ID: 970429609

View in Genome Browser
Species Human (GRCh38)
Location 4:15976794-15976816
Sequence ATCTAGAAGGCACAACTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970429609_970429617 11 Left 970429609 4:15976794-15976816 CCGTGGAGTTGTGCCTTCTAGAT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 970429617 4:15976828-15976850 AATGACTTGCCTCCAGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 198
970429609_970429618 19 Left 970429609 4:15976794-15976816 CCGTGGAGTTGTGCCTTCTAGAT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 970429618 4:15976836-15976858 GCCTCCAGCTGGGGGCAGCATGG 0: 1
1: 1
2: 6
3: 57
4: 444
970429609_970429614 8 Left 970429609 4:15976794-15976816 CCGTGGAGTTGTGCCTTCTAGAT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 970429614 4:15976825-15976847 AGGAATGACTTGCCTCCAGCTGG No data
970429609_970429615 9 Left 970429609 4:15976794-15976816 CCGTGGAGTTGTGCCTTCTAGAT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 970429615 4:15976826-15976848 GGAATGACTTGCCTCCAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 177
970429609_970429616 10 Left 970429609 4:15976794-15976816 CCGTGGAGTTGTGCCTTCTAGAT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 970429616 4:15976827-15976849 GAATGACTTGCCTCCAGCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970429609 Original CRISPR ATCTAGAAGGCACAACTCCA CGG (reversed) Intronic
900136046 1:1117249-1117271 ATCAAGGAGGAACAACCCCAAGG - Intergenic
901254783 1:7813528-7813550 CTCTCGAAGGCACAATGCCAAGG + Intronic
901872872 1:12148377-12148399 ATCTAGAAGGCATAGTGCCAGGG - Intergenic
901902349 1:12375877-12375899 CTGTGGAAGGCAGAACTCCATGG - Intronic
903942078 1:26938733-26938755 ATCTCTAAGGCAGAACTGCAGGG - Intronic
905245117 1:36607462-36607484 ATCTATAATGCAAAATTCCAAGG + Intergenic
907903860 1:58766373-58766395 ACCTAGAAGGCATCATTCCAAGG + Intergenic
909046333 1:70714448-70714470 ATGAAGAAGGCACAAGCCCAAGG + Intergenic
910780264 1:90924626-90924648 ATCTAAATGGCACAAATCCATGG + Intronic
911212251 1:95154470-95154492 ATCTATAAGGCACAGCTCATTGG + Intronic
911231547 1:95367151-95367173 ATTTAGTAGGCACATTTCCAAGG - Intergenic
911971166 1:104439712-104439734 ATCTAGAATGCACAAATCTTGGG - Intergenic
913110846 1:115655797-115655819 TTCCAGATGCCACAACTCCAGGG - Intronic
915876391 1:159615763-159615785 ATCTAGAAGCCTCAAACCCAAGG + Intergenic
917773935 1:178313053-178313075 ATCTTGAAGGCATACTTCCAGGG - Intronic
918992063 1:191709528-191709550 TTCTATAATGCACATCTCCAGGG + Intergenic
920940807 1:210480525-210480547 TTCCAGGAGGCACAACACCAGGG + Intronic
1062772853 10:117359-117381 ATCCAGAAGGAAAAACACCAGGG + Intergenic
1063976728 10:11423544-11423566 GCCCAGAAGGCCCAACTCCAGGG - Intergenic
1064786373 10:18901601-18901623 AGATAGAAGGCACAACTTCAAGG - Intergenic
1065376183 10:25044802-25044824 ATGTACAAGGCAAGACTCCAAGG - Intronic
1068349569 10:55825013-55825035 ATCTAGATGCCCAAACTCCATGG + Intergenic
1068867543 10:61910520-61910542 ATCTACACTGCACAAATCCAAGG + Intronic
1071090669 10:81914280-81914302 ATCCAGCACTCACAACTCCAAGG + Intronic
1071785493 10:88895131-88895153 ACCTAGAAGGGTCAAGTCCAAGG - Intronic
1072728300 10:97828236-97828258 ATCTAGAAAGAACAGCTCCCTGG - Intergenic
1077964940 11:7119704-7119726 ATCTAGAAGGCACTGAACCAAGG - Intergenic
1078579123 11:12525322-12525344 ATGTACACTGCACAACTCCAAGG - Intronic
1079369565 11:19838974-19838996 ATCTAGGAAGCCCAGCTCCAGGG - Intronic
1080021001 11:27560028-27560050 AGCTAGAAGGCAGAAGTCCAAGG + Intergenic
1080304885 11:30825641-30825663 AGCTAGAAGGCCCAATTGCAAGG - Intergenic
1081533482 11:43981289-43981311 TCCTAGAGGGCACAACTCCCTGG + Intergenic
1082283285 11:50294946-50294968 TACTAGACAGCACAACTCCAGGG + Intergenic
1083674909 11:64319713-64319735 ACCTAGAAGGAAGGACTCCAGGG - Exonic
1084776937 11:71383466-71383488 ATCTAGAAGGAATTTCTCCAGGG - Intergenic
1086438671 11:86806446-86806468 ATCAAGGAGGGACAGCTCCACGG + Intronic
1086552068 11:88064061-88064083 AACTAGAAGGAACAACAACAGGG + Intergenic
1087292705 11:96337951-96337973 ATCCAGCAGGCACAAAACCAAGG + Intronic
1088590943 11:111402631-111402653 ATCTGGAAGGCACATCCCCTTGG - Intronic
1088732790 11:112698120-112698142 GTCTAGAAGACAGAACTCCCAGG - Intergenic
1089416358 11:118295432-118295454 CTCTAGACGGGACAACTCCGCGG + Intergenic
1096820475 12:54229937-54229959 CACTGGAAAGCACAACTCCAGGG - Intergenic
1101547085 12:105724908-105724930 AACTGGCAGACACAACTCCAAGG + Intergenic
1103149748 12:118626717-118626739 TTGTACAGGGCACAACTCCATGG + Intergenic
1109440572 13:62366928-62366950 ATCTACATGACACAACTCCAAGG - Intergenic
1113345340 13:109472283-109472305 ATCTCTAAGGCACAGATCCAAGG + Intergenic
1121698544 14:95933178-95933200 AACTGGAAGGCACAGGTCCACGG - Intergenic
1121895558 14:97643790-97643812 ATATAGATGGCCCAATTCCAGGG + Intergenic
1202856413 14_GL000225v1_random:54211-54233 ACCTAGAAGGCAGAAATCCCAGG - Intergenic
1123405966 15:20019638-20019660 TTCTGGAAGGCACAACATCATGG - Intergenic
1123515296 15:21026286-21026308 TTCTGGAAGGCACAACATCATGG - Intergenic
1127660609 15:61096950-61096972 ATGTAGAAGGCACATGTGCATGG + Intronic
1133667170 16:7979805-7979827 ATTTAGCTGACACAACTCCACGG + Intergenic
1135568185 16:23528139-23528161 ATCTAGAGGCTAGAACTCCAGGG - Intronic
1141344079 16:83229317-83229339 AACTTGAAGGCAGAGCTCCAGGG - Intronic
1141453160 16:84119251-84119273 CTCCAGGAGCCACAACTCCAGGG - Intergenic
1146892321 17:36514087-36514109 ATGGAAAAGGCACAACTCTAGGG + Intronic
1147360084 17:39924891-39924913 ACCTAGAAGGCACCCCTCCTGGG + Intronic
1148514827 17:48206777-48206799 CTCTGGAAAGCAGAACTCCAGGG + Intronic
1150870360 17:68902403-68902425 ATTTAAAATGCACAATTCCATGG - Intronic
1156425600 18:37008559-37008581 ATTAAGAAATCACAACTCCAGGG + Intronic
1156844813 18:41652950-41652972 ATCTGAATGGCACACCTCCATGG + Intergenic
1158015465 18:52777748-52777770 ATCTAGGAGGCAGATCTCCAGGG + Intronic
1159915514 18:74184159-74184181 ATCTAGAAGGCACAAGCCAGTGG + Intergenic
1167337706 19:48896781-48896803 TTCTAGAAGGCAGGACTCCTGGG - Intronic
932321254 2:70823509-70823531 ACCTCGAAGGCAGAACTCTACGG + Intergenic
936235980 2:110743109-110743131 GTCCAGAATACACAACTCCATGG - Intronic
936936887 2:117847570-117847592 ATAAAGAAGGCACAATTCAATGG - Intergenic
936938890 2:117862764-117862786 ATCTGGAAGGCACATGTGCAAGG - Intergenic
937052831 2:118906290-118906312 ATGTAGAAGGCACGAGTCCTTGG + Intergenic
937580724 2:123484286-123484308 ATCTGAATGGCGCAACTCCATGG + Intergenic
937666747 2:124496499-124496521 ATCTAGACGCCACAACACCCTGG - Intronic
940481322 2:154234940-154234962 ATGTAGAAGGTACAAGGCCAGGG + Intronic
940962363 2:159799527-159799549 ATCTAGCAATCACAACTCCTTGG + Intronic
1172865307 20:38091643-38091665 ATCTAGAAAGCAGCACACCACGG - Exonic
1173123420 20:40314988-40315010 TTCCAGAAGGTAGAACTCCATGG - Intergenic
1175888326 20:62304590-62304612 AACAAAAAGGCACAACCCCAAGG - Intronic
1179359634 21:40693883-40693905 ACCTAGCAGGCCCAACTCCCTGG + Intronic
949176905 3:1074785-1074807 AGATTGAAGGCACTACTCCATGG + Intergenic
950132535 3:10557203-10557225 TTCTGGAAGGCACAGTTCCAGGG + Intronic
950197839 3:11021773-11021795 ATCTAGAAGAGAAAACTGCAGGG + Intronic
952443969 3:33362333-33362355 ATCTAAAAGTGATAACTCCAGGG + Intronic
952486355 3:33815519-33815541 ATCTAGAAGGCCTAACTCCCGGG + Intronic
952885015 3:38006797-38006819 AGCTAGAAGACACATCTCCCGGG - Intronic
953258724 3:41316358-41316380 ATTTAAAAGGTACAACTCAATGG - Intronic
955753044 3:62202310-62202332 ACCTGGAAGGCACAAATGCAGGG - Intronic
960236734 3:115291950-115291972 TTCTAGAAGGAACAAAGCCATGG + Intergenic
961154432 3:124666708-124666730 TTCTGGATGTCACAACTCCAGGG - Intronic
961468036 3:127093171-127093193 TTCTACAAAGGACAACTCCAGGG - Intergenic
967403538 3:189090658-189090680 ATATAAAAGGCAGAACTCAAGGG - Intronic
970429609 4:15976794-15976816 ATCTAGAAGGCACAACTCCACGG - Intronic
970576072 4:17429399-17429421 AACCAGAAGGCACAAGTCTATGG - Intergenic
976687305 4:87828732-87828754 ATCTGGAAGGAAGTACTCCATGG - Intronic
976730399 4:88255439-88255461 ATCAAGTGGGCACAACTCTAGGG + Intergenic
980021562 4:127716429-127716451 ATCAAGAAAGCACAGCTACAAGG - Exonic
980688922 4:136265774-136265796 ATCTAGAAGCCATTATTCCAAGG + Intergenic
981555805 4:145992146-145992168 GTGTAGAACGCACAACACCAAGG - Intergenic
982204715 4:152989184-152989206 GTCTGGCAGGCAGAACTCCAGGG - Intergenic
986130801 5:4928205-4928227 ATCTAGTAGGTACAAGTCAAGGG - Intergenic
988197192 5:28019383-28019405 ATCTTGAAAGCTCAACTCAAGGG - Intergenic
988709095 5:33755644-33755666 CTCCAGAAGGCACAACAGCATGG - Intronic
990783556 5:59394662-59394684 ATATACAAGGCACAGTTCCAAGG + Intronic
993162078 5:84305136-84305158 ATCTAGAATTAACAAATCCAGGG + Intronic
993567719 5:89495590-89495612 ATCTAAAAGACACAACTCCACGG - Intergenic
1001456178 5:171861990-171862012 ATTTAGTAGGCACAATTCAAAGG + Exonic
1001941054 5:175739757-175739779 ATCTAGAAGGCAGTACTTAAGGG + Intergenic
1004247507 6:13994036-13994058 ATCTATAAGGCAAAATTCTATGG - Intergenic
1009271472 6:61620608-61620630 ATCTAAGGGTCACAACTCCATGG - Intergenic
1016771068 6:147851500-147851522 ATTTAGAAAGCAAAACTTCAAGG + Intergenic
1018899477 6:168043997-168044019 ATCTAGAAAGAACAGCCCCAGGG + Intronic
1022097369 7:27149134-27149156 ATCTCGAAGGCACACCTCTCAGG - Intronic
1023005668 7:35863912-35863934 TACTAGATAGCACAACTCCAGGG - Intronic
1023369583 7:39499640-39499662 ATCTAGGTGCCAGAACTCCAAGG - Intergenic
1024665794 7:51545710-51545732 AAAGAGAAGGCACACCTCCAGGG + Intergenic
1029737587 7:102473232-102473254 CTCTAGAAGCCTCAACTCCTGGG - Exonic
1036004748 8:4648974-4648996 TTATTGAAGGCACTACTCCAGGG - Intronic
1036411906 8:8509873-8509895 AATTAGAAGGAACAAGTCCATGG + Intergenic
1038067255 8:23975902-23975924 TTCTAGAAGGCACAGCTGAAAGG + Intergenic
1038390990 8:27200902-27200924 TTCAAGAAGGCAGCACTCCATGG - Intergenic
1039147469 8:34465082-34465104 AACTAGATGGCAAAAATCCATGG + Intergenic
1039445477 8:37628208-37628230 ATCAAGAAGGCACCAAACCAAGG + Intergenic
1040546300 8:48400685-48400707 CTATAGAAGGCCCAACTCCAGGG - Intergenic
1042494805 8:69443978-69444000 ATCTAGAATAGACAAATCCATGG - Intergenic
1042756605 8:72220907-72220929 CTCTGGAAGGCACCTCTCCATGG + Intergenic
1044915122 8:97105089-97105111 ATCAAGAAGGCACAATGCCGGGG - Intronic
1047940838 8:129826228-129826250 ATCTGGCAGGGACAGCTCCAGGG - Intergenic
1048074902 8:131058937-131058959 GACTAGAAGCCACAACTTCAGGG + Intergenic
1050330656 9:4542027-4542049 ATTTACAAGGCATAACTCCTAGG + Intronic
1059308605 9:113373605-113373627 GCCTAGAGGGCTCAACTCCAGGG - Exonic
1061824198 9:133247667-133247689 ACCTAGTAGGGACAACTGCAGGG + Intergenic
1186535683 X:10345054-10345076 ATTTGGAAGGCACAATTCAAAGG + Intergenic
1187487261 X:19716369-19716391 ATCAAGCAGGCTCATCTCCAGGG - Intronic
1188732932 X:33674332-33674354 ATCTTGAAGGCACATCTCTCTGG + Intergenic
1189251458 X:39603421-39603443 ATCCAGAAGAGACATCTCCAGGG + Intergenic
1189804389 X:44720636-44720658 ATCGAGAAGGAACAATTGCATGG - Intergenic
1190862136 X:54355297-54355319 GTCTAGAAGTCAGAACTCCGGGG + Intronic
1196089269 X:111722343-111722365 ATCTTGAAGGCAAAACTTTAAGG - Intronic
1196145376 X:112311086-112311108 TTCTGGAAGACACAACTCCAAGG - Intergenic
1201447422 Y:14073460-14073482 AGCTAGAAGCCACAACTCCCTGG - Intergenic