ID: 970422536

View in Genome Browser
Species Human (GRCh38)
Location 4:15918865-15918887
Sequence TCCCCACCGTGTACAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970422536_970422541 -5 Left 970422536 4:15918865-15918887 CCCTCTCCTGTACACGGTGGGGA No data
Right 970422541 4:15918883-15918905 GGGGACCACTGGAGGAGCTCTGG No data
970422536_970422543 19 Left 970422536 4:15918865-15918887 CCCTCTCCTGTACACGGTGGGGA No data
Right 970422543 4:15918907-15918929 GACTCCCTCTTGTGAACATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970422536 Original CRISPR TCCCCACCGTGTACAGGAGA GGG (reversed) Intergenic