ID: 970429611

View in Genome Browser
Species Human (GRCh38)
Location 4:15976807-15976829
Sequence TTCCTAAAAGGGAATCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970429611_970429614 -5 Left 970429611 4:15976807-15976829 CCTTCTAGATTCCCTTTTAGGAA 0: 1
1: 0
2: 0
3: 20
4: 205
Right 970429614 4:15976825-15976847 AGGAATGACTTGCCTCCAGCTGG No data
970429611_970429615 -4 Left 970429611 4:15976807-15976829 CCTTCTAGATTCCCTTTTAGGAA 0: 1
1: 0
2: 0
3: 20
4: 205
Right 970429615 4:15976826-15976848 GGAATGACTTGCCTCCAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 177
970429611_970429616 -3 Left 970429611 4:15976807-15976829 CCTTCTAGATTCCCTTTTAGGAA 0: 1
1: 0
2: 0
3: 20
4: 205
Right 970429616 4:15976827-15976849 GAATGACTTGCCTCCAGCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 134
970429611_970429617 -2 Left 970429611 4:15976807-15976829 CCTTCTAGATTCCCTTTTAGGAA 0: 1
1: 0
2: 0
3: 20
4: 205
Right 970429617 4:15976828-15976850 AATGACTTGCCTCCAGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 198
970429611_970429618 6 Left 970429611 4:15976807-15976829 CCTTCTAGATTCCCTTTTAGGAA 0: 1
1: 0
2: 0
3: 20
4: 205
Right 970429618 4:15976836-15976858 GCCTCCAGCTGGGGGCAGCATGG 0: 1
1: 1
2: 6
3: 57
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970429611 Original CRISPR TTCCTAAAAGGGAATCTAGA AGG (reversed) Intronic
900874862 1:5334951-5334973 TTCTGAAAAGGGAGGCTAGATGG + Intergenic
901568680 1:10141318-10141340 TTCATAAGAGGGAATCAGGAGGG + Intronic
903312113 1:22467147-22467169 TTCCTAGAAGTGATTCTAAAAGG + Intronic
905163527 1:36060070-36060092 TTCCTAGAAGAGAGTCTAGCAGG + Exonic
906345785 1:45013547-45013569 TTCCCAAAATGGAATCCAGGAGG - Intronic
906694440 1:47814629-47814651 TTCCTAAAAGGGAAGGGAGTGGG - Intronic
907024969 1:51108259-51108281 ATCATAAAAGAGAATCTAAATGG - Intronic
907231095 1:52999648-52999670 TTCCTGAATGGAAATCTAAAAGG - Intronic
913357737 1:117942429-117942451 TTGCTAGAATGTAATCTAGAGGG - Exonic
914838910 1:151231587-151231609 TTCAGAAAGGGGAAGCTAGAAGG - Intronic
914940569 1:152019429-152019451 TTCCTAAAAAGGAAGAAAGACGG + Intergenic
915390342 1:155537668-155537690 TTCCTAAAAGAAAATGTAGAAGG + Intronic
918428924 1:184438305-184438327 TTCCTAAAAGGGAATATAACTGG - Intronic
918509742 1:185298286-185298308 TTCCTAAAAGAGAAATGAGATGG + Exonic
919357325 1:196540427-196540449 CTCCTCAAAAGGAAGCTAGATGG + Intronic
919956310 1:202420406-202420428 TTTCTACAAGGGAAAATAGAAGG + Intronic
923590201 1:235311072-235311094 TTACTAAAAGGTAATCTATGAGG - Intronic
1065090158 10:22223959-22223981 TTCCTTAAAGGAAATATATACGG + Intergenic
1067159785 10:43815857-43815879 TACCTAAATGCCAATCTAGAGGG + Intergenic
1068061952 10:52079475-52079497 TTCCTAAAGGATGATCTAGAAGG - Intronic
1069623283 10:69850982-69851004 TCCCTAAAGGGGAATCTGGATGG + Intronic
1070492670 10:76992421-76992443 TTTCCCAAAGGGAATCTAAATGG - Intronic
1074654766 10:115572593-115572615 TGCCTAAAAGAGATTCAAGAGGG + Intronic
1078389613 11:10925566-10925588 TTGGTAAAAGGGAACCTACACGG + Intergenic
1081199537 11:40199748-40199770 TTCCCAGAAGGGAAACTAGTTGG - Intronic
1082086499 11:48054667-48054689 TTCATAAAAGGGAATCCCGGGGG - Intronic
1082809262 11:57468728-57468750 TTGGAAAATGGGAATCTAGAAGG - Intronic
1083128201 11:60595007-60595029 TTTCTACAAGGGAATAAAGAGGG + Intergenic
1085096643 11:73766057-73766079 TTACTAAAAAGAAATCTAGGCGG - Intergenic
1085777204 11:79377731-79377753 TTCCCAAGAGGGAAGCTGGATGG + Intronic
1088445055 11:109917238-109917260 TTCTTAAAAGTAACTCTAGAGGG + Intergenic
1089882520 11:121788385-121788407 TCCTTAAAGAGGAATCTAGACGG - Intergenic
1090511134 11:127376519-127376541 TCCCTAAAGGGGAATCTGGGTGG + Intergenic
1090604660 11:128408777-128408799 TTCTAAAAGGGAAATCTAGATGG - Intergenic
1091676410 12:2493750-2493772 TTCCTCAAAAGGGAGCTAGAAGG + Intronic
1092096651 12:5848427-5848449 TTCCTAAAATGGACTTGAGATGG - Intronic
1092110021 12:5953435-5953457 TTCCAAAAAAGGAAGCAAGATGG + Intronic
1095297372 12:40542324-40542346 CTGATAAAAGGGAAACTAGATGG - Intronic
1096932479 12:55228265-55228287 TTCCTAAAAGGAAATTTATAAGG - Intergenic
1098581334 12:72102799-72102821 TCCTTGAAAGGTAATCTAGATGG - Intronic
1099800357 12:87449830-87449852 ATCCTAAAAGAAAACCTAGAGGG + Intergenic
1099894243 12:88624944-88624966 CTCCTAAAAGGGAATTTTGATGG + Intergenic
1100036198 12:90255078-90255100 TTCCTGAAAGGGAATATGCAGGG - Intergenic
1100185472 12:92134347-92134369 TTTCTAAAATGGAGTGTAGAGGG + Intronic
1102360794 12:112285871-112285893 TTGCTAAAAGTTAATCTAGTAGG - Intronic
1106563592 13:30867170-30867192 TTCCTAGAAGGTAAGCAAGAAGG + Intergenic
1107013140 13:35687399-35687421 TTGCTAAAATAGAATCTAAATGG - Intergenic
1107761878 13:43688222-43688244 TTGCTAAAAGGAAATGTTGAAGG - Intronic
1109073371 13:57799650-57799672 TTCTTAAATGGAAATCTATAAGG - Intergenic
1109156475 13:58916646-58916668 TTCCTAACAAGAAATCTAGGTGG - Intergenic
1110505451 13:76280662-76280684 TTCCTGAAGGAGAATCTAGGTGG - Intergenic
1110664774 13:78104004-78104026 GTCCTAAAAGAGAATCTACTGGG - Intergenic
1112551286 13:100423379-100423401 ATCCAAGGAGGGAATCTAGATGG - Intronic
1116054433 14:39845712-39845734 TCCCTAGAAGGAAAACTAGATGG - Intergenic
1116923727 14:50610864-50610886 TTGCTAGAAGGGGAACTAGACGG - Intronic
1120068947 14:80080983-80081005 TTCCTCAAAGGAAATGTTGATGG + Intergenic
1123170964 14:106372465-106372487 TTCCTAAATGGGGAGCTACATGG - Intergenic
1123194638 14:106604712-106604734 TTCCTAAATGGGGAGCTACATGG - Intergenic
1124351695 15:28960595-28960617 TTCCTAAAGGGGAACCTAGGAGG - Intronic
1126432216 15:48598219-48598241 TTCCTCTAAGGGTATATAGATGG - Intronic
1127535752 15:59888492-59888514 TTCCTCAAAGGAAAACTAGGAGG + Intergenic
1128440574 15:67704624-67704646 TTCTTAAAAGGGAATCTAAGAGG + Intronic
1129633723 15:77291572-77291594 TTCATAAAATGGAATATTGAAGG - Intronic
1130612768 15:85376626-85376648 TCCCTTAAATGGAATCTGGAAGG - Intergenic
1135157173 16:20062309-20062331 TTTATAAAAGGGACTCCAGAGGG + Intronic
1137320695 16:47378955-47378977 TTCCCAAAAGGGCATCTGGGTGG - Intronic
1141420703 16:83913469-83913491 GTCCTCAAAGGGAGTCTGGAAGG + Intronic
1141591900 16:85074743-85074765 TTCATAAAAGGCAATCTGGAGGG - Intronic
1141949173 16:87329769-87329791 TTCCTAAATGGTAATCTGGCCGG - Exonic
1142765226 17:2060680-2060702 TTCCTGAAGAGGAAGCTAGACGG + Exonic
1143924102 17:10354467-10354489 TTCCAAAATGGAAATCCAGAAGG - Intronic
1144170939 17:12659303-12659325 TTCATAAAAGTGAATGTAGAAGG - Intergenic
1144331286 17:14226440-14226462 TTACTAAAAAAAAATCTAGAAGG - Intergenic
1144719973 17:17462424-17462446 TTCCCGAAAGGGAATCTTAAGGG - Intergenic
1147847476 17:43414754-43414776 TTCATAAAAGGGGGTCTTGAAGG - Intergenic
1148293858 17:46482272-46482294 TTCTTAAAAGTGAATTAAGATGG - Intergenic
1148316041 17:46699975-46699997 TTCTTAAAAGTGAATTAAGATGG - Intronic
1148571053 17:48669439-48669461 TTCATAAAAGAGACTCCAGAGGG + Intergenic
1148950165 17:51303908-51303930 TTCCTAAAAGGAAAAAGAGAAGG + Intergenic
1151183098 17:72343744-72343766 TTCCTCAAAGGCAATCTAAGCGG - Intergenic
1151193739 17:72416926-72416948 TTCCTAAAAGTGGACCTAGAAGG - Intergenic
1152973756 18:192637-192659 TGCTGAAAAGGGAATTTAGATGG - Intronic
1156571412 18:38257655-38257677 TTCCTAAGAGGAAAGCTACATGG - Intergenic
1156779976 18:40839102-40839124 TTTCTAAATGGGAATCTTGAAGG - Intergenic
1158311955 18:56168671-56168693 TCCCTAAAAGGTATTCTAGCAGG + Intergenic
1159889292 18:73939302-73939324 TTCCTAAAAGAGAAAGAAGAGGG + Intergenic
1163074560 19:14878206-14878228 TCCCTAGAAGGGAATCTAATAGG - Intergenic
925256006 2:2488922-2488944 TTTCTCAAAGGAAATATAGATGG - Intergenic
928533300 2:32214365-32214387 GTTCTAAAAGGCATTCTAGAAGG - Intronic
929478096 2:42273787-42273809 AAACTAAAAGGGAATTTAGAAGG - Intronic
936077340 2:109410033-109410055 TTACTAAAAGGGAAAAAAGAGGG - Intronic
936441537 2:112558339-112558361 TACCTAACAGGAACTCTAGATGG + Intronic
937421357 2:121758488-121758510 TTGCTAAAAGGGAATATATTAGG - Intronic
939488854 2:142852356-142852378 TTCCTAGCAGGGACTCTAGTAGG - Intergenic
942210460 2:173664421-173664443 TTCAGAAAAGGGAATTTAGGTGG + Intergenic
942851792 2:180495640-180495662 CTCCAGAAAGGGAATCTACATGG - Intergenic
942951768 2:181729489-181729511 TTCCTAACAGGAAAACTACATGG - Intergenic
943294495 2:186119346-186119368 TTCCAAAATGGAAATTTAGAAGG - Intergenic
943647443 2:190422193-190422215 GTCCTAAGAGGAAATTTAGATGG - Intronic
943744963 2:191452550-191452572 TTCTGAAAAGGGAATCCAGGAGG + Intergenic
945482474 2:210360156-210360178 TACCTGAAAAGGAATTTAGAAGG - Intergenic
947174147 2:227345064-227345086 TTCCTAAGATGGAATGCAGAAGG - Intronic
948638268 2:239354822-239354844 TTTCTTGAAGGGAATGTAGATGG + Intronic
948920999 2:241065895-241065917 TTCCCAAAAGGGTCCCTAGAAGG + Intronic
1169523673 20:6400234-6400256 TTGCTAAACAGGAATCTACATGG + Intergenic
1169920695 20:10731506-10731528 TTCCTGAAAAGGAATCTGGGAGG + Intergenic
1174604233 20:51749214-51749236 TTTCAAAAAGGGAATGAAGAAGG + Intronic
1174993879 20:55544027-55544049 TTCCTAAAACTGAATCAAAAGGG - Intergenic
1182987101 22:34730315-34730337 TTCCTAATACTGAACCTAGAAGG + Intergenic
1184683450 22:46085319-46085341 TTCCTAATAGGGAACATAGCAGG + Intronic
1184764547 22:46564616-46564638 TTCCAAGAGGGGAATCTAAAGGG + Intergenic
950392288 3:12706095-12706117 TTCCAAAGAGGGAATCCAGATGG + Intergenic
950783607 3:15413743-15413765 TTCCTAGTAGGGAATCCACATGG + Intronic
953562525 3:44003781-44003803 TTCATAAATAAGAATCTAGAAGG + Intergenic
955424548 3:58774430-58774452 TTCCTACAAGGGAATATCAAGGG - Intronic
955708849 3:61757436-61757458 AACCTAAAAGGGAAGCCAGAAGG + Intronic
956722015 3:72126351-72126373 TTCTTGAAGGGGAATCTGGAAGG - Intergenic
957770996 3:84692346-84692368 TTCCTCTAAAGGAATCTGGAAGG + Intergenic
958551250 3:95616420-95616442 TTTCTGAAAGGAAATCTAGGTGG - Intergenic
958958116 3:100483340-100483362 TTCCTATAAGGAAATGTACAGGG - Intergenic
959282854 3:104368129-104368151 TTCATATAAAGAAATCTAGAAGG + Intergenic
960347112 3:116546775-116546797 TTCCAAAAAGGGCATATAAATGG + Intronic
960613241 3:119573850-119573872 TTTGTAAAAGGGACTCTTGAAGG - Intergenic
961938749 3:130614544-130614566 TTCCTAAAAGGTGAGGTAGAGGG - Intronic
962332488 3:134490774-134490796 TACCTAAAAGCAAATCTACATGG + Intronic
963211274 3:142694235-142694257 GACATCAAAGGGAATCTAGAAGG + Intronic
963547554 3:146679565-146679587 TACCTAAAAGGCAAGCTATAGGG - Intergenic
966324911 3:178743051-178743073 TTCCTAGAAGGGAAAGTAAAGGG + Intronic
966418736 3:179716285-179716307 TTCCTGTAGGGGAATCTGGAGGG + Intronic
970429611 4:15976807-15976829 TTCCTAAAAGGGAATCTAGAAGG - Intronic
970506252 4:16733573-16733595 TGCCTCAAAGGGAAGCTACAGGG + Intronic
970571733 4:17389960-17389982 TTCCTAAATGGGGATCTAGGTGG + Intergenic
970921250 4:21397836-21397858 TCCCTAAAAGGGATTGAAGATGG + Intronic
971147609 4:23995884-23995906 TTGCTAAAAGGGATTCTTTATGG - Intergenic
971798669 4:31260139-31260161 TTCCGAAAAAGGAAGCCAGATGG - Intergenic
973287733 4:48438819-48438841 GTCCTTAAAGAGAATGTAGAGGG - Intergenic
974550970 4:63373995-63374017 TTCCTAAAAATAAATCAAGAGGG + Intergenic
974755698 4:66204026-66204048 TTCCAAAAATGGAATCTGAAAGG + Intergenic
974767696 4:66369330-66369352 AATCTAAAAGGCAATCTAGAAGG - Intergenic
975185881 4:71402212-71402234 ATCTTAAAATGAAATCTAGAAGG + Intronic
975300950 4:72790815-72790837 TTCCAAATAGGCAATGTAGATGG - Intergenic
975718202 4:77226138-77226160 ATCTTAAAATGGAATCTAGTTGG + Intronic
976134524 4:81921573-81921595 TTGGAAAAAGAGAATCTAGAAGG - Intronic
976687307 4:87828745-87828767 CTCCTCAAAGAGAATCTGGAAGG - Intronic
977180467 4:93867198-93867220 TTACTGGAGGGGAATCTAGAAGG - Intergenic
981295246 4:143124148-143124170 TTCTTGAAGGGGAATCTAGGTGG - Intergenic
981444648 4:144821726-144821748 TTAATAAAAGTGAATTTAGAGGG + Intergenic
983140959 4:164148759-164148781 TTCCTATAAGTAATTCTAGAAGG + Intronic
983397922 4:167226248-167226270 TTTCTAAAAGGAAATTTTGAAGG - Intronic
983471831 4:168166549-168166571 TTTCTAAAAGAGAATCTCAAAGG + Intronic
983694504 4:170511411-170511433 CTCATGAAATGGAATCTAGAAGG - Intergenic
987209527 5:15665591-15665613 TTCATAAAACTGCATCTAGATGG - Intronic
988157640 5:27475856-27475878 TTCATGAAAGCCAATCTAGAGGG + Intergenic
988172407 5:27675790-27675812 ATTGTAAAAGAGAATCTAGAGGG + Intergenic
988467393 5:31503420-31503442 TTCCTTGAAGGGAGACTAGATGG - Intronic
988829791 5:34976411-34976433 TTCTTAAAAGGGAATCTGCAGGG + Intergenic
995355910 5:111237655-111237677 TTTCTAAAAGCAAAACTAGAGGG - Intronic
996172034 5:120305281-120305303 TTGCTAAAACAGGATCTAGAAGG - Intergenic
996898500 5:128515595-128515617 TTCATAAAAGGTAACCTAAATGG + Intronic
997081894 5:130748713-130748735 CTCATAAACTGGAATCTAGATGG + Intergenic
997248789 5:132373190-132373212 TTCTTAGAAGGGAAACTTGAGGG + Intronic
997650337 5:135512889-135512911 TTCTTAAAAGGGAACTTAAAAGG - Intergenic
998169036 5:139861386-139861408 TTCCTGATAGGGATTCCAGAAGG + Intronic
999450987 5:151677991-151678013 TTCCAAAAGGGGAAGCAAGAAGG - Intronic
999629916 5:153560323-153560345 TTCCTGAAAAGTTATCTAGAAGG - Intronic
999828060 5:155292978-155293000 TTCCTGAAAGGGGATCCACATGG + Intergenic
1000719777 5:164692472-164692494 TTTATAAAAGGGAAGCAAGAAGG + Intergenic
1001016985 5:168150649-168150671 TCCCTAAAGGGAAATCTATATGG + Intronic
1003867798 6:10379605-10379627 TTCATAAAGAGGAATCTGGAGGG + Intergenic
1004173801 6:13321227-13321249 TTTCTAAAAGAGATTCTACATGG - Intronic
1004288199 6:14342407-14342429 GTCCTGAAAGGGCATCTAGATGG - Intergenic
1010541129 6:77093777-77093799 TTCGTGACAGGAAATCTAGAGGG - Intergenic
1011282212 6:85688432-85688454 ATCCTACAAAGGAATCCAGAAGG - Intergenic
1011668425 6:89658524-89658546 ATCCTAAAAGGGATTCTAATGGG + Intronic
1011715624 6:90102418-90102440 ATTCTCAAAGGGAATCTAAAGGG + Intronic
1012197750 6:96365540-96365562 TTCCTAGAAGGAAATACAGATGG + Intergenic
1012301942 6:97600677-97600699 TTCCTGAGAGGAAACCTAGATGG + Intergenic
1012492828 6:99801242-99801264 ATGCTTAAAGGGAATGTAGAAGG - Intergenic
1012670846 6:102045387-102045409 TTCCAAAACTGGAATGTAGATGG - Intronic
1013222768 6:108094149-108094171 TTCCTAAGGGGAAATCGAGATGG + Intronic
1014601111 6:123413681-123413703 TTCCCAAAAGGCATTCTTGAAGG + Intronic
1015332690 6:131999017-131999039 TTGCTAAAGGTGAATCTAGAAGG + Intergenic
1020651327 7:10880148-10880170 TGCCTAAAAAGTAATTTAGAAGG - Intergenic
1021025807 7:15665661-15665683 TTTTTAAAATGGAATCTAAAAGG - Intronic
1026226721 7:68448418-68448440 TTCCTCAGAGGAAATCAAGACGG - Intergenic
1027653216 7:80897126-80897148 TTACTAAAAGGGAAATTAGAGGG - Intronic
1029433113 7:100545005-100545027 TTCCTAACAGGGACTCTTCATGG + Intronic
1029570601 7:101366094-101366116 TTCCTAAAAAGGATACCAGAAGG + Intronic
1029899764 7:104026504-104026526 TTCCTGAAATGGACTCTAGCAGG - Intergenic
1029942317 7:104493354-104493376 TTCAGAAAAGGGAGTCTTGAAGG - Intronic
1030198020 7:106872044-106872066 TGCCGAAAAGGGAAGCTATAGGG + Intronic
1030217350 7:107058668-107058690 TTCCTTAAATGGAATCCAAAAGG + Intronic
1031021455 7:116632889-116632911 TTTCTAAAATGAAATCTATAAGG + Intergenic
1031612645 7:123845627-123845649 TTCCTAAAAAAGAATTCAGAAGG - Exonic
1031652427 7:124306718-124306740 TTCAGCAAAGGGAATCTTGAGGG - Intergenic
1032508254 7:132452033-132452055 TTCCAAAAAGGGATGCTGGAAGG + Intronic
1035178580 7:157072525-157072547 TTCCTAAAAAGGAATATTAAAGG + Intergenic
1037004747 8:13763791-13763813 TTCCAAAATGCAAATCTAGAGGG + Intergenic
1037812576 8:22095680-22095702 TTCCTTAAAGGAAAGCTAGGGGG + Intronic
1043126427 8:76401979-76402001 TTCTTAAAAGGGAATTGAGCAGG + Intergenic
1043516950 8:81003470-81003492 TTCCTTTAAGGGAATCAAGAAGG - Intronic
1044052780 8:87529374-87529396 TTCCAAAAAGGAAGTCTTGAAGG + Intronic
1044462009 8:92456735-92456757 TTCCTAAAACAGCAGCTAGATGG - Intergenic
1044851779 8:96435750-96435772 TTCATAAAAGGGACTCTGGAGGG - Intergenic
1045421770 8:102023518-102023540 TTCCCAAGGGGGAATCTAGCAGG + Intronic
1046312204 8:112452080-112452102 TTCCTACCTGGGAATCTTGAAGG - Intronic
1047922722 8:129651979-129652001 TTACTAAAAGGGAATTACGAGGG + Intergenic
1048219527 8:132528700-132528722 TTCCTCATAGCAAATCTAGAAGG + Intergenic
1048640922 8:136360370-136360392 TACCTAAAAGGCAGGCTAGAAGG - Intergenic
1050593106 9:7180237-7180259 TTCCTAAGAGGGAATCAGGCGGG + Intergenic
1051034793 9:12731278-12731300 TTCCTAAAAGGGATTTTAAAGGG + Intergenic
1051095984 9:13465602-13465624 TTCCTAAAAGAAAATCAAGGTGG + Intergenic
1051693351 9:19741278-19741300 TGCCAAAAAGGGGAGCTAGAGGG + Intronic
1052834018 9:33237049-33237071 TTACTATGAGTGAATCTAGAAGG + Intronic
1055251628 9:74314690-74314712 TTGCTAAAATGAAATCTTGAGGG - Intergenic
1059028971 9:110668627-110668649 GTCTTAAAAGGGATTCTAAAGGG + Intergenic
1059501255 9:114756121-114756143 TTCAGAAAAGGGACTCTATATGG - Intergenic
1060109027 9:120893502-120893524 TTCCAGAAAGGGAATGTACAGGG - Intronic
1060915772 9:127389434-127389456 TTCCTAGAAAGGTGTCTAGAAGG + Intronic
1188244012 X:27820011-27820033 TTCCAAAGAGGGAATTCAGAGGG - Intronic
1188361214 X:29256435-29256457 TTCCTAGCAGGGAATATAAAAGG + Intronic
1195069298 X:101263835-101263857 TTCCTTAAAATGAATCTGGAGGG - Exonic
1196105162 X:111887454-111887476 TTCCTAACAAAGAATCTGGAAGG + Intronic
1196899044 X:120365445-120365467 TTCCTCAAAGGCCATTTAGAGGG - Intronic
1197524272 X:127543068-127543090 TTCCTAAATGGAAAACAAGAAGG - Intergenic
1199366338 X:146988739-146988761 TTACTAAAAGGAAAACAAGAAGG + Intergenic