intronic
1087783132 11:102322198-102322220 TTAAAATCTTTCCCAAACACAGG - Exonic
1087788550 11:102383176-102383198 GGAAAATCTTTTACACACACAGG + Intergenic
1088493419 11:110408409-110408431 GGAAAATCTGTGACAAATAGAGG + Intergenic
1090474924 11:127011290-127011312 GTAAGATGTTTGACAAATGCAGG - Intergenic
1090583442 11:128184677-128184699 GGAAAATCTTAGAGTAAAACTGG + Intergenic
1092103907 12:5907418-5907440 GTAAAAGGTTTCACAAATACTGG - Intronic
1092563782 12:9643257-9643279 GTAAACTCTTTGAGAAAAGTTGG - Intergenic
1092989781 12:13885469-13885491 GTGAAATCTTTCACATTAACGGG - Intronic
1093063348 12:14630441-14630463 GGAAAATGTTTGGAAAAAACAGG + Intronic
1093166916 12:15814685-15814707 GTAAGATCATTGTCAAAAAAAGG + Intronic
1093228557 12:16514913-16514935 GTAAACTCTTTGAGAAAAGTTGG - Intronic
1094157475 12:27352042-27352064 CTAAAAGCTTTGACAAACAAGGG - Intronic
1094466540 12:30759532-30759554 GTATAATTTTTTACAAAAATGGG + Intergenic
1094502424 12:31033232-31033254 CTAACATTTTTGACAAAAACTGG - Intergenic
1097550677 12:61064284-61064306 TTAAAATCATTAACAAACACTGG + Intergenic
1098135927 12:67401686-67401708 GTAAAACTATTGACAAAAACAGG - Intergenic
1099021315 12:77408010-77408032 GTAAAACCTTTAAGAAATACAGG - Intergenic
1099061457 12:77915464-77915486 GTTGAACGTTTGACAAAAACAGG + Intronic
1099326401 12:81220720-81220742 GTAAAATGTTTGTCAAAAAGTGG - Intronic
1101353958 12:103959300-103959322 GTAAAATATATGAGAAAGACTGG + Intronic
1101641867 12:106591597-106591619 GTATAATTGTTGACAAAAATAGG + Intronic
1104145228 12:126026956-126026978 GTAAAATCTTTAAATAAAATGGG - Intergenic
1106184647 13:27398660-27398682 GAAAAAACTTTAACAGAAACTGG - Intergenic
1106969867 13:35126418-35126440 ATAAAATATTGGACAAATACTGG + Intronic
1106973783 13:35180524-35180546 GTAAAAGGTTTGAAAAAAACTGG - Intronic
1107322031 13:39200328-39200350 GTAAGATCATTGACAGAAAGAGG + Intergenic
1107366909 13:39689311-39689333 TTGAAATCTTTCAGAAAAACTGG - Intronic
1108569075 13:51731450-51731472 GAAATATATTTGAGAAAAACAGG + Intronic
1109707846 13:66121991-66122013 CGAAAATCTTATACAAAAACAGG + Intergenic
1110024380 13:70515817-70515839 AAAAAAACTTTGACAATAACAGG - Intergenic
1110491100 13:76109058-76109080 CTAAACTCTATGACAAAAACAGG - Intergenic
1110573329 13:77028932-77028954 ATAAAATATTTGCCAATAACAGG - Intergenic
1110982989 13:81926086-81926108 TTAGAATATTTGACATAAACTGG - Intergenic
1111645785 13:91030516-91030538 GGAAGATCTTTGACAGAAAGAGG + Intergenic
1112217458 13:97448152-97448174 GGAAAAGATTTGAGAAAAACAGG - Intronic
1112613511 13:100979552-100979574 GTAGAAACATTGACAAAAATGGG + Intergenic
1112762046 13:102702566-102702588 GTAAGATCCTGTACAAAAACAGG + Intergenic
1114515888 14:23300257-23300279 GGAACATCTGTGCCAAAAACTGG + Intronic
1115948158 14:38687761-38687783 GAAAAATCTTTTAGAAAAAAAGG + Intergenic
1116008254 14:39321138-39321160 GTAAAATATTTGGAAAATACAGG + Intronic
1116599360 14:46899745-46899767 TTAAAACCTTTGAGAAATACTGG + Intronic
1116942274 14:50802605-50802627 GTAAAATCTTACATAAACACAGG + Intronic
1117559261 14:56919208-56919230 GTGAGAAATTTGACAAAAACTGG + Intergenic
1117566478 14:56999095-56999117 GAACAAGCTTTGGCAAAAACTGG + Intergenic
1120262689 14:82206605-82206627 GTGACATCTTTGTCAAAAATGGG + Intergenic
1120937581 14:89912649-89912671 CTAAAACGTATGACAAAAACAGG - Intronic
1121083008 14:91123876-91123898 GTTAAAACATTGAAAAAAACAGG - Intronic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1123146017 14:106130651-106130673 GTGAAATTTTAGACAAAAAAGGG - Intergenic
1202943313 14_KI270726v1_random:4173-4195 CTAAAAACTTAGACAAAAAAGGG + Intergenic
1124202650 15:27691526-27691548 GTAAAATCTTTGACAAACACTGG + Intergenic
1124818139 15:33017574-33017596 ATAAAATATTGGACAATAACTGG + Intronic
1125103610 15:35944897-35944919 ATAGAATTTTTCACAAAAACTGG - Intergenic
1127242663 15:57134948-57134970 TTAATATCCATGACAAAAACAGG - Intronic
1127437356 15:58971178-58971200 GTTAAATGTATGACAAAAATGGG - Intronic
1127633982 15:60851811-60851833 GTAAGCTTTTTGACAAAAGCTGG - Intronic
1129066523 15:72909150-72909172 GTAACATCTTTGATAGAACCTGG - Intergenic
1130400564 15:83549128-83549150 GTAAAATTTTTATCAAAAATTGG - Intronic
1130680770 15:85994480-85994502 GTAAAATTTTTAAAAAAAAAAGG - Intergenic
1131805674 15:96119738-96119760 CTAAAATCTTTGCCAAAACTAGG + Intergenic
1132162397 15:99555325-99555347 TTGAAATTTCTGACAAAAACAGG + Intergenic
1132251548 15:100339432-100339454 TTAAACACTTTGGCAAAAACAGG + Intronic
1132305389 15:100808161-100808183 GAAAAAGCTGTGACACAAACAGG + Intergenic
1133172657 16:3991453-3991475 GTAACATTTTTGAAAAATACAGG - Intronic
1136035637 16:27537876-27537898 GAAAAATTTTGAACAAAAACGGG - Exonic
1136693095 16:32051140-32051162 GTGAAATTTTAGACAAAAAAGGG + Intergenic
1136793587 16:32994363-32994385 GTGAAATTTTAGACAAAAAAGGG + Intergenic
1136876324 16:33860021-33860043 GTGAAATTTTAGACAAAAAAGGG - Intergenic
1137950667 16:52780665-52780687 ATAAAACCATTTACAAAAACAGG - Intergenic
1138683901 16:58707911-58707933 GTAAACTCTTTGAGAAAAGTTGG + Exonic
1139287489 16:65828591-65828613 GTCAAATCTTAGAGATAAACAGG + Intergenic
1140008314 16:71103049-71103071 TTAAAATGTTTTAGAAAAACTGG + Intronic
1140289685 16:73641484-73641506 GTAAAATCTCTGAGAAAATTAGG + Intergenic
1142106876 16:88309094-88309116 GGAAAATCTGTGAGAAAACCGGG - Intergenic
1203095850 16_KI270728v1_random:1256056-1256078 GTGAAATTTTAGACAAAAAAGGG + Intergenic
1146427837 17:32760481-32760503 TTGAAATCTTTGACAACAACAGG - Exonic
1146990761 17:37269897-37269919 GTAAAAGATTTGTCAAAAAATGG - Intronic
1147027982 17:37605705-37605727 GTAAAAGCTTGGCAAAAAACTGG + Intronic
1148277115 17:46314745-46314767 GAAAAATGCTTGACAAAATCTGG - Intronic
1148299231 17:46532321-46532343 GAAAAATGCTTGACAAAATCTGG - Intronic
1148363850 17:47037527-47037549 GAAAAATGCTTGACAAAATCTGG - Intronic
1148425948 17:47596161-47596183 GTAAATTCTATCATAAAAACTGG - Intronic
1149598115 17:57875853-57875875 GTAAAATTTTTGGTAAGAACTGG + Intronic
1153164181 18:2243289-2243311 AAAGAGTCTTTGACAAAAACAGG + Intergenic
1155121587 18:22826164-22826186 GTAAAATCTTTAACAAAGATAGG - Intronic
1155553083 18:26987555-26987577 ATAAAATATATGACAACAACAGG + Intronic
1156526506 18:37772941-37772963 GTAAAATCCTTGCTAAAAAATGG + Intergenic
1156726284 18:40132056-40132078 ATAAAATCTTTAACATAAAGGGG + Intergenic
1156970892 18:43153791-43153813 GGAAATTCTGTGACATAAACTGG + Intergenic
1159342429 18:67153143-67153165 GTAAAAAATATGACAAAAGCAGG + Intergenic
1159775495 18:72599379-72599401 GTAAAATCATGGACAAATATGGG - Intronic
1159840364 18:73392307-73392329 GTAACATCTTAGACAAAGCCTGG + Intergenic
1160208076 18:76853409-76853431 GTAAAGACATTGATAAAAACAGG - Intronic
1164362478 19:27529813-27529835 GAAATATGTTTGAGAAAAACTGG + Intergenic
1164406538 19:27952378-27952400 ATAGAATCTTAGAGAAAAACCGG + Intergenic
1164831614 19:31326108-31326130 GTATATTCTTAGACAAAAACAGG + Intronic
1165125416 19:33592371-33592393 GTAAAATTTATTACAAAAACAGG - Intergenic
1167979004 19:53256993-53257015 ATAAATACTTTGACAAAAATAGG + Intergenic
926510142 2:13766134-13766156 GTAAAATCTATTTTAAAAACTGG - Intergenic
926534642 2:14096102-14096124 GCAAAATCTTTGCCAAAATTTGG - Intergenic
926665139 2:15513427-15513449 GTAAAATATTTCACAAAAAAAGG + Intronic
926990276 2:18672143-18672165 GAAAAGTCTTTGATAAAATCTGG - Intergenic
927269559 2:21191369-21191391 TTAAAATCTTCTACAAAAAGGGG - Intergenic
927427119 2:22993951-22993973 GCAAAATCTTTGTCAGAAAGTGG + Intergenic
927828291 2:26325296-26325318 GTGAAATATTTGACAAGAAGAGG + Intronic
927850764 2:26497921-26497943 TAAAAATCTTTGGCAAAAAAGGG - Intronic
929975427 2:46629545-46629567 GTAATATATTTGAAAAATACAGG + Intergenic
931076383 2:58718031-58718053 GTAAAACCTTTCCCAAAAACAGG - Intergenic
931781855 2:65585512-65585534 GCAACATATTTGACAAAAATAGG - Intergenic
932153308 2:69392534-69392556 GTAAAATATTTTATAAAAGCTGG + Intergenic
932183302 2:69669254-69669276 ATAAATTGTTTGACAAAAATGGG - Intronic
932513340 2:72318263-72318285 GTAAAATCAATAACAAAAAAAGG + Intronic
932539196 2:72633974-72633996 GTAAAATCTTTAAAATAAATAGG + Intronic
932708008 2:74041691-74041713 TGAAAATTTTTGAAAAAAACTGG + Intronic
933083625 2:78026007-78026029 GTAAAATATTTTATAACAACTGG + Intergenic
933438049 2:82274130-82274152 CTAAGATTTTTGACATAAACTGG + Intergenic
933873831 2:86598285-86598307 GTAAAAAGTTTGGCAAAAGCTGG + Intronic
935081294 2:99798088-99798110 GTAAAATGTTTGACAACAATAGG + Intronic
935285147 2:101557878-101557900 GGAAAATCTTTGAAAATAAAAGG - Intergenic
937005033 2:118503687-118503709 GTAAAATCTTTAAGAAAGACTGG + Intergenic
939745622 2:145962731-145962753 TTATAATCCTTAACAAAAACAGG + Intergenic
940084576 2:149844435-149844457 ATAAAATTCTTGACAAGAACTGG + Intergenic
940277798 2:151957624-151957646 GTAAATTCTTTGAGAAATACTGG - Intronic
941383001 2:164819069-164819091 ATTAAATATTTGACAGAAACAGG - Intronic
941821432 2:169847498-169847520 GTAAAATGTTTGACAACAATAGG - Intronic
942136682 2:172933120-172933142 GAAAACTCATTCACAAAAACAGG + Intronic
942770303 2:179509654-179509676 GTAAAATGTTTGACAAAAGCAGG + Intronic
942919419 2:181353298-181353320 TTAAAATATTTTAAAAAAACTGG + Intergenic
943626572 2:190207936-190207958 GTAAAATAATTAATAAAAACAGG + Intronic
944699112 2:202230343-202230365 GTAAAACCTTTAAAAATAACTGG + Intronic
944781992 2:203028412-203028434 GTAGAATATTTGAAAAATACAGG + Intronic
945452388 2:210008592-210008614 CTTAAATCTTTAACAAAACCGGG - Intronic
945461046 2:210109187-210109209 GTATAATTTTTTAAAAAAACAGG + Intronic
945968936 2:216217647-216217669 GTAAAATCTCTGACAATGACAGG - Intergenic
947032315 2:225810844-225810866 ATAAAATCAATGGCAAAAACTGG - Intergenic
947065873 2:226225107-226225129 GCAAAATCTTTGCATAAAACAGG - Intergenic
947415016 2:229886003-229886025 GTACAATCTTAAAGAAAAACGGG + Intronic
948398644 2:237666431-237666453 TTAAAACCTTTGAGAAAAATTGG - Intronic
1169430849 20:5534754-5534776 GTAAAATGTTTGAGAAGAAGGGG + Intergenic
1171034078 20:21702687-21702709 GTAAACTCTTTGCCGAAAGCGGG - Intergenic
1171569056 20:26228993-26229015 TTAAAATATTTGAGAAAAATAGG - Intergenic
1174956973 20:55108341-55108363 GTAAAATGTTTCATTAAAACTGG - Intergenic
1175138629 20:56843253-56843275 GAAAAATCTGTAACACAAACAGG + Intergenic
1175359995 20:58402139-58402161 TTAAATTCTTTAACAAAACCTGG + Intronic
1179223633 21:39432303-39432325 GCATAGTCTTTGACAAAAAGAGG + Intronic
1179401007 21:41083489-41083511 GTAATATCTTTGCCTAGAACAGG + Intergenic
1180281873 22:10706650-10706672 TTAAAATATTTGAAAAAAATAGG + Intergenic
1183552067 22:38494886-38494908 GTAAAATTGTTGACCAAATCAGG - Exonic
1184545724 22:45165653-45165675 GTAAAATATTTGTAAAAATCTGG + Intronic
1203239114 22_KI270732v1_random:37811-37833 TTAAAATATTTGAAAAAAATAGG + Intergenic
949369868 3:3323087-3323109 GTAAAATCCTTGTCTCAAACTGG + Intergenic
949409761 3:3750811-3750833 GTTAAATATTTGGTAAAAACAGG + Intronic
949431630 3:3982925-3982947 GGAAAATCTTTGGGAATAACAGG + Intronic
950272462 3:11629263-11629285 GTAGAATCTTTTAAAAACACAGG - Intronic
950808688 3:15631060-15631082 CTAAATTCTTTTACATAAACAGG - Intronic
952360358 3:32625009-32625031 TAAAACTCTTAGACAAAAACAGG - Intergenic
952606716 3:35155884-35155906 ATAAAACCTTTGACAAATATGGG + Intergenic
952811333 3:37406342-37406364 ATAAAATCTCTCAAAAAAACTGG - Intronic
953344360 3:42162749-42162771 GCAAAATATTTGACAAACTCTGG + Intronic
955575307 3:60355706-60355728 AAAAAATTTGTGACAAAAACTGG - Intronic
956625270 3:71260370-71260392 ATAAATTCTTTGACAAAACATGG - Intronic
957109791 3:75939336-75939358 TTAAAATATTTGAGAAAAATAGG + Intronic
958637266 3:96761486-96761508 ATAAAATCTAAGACAAAATCTGG + Intergenic
960066758 3:113382641-113382663 GTAAAATATTGAAAAAAAACTGG + Intronic
960375459 3:116895374-116895396 GTAAAAACTTAGAAAGAAACTGG - Intronic
961596248 3:128020003-128020025 GTAAAATCCTTCACAAATAAAGG - Intergenic
963024584 3:140906328-140906350 GTAAAGTCCTAGACAACAACAGG - Intergenic
963201249 3:142588638-142588660 ACAAAATCTTTGAGAGAAACAGG + Intergenic
963500194 3:146115902-146115924 ATAAAACTTTTTACAAAAACAGG + Intronic
963655581 3:148045580-148045602 GTAAAATCACTGAAAAATACTGG - Intergenic
963800118 3:149667782-149667804 CTAAAATCATTCACAAAAAATGG - Intronic
964628046 3:158777894-158777916 GTTTATTTTTTGACAAAAACAGG + Intronic
965197124 3:165614938-165614960 TTAAAATCTTTGTCAGAAAAAGG + Intergenic
965592201 3:170372040-170372062 TTAAAATTTTTGACAAATAGTGG + Intronic
966048193 3:175578918-175578940 TTCTAATCTTTGACAGAAACAGG - Intronic
967677824 3:192321100-192321122 GTAAAATCAGAGACAAAAAAAGG + Intronic
969869398 4:10095327-10095349 TTAAAATCTTTTACTATAACAGG + Intronic
970139268 4:12962911-12962933 GGAAAATGTTTTACAAATACTGG - Intergenic
970274613 4:14385076-14385098 GGAAAGTCTTTGACTTAAACTGG - Intergenic
970413956 4:15838144-15838166 GTAAAATCTTTGACAAAAACAGG + Exonic
970820765 4:20209793-20209815 AGAAAAATTTTGACAAAAACTGG + Intergenic
972407528 4:38761215-38761237 GTAAATTCTGTAACAAAATCTGG - Intergenic
974272604 4:59671044-59671066 GTAAAAAATTTTATAAAAACAGG - Intergenic
974320725 4:60345791-60345813 GTAAGAGTTTTGAGAAAAACTGG - Intergenic
974742774 4:66028596-66028618 GTAAGAACTTTTACAAATACAGG - Intergenic
974983012 4:68984867-68984889 GTAAAATATTTGAATAAATCAGG + Intergenic
976064236 4:81165388-81165410 CCATAATCTTTGAAAAAAACAGG - Intronic
976710834 4:88069853-88069875 GTAATATATTTGACAATAATAGG - Intronic
977487885 4:97672138-97672160 GTTAAATTTTTCACATAAACTGG + Intronic
978073535 4:104500267-104500289 GTAAATACTTTGACAAAATCTGG - Intergenic
978242629 4:106534972-106534994 GTGTAGTCTTTGCCAAAAACAGG + Intergenic
979125105 4:116960642-116960664 GTAAATATTTTAACAAAAACGGG - Intergenic
979551160 4:121992412-121992434 GTAAATTCTTACATAAAAACAGG + Intergenic
980317713 4:131224503-131224525 GCAAAATCTTTGAGAAAACTAGG + Intergenic
980732305 4:136838606-136838628 GTAAAGTGTTTGACAATACCTGG - Intergenic
981163681 4:141531123-141531145 GTGGAATCTTTGAAAAAAAGGGG + Intergenic
982046017 4:151446608-151446630 GTTTAATCTTTGACAAAATTGGG + Intronic
982586968 4:157253913-157253935 GTAAAAGATTTGTCAAATACAGG + Intronic
983124822 4:163938011-163938033 ATAAAATCTTTTTTAAAAACAGG + Intronic
985340145 4:188942598-188942620 GTCATATCATAGACAAAAACGGG - Intergenic
986630831 5:9771234-9771256 GAAAAAACTTTGCCAAAATCTGG - Intergenic
986832914 5:11601204-11601226 GCAAAATATTTGAGAACAACAGG + Intronic
987013213 5:13789342-13789364 ATAAAATTTGTGGCAAAAACTGG + Intronic
988285430 5:29209780-29209802 GAAAGGTCTTAGACAAAAACAGG - Intergenic
988635759 5:32982234-32982256 GTATAATTTTTGTCATAAACTGG - Intergenic
988715509 5:33823367-33823389 GTTAAATGTGTGACAAAGACGGG - Intronic
989258953 5:39397619-39397641 TTAAAATCTTTTAAAATAACTGG + Intronic
989371536 5:40714822-40714844 GTAAGATCTTTAACATAAAGTGG + Exonic
989800028 5:45526226-45526248 GAAACATGGTTGACAAAAACTGG - Intronic
989993991 5:50805085-50805107 ATAAAATCTTTAAAAGAAACTGG - Intronic
990613224 5:57481206-57481228 CTAAAATATTTAACAAGAACAGG - Exonic
990717004 5:58648547-58648569 GTAAAATCTTTTCAAGAAACAGG - Intronic
992844971 5:80737379-80737401 GAAACATCTTTGTCAAAAGCTGG - Intronic
993357047 5:86927249-86927271 GTAAAATATTTGATAAAATAAGG - Intergenic
993789332 5:92188319-92188341 TTTAAATCTTTGAAAAAAAAAGG + Intergenic
994070809 5:95599821-95599843 TGACTATCTTTGACAAAAACAGG - Intronic
994090480 5:95805602-95805624 GTAAAATCTTTGAGATATAATGG + Intronic
994253533 5:97565538-97565560 GAAAAATATTTGAAAAAAAGTGG + Intergenic
994880317 5:105484224-105484246 TTAAAATCTTTGACACAGCCAGG + Intergenic
995712913 5:115052898-115052920 GTAGCATCTTTGACAACAATGGG - Intergenic
995933223 5:117476906-117476928 TTAAAATATTTCACAAAATCAGG - Intergenic
996675848 5:126173400-126173422 ATAAAACCTCTGACAAATACAGG + Intergenic
997908717 5:137846991-137847013 TTAAAATCTTTCACAATATCTGG + Intergenic
998280265 5:140800052-140800074 GTAACAACTTTTAAAAAAACTGG + Intronic
1000148286 5:158474341-158474363 GTAAAAACTGTGACCAAAACTGG + Intergenic
1000958865 5:167575186-167575208 GTAAAATCTTAGATATAATCTGG - Intronic
1001809900 5:174619603-174619625 CTAAAATTTTTGGCAAACACTGG - Intergenic
1003666536 6:8116751-8116773 ATAAAACCTTTGACATAATCAGG - Intergenic
1005172166 6:23000396-23000418 TTAAAAACTTATACAAAAACAGG + Intergenic
1005594792 6:27368672-27368694 GAAAAAGCTTTAACACAAACAGG + Intergenic
1005720926 6:28601481-28601503 TGAATATCATTGACAAAAACAGG - Intronic
1006026087 6:31148029-31148051 GTAAAATTTTAGAAAAAAAAAGG + Intronic
1006952049 6:37830834-37830856 GTAAAATCTTTTAAAAAAGAAGG - Intronic
1007894861 6:45343972-45343994 GTAAAATATTTTACAATCACAGG + Intronic
1008248694 6:49210214-49210236 GAAAAACATTTGACAAAAACTGG + Intergenic
1009519425 6:64662708-64662730 GTAAAATGTTATACAAAACCTGG - Intronic
1010104708 6:72153388-72153410 TTAAAATATTTGACCAAAATAGG - Intronic
1011579888 6:88850231-88850253 ATAAAATCTATGACAATAAATGG + Intronic
1013994297 6:116290193-116290215 TTGAAATCTTTGACAGTAACCGG + Intronic
1015309604 6:131751819-131751841 GTAATACATTTGACAAGAACGGG + Intergenic
1015878120 6:137844795-137844817 GTGAAACCTTGGACAATAACTGG - Intergenic
1016077338 6:139812140-139812162 CTAAAATTTTTGTTAAAAACTGG + Intergenic
1019655017 7:2187774-2187796 GTAAAATATTTTACATAAAAAGG - Intronic
1020465440 7:8473259-8473281 TGAAAATCATTGACAAAAGCAGG + Intronic
1021183395 7:17534364-17534386 GGAAAATCATTAAGAAAAACAGG + Intergenic
1021664640 7:22963730-22963752 GCAAAAAACTTGACAAAAACAGG + Intronic
1021933005 7:25600334-25600356 GTAAAGCCTTAAACAAAAACTGG + Intergenic
1022510318 7:30931291-30931313 GTGAAATCATTGACAGAGACAGG + Intergenic
1024404992 7:48968895-48968917 GTAAAATAATTCACTAAAACTGG + Intergenic
1024856982 7:53794088-53794110 GTAAAAGCTGTAACACAAACAGG - Intergenic
1025918202 7:65884001-65884023 AGAAAATCTATGACAAAATCAGG + Intronic
1026264762 7:68786445-68786467 GTCAAATCTTTTACAAAGCCAGG - Intergenic
1026382716 7:69815435-69815457 GATAGATCTTTGAAAAAAACAGG + Intronic
1027659219 7:80968947-80968969 GTAAAATCCTTTACATAAAAAGG - Intergenic
1027948793 7:84785421-84785443 GTTAAACTTTTGACAAAAATGGG + Intergenic
1028278648 7:88892726-88892748 GTACAAAGTTTAACAAAAACAGG - Intronic
1029941775 7:104488412-104488434 GTAAGATCTTTGAGATAAAAGGG + Intronic
1030652677 7:112132391-112132413 GAAAAATCTGGGATAAAAACAGG + Intronic
1031451311 7:121923709-121923731 GTAAAAATTTTGAGAAAAATTGG + Intronic
1032291672 7:130594403-130594425 ATAAACTCTTTGAAGAAAACAGG + Intronic
1032954454 7:136954443-136954465 GTAAGATCTTAGAGAAAGACAGG - Intronic
1033337016 7:140462505-140462527 GTAAAATGTTTGCCATAAGCTGG - Intronic
1033519189 7:142143152-142143174 CAAAAATTTTTTACAAAAACTGG + Intronic
1035891707 8:3351837-3351859 TTAAAATCTTTGAAAAATATAGG - Intronic
1036081793 8:5565383-5565405 GTAAAACCTTAGAAAAAAGCAGG - Intergenic
1036137344 8:6174330-6174352 CTGAAATCTGTGACAAAAAAAGG + Intergenic
1037197617 8:16210326-16210348 GAAAAATCTATATCAAAAACAGG - Intronic
1039623892 8:39027779-39027801 GTGATATCTTTAACAAATACAGG + Intronic
1040320696 8:46297090-46297112 GAAAATTCTTTGATGAAAACTGG - Intergenic
1041228336 8:55723551-55723573 GTAAAATTGTTAACAAAAATGGG + Intronic
1042159315 8:65876185-65876207 TTAAAATACTTGACCAAAACAGG - Intergenic
1044499024 8:92929266-92929288 GTAATGTCATTAACAAAAACAGG + Intronic
1044713113 8:95075854-95075876 GGAGAATCTTTGACAAACACAGG + Intronic
1045981997 8:108200532-108200554 GTAAAACTATTTACAAAAACAGG - Intergenic
1046709617 8:117495710-117495732 GTAAAGTCTTTGAGAAATATGGG - Intergenic
1048085184 8:131169671-131169693 GTAAGATAATAGACAAAAACGGG + Intergenic
1048720452 8:137318740-137318762 TTAAAATCTTTGACAGAGGCTGG + Intergenic
1051036400 9:12751628-12751650 GTAAAATCTCTGAAGAAACCAGG - Intergenic
1052207727 9:25863724-25863746 GAAAAATCCTTGACAAGAAAGGG - Intergenic
1052794439 9:32910285-32910307 GTAATATGTTTGGCAAAAACTGG - Intergenic
1053232789 9:36425369-36425391 GTAACATTTTTGTCTAAAACTGG - Intronic
1055140369 9:72870389-72870411 GTAAAATCTTTAAAGAAAAAAGG - Intergenic
1056073367 9:83012232-83012254 GTAAAAGCTTTCACAATAAGTGG + Intronic
1056914394 9:90732717-90732739 GGAAAAACTTTCAGAAAAACAGG + Intergenic
1057049581 9:91913564-91913586 ATAAAAACTTTGACATCAACTGG + Intronic
1057084341 9:92194938-92194960 ATAAAATCTTTTTCCAAAACAGG - Intergenic
1058760789 9:108129804-108129826 CTAAAGTCTTTCACAAAAAGGGG + Intergenic
1060344645 9:122805599-122805621 GGAAAATATGTGACAAAAAAAGG - Intronic
1060682957 9:125581723-125581745 GTAAAATGTAAGAAAAAAACAGG - Intronic
1062701920 9:137911239-137911261 GTAAACTATTAAACAAAAACAGG - Intronic
1185822149 X:3215848-3215870 GTAAAATTTTTGAGAAATAGGGG + Intergenic
1185880995 X:3740656-3740678 TTAAAATGTTTTATAAAAACAGG - Intergenic
1186658265 X:11639933-11639955 TTAAAATTTTTAACAAAAAATGG - Intronic
1188530384 X:31133852-31133874 GTAAAATACTTGACAAATAGAGG + Intronic
1188607462 X:32049592-32049614 GTACAATCTATGACAACAATGGG + Intronic
1188930595 X:36105882-36105904 GCAAAATCTTTGAAATTAACTGG - Intronic
1188972922 X:36639224-36639246 GCAAAATCATTTAGAAAAACTGG - Intergenic
1189406467 X:40729807-40729829 GTAAAACCCTTGACATACACTGG - Intronic
1191073803 X:56430399-56430421 GTGACAAATTTGACAAAAACAGG - Intergenic
1192766802 X:74147953-74147975 AGAAAATCTTTGAGAAATACGGG + Intergenic
1192911494 X:75609433-75609455 GAAAAATCATTGAGAAAACCAGG + Intergenic
1193581763 X:83273567-83273589 GGAAAATCTATTATAAAAACAGG - Intergenic
1193839529 X:86392246-86392268 GTAAAATGTTTGCCAAGAACAGG - Intronic
1194247277 X:91531192-91531214 ATAAAATCCTTAAAAAAAACTGG - Intergenic
1195302919 X:103549579-103549601 GTTATATCTTTGAGCAAAACAGG + Intergenic
1195950367 X:110265596-110265618 GTAAATTATTTCATAAAAACTGG - Intronic
1196706112 X:118718681-118718703 TTAAACTCATTCACAAAAACCGG + Intergenic
1197393512 X:125897557-125897579 GCAAAATCTTTGAGAAATATGGG - Intergenic
1197414405 X:126157020-126157042 ATATAATCTTTGAAAAAAATGGG - Intergenic
1199311301 X:146323800-146323822 GTACAATCTTTAAAAAAAAATGG + Intergenic
1199447762 X:147945720-147945742 GTAAAATATTTCACATAAACTGG - Intronic
1200566298 Y:4772729-4772751 ATAAAATCCTTAAAAAAAACTGG - Intergenic