ID: 970422541

View in Genome Browser
Species Human (GRCh38)
Location 4:15918883-15918905
Sequence GGGGACCACTGGAGGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970422528_970422541 17 Left 970422528 4:15918843-15918865 CCTTCCCATCACTGTGCCTAATC No data
Right 970422541 4:15918883-15918905 GGGGACCACTGGAGGAGCTCTGG No data
970422531_970422541 1 Left 970422531 4:15918859-15918881 CCTAATCCCTCTCCTGTACACGG No data
Right 970422541 4:15918883-15918905 GGGGACCACTGGAGGAGCTCTGG No data
970422526_970422541 19 Left 970422526 4:15918841-15918863 CCCCTTCCCATCACTGTGCCTAA No data
Right 970422541 4:15918883-15918905 GGGGACCACTGGAGGAGCTCTGG No data
970422529_970422541 13 Left 970422529 4:15918847-15918869 CCCATCACTGTGCCTAATCCCTC No data
Right 970422541 4:15918883-15918905 GGGGACCACTGGAGGAGCTCTGG No data
970422536_970422541 -5 Left 970422536 4:15918865-15918887 CCCTCTCCTGTACACGGTGGGGA No data
Right 970422541 4:15918883-15918905 GGGGACCACTGGAGGAGCTCTGG No data
970422527_970422541 18 Left 970422527 4:15918842-15918864 CCCTTCCCATCACTGTGCCTAAT No data
Right 970422541 4:15918883-15918905 GGGGACCACTGGAGGAGCTCTGG No data
970422537_970422541 -6 Left 970422537 4:15918866-15918888 CCTCTCCTGTACACGGTGGGGAC No data
Right 970422541 4:15918883-15918905 GGGGACCACTGGAGGAGCTCTGG No data
970422530_970422541 12 Left 970422530 4:15918848-15918870 CCATCACTGTGCCTAATCCCTCT No data
Right 970422541 4:15918883-15918905 GGGGACCACTGGAGGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970422541 Original CRISPR GGGGACCACTGGAGGAGCTC TGG Intergenic
No off target data available for this crispr