ID: 970429614

View in Genome Browser
Species Human (GRCh38)
Location 4:15976825-15976847
Sequence AGGAATGACTTGCCTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970429609_970429614 8 Left 970429609 4:15976794-15976816 CCGTGGAGTTGTGCCTTCTAGAT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 970429614 4:15976825-15976847 AGGAATGACTTGCCTCCAGCTGG No data
970429611_970429614 -5 Left 970429611 4:15976807-15976829 CCTTCTAGATTCCCTTTTAGGAA 0: 1
1: 0
2: 0
3: 20
4: 205
Right 970429614 4:15976825-15976847 AGGAATGACTTGCCTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970429614 Original CRISPR AGGAATGACTTGCCTCCAGC TGG Intronic
No off target data available for this crispr