ID: 970420579

View in Genome Browser
Species Human (GRCh38)
Location 4:15902129-15902151
Sequence TGAGAGGCCAACTTCAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970420579_970420584 -8 Left 970420579 4:15902129-15902151 CCCCTTCTGAAGTTGGCCTCTCA No data
Right 970420584 4:15902144-15902166 GCCTCTCAGGGACACCTCGCTGG No data
970420579_970420586 -5 Left 970420579 4:15902129-15902151 CCCCTTCTGAAGTTGGCCTCTCA No data
Right 970420586 4:15902147-15902169 TCTCAGGGACACCTCGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970420579 Original CRISPR TGAGAGGCCAACTTCAGAAG GGG (reversed) Intergenic
No off target data available for this crispr