ID: 970422543

View in Genome Browser
Species Human (GRCh38)
Location 4:15918907-15918929
Sequence GACTCCCTCTTGTGAACATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970422536_970422543 19 Left 970422536 4:15918865-15918887 CCCTCTCCTGTACACGGTGGGGA No data
Right 970422543 4:15918907-15918929 GACTCCCTCTTGTGAACATTAGG No data
970422537_970422543 18 Left 970422537 4:15918866-15918888 CCTCTCCTGTACACGGTGGGGAC No data
Right 970422543 4:15918907-15918929 GACTCCCTCTTGTGAACATTAGG No data
970422542_970422543 -4 Left 970422542 4:15918888-15918910 CCACTGGAGGAGCTCTGGAGACT No data
Right 970422543 4:15918907-15918929 GACTCCCTCTTGTGAACATTAGG No data
970422538_970422543 13 Left 970422538 4:15918871-15918893 CCTGTACACGGTGGGGACCACTG No data
Right 970422543 4:15918907-15918929 GACTCCCTCTTGTGAACATTAGG No data
970422531_970422543 25 Left 970422531 4:15918859-15918881 CCTAATCCCTCTCCTGTACACGG No data
Right 970422543 4:15918907-15918929 GACTCCCTCTTGTGAACATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970422543 Original CRISPR GACTCCCTCTTGTGAACATT AGG Intergenic
No off target data available for this crispr