ID: 970431618

View in Genome Browser
Species Human (GRCh38)
Location 4:15994165-15994187
Sequence CTGTGTTCACAGATTAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970431618_970431622 2 Left 970431618 4:15994165-15994187 CCTTGTTTAATCTGTGAACACAG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 970431622 4:15994190-15994212 GTGGGGCTGCATGTCCCCAGTGG 0: 1
1: 0
2: 6
3: 27
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970431618 Original CRISPR CTGTGTTCACAGATTAAACA AGG (reversed) Intronic
908533847 1:65059219-65059241 CTGTGTTCACTCATTTGACATGG - Intergenic
908645755 1:66275945-66275967 CTGTGTCCACAGAGTAAGCTGGG + Intronic
909087586 1:71186036-71186058 ATGAGATCACAGATTAAACGTGG - Intergenic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
910191382 1:84599407-84599429 CTGTTCTCACTGATTAGACATGG + Intergenic
911463638 1:98223060-98223082 CTGTGTTCACAAAGTTAAAAGGG - Intergenic
912068844 1:105781600-105781622 CTGTCTTCTCATATTAAAGAAGG + Intergenic
914689988 1:150017322-150017344 CTGGGTTAAGAGATTAAAAAAGG + Intergenic
916453888 1:164950368-164950390 CTCTCTTCACAGTTTAAAAAAGG + Intergenic
918185772 1:182126517-182126539 CTGTGTTCTGAGATAAAGCAAGG - Intergenic
918197530 1:182236136-182236158 CTGTGTGCACACATCAAGCAAGG + Intergenic
918964532 1:191325018-191325040 CTTTTTTCACAAATTAAAGAGGG - Intergenic
919185627 1:194144662-194144684 CTGAGATCAAAGATTATACAGGG - Intergenic
919289175 1:195606686-195606708 CTGTTTTGATAGATTAAAAATGG + Intergenic
919993720 1:202728585-202728607 ATGTGGTAACAGAGTAAACAAGG + Exonic
923090052 1:230733598-230733620 CTGTTTTCACACAATAAGCAAGG - Intergenic
1063529242 10:6814964-6814986 CTGTTTTCACGTATGAAACAGGG + Intergenic
1064492866 10:15878198-15878220 TTGTGCTCACAGTGTAAACAAGG - Intergenic
1066287702 10:33984400-33984422 CTGTTTTCACTTATTAATCATGG + Intergenic
1067135655 10:43605463-43605485 CTGTTTGCGCAGATTAATCAGGG - Intergenic
1067280844 10:44871432-44871454 CTATGTTCACACATTAATCTGGG + Intergenic
1067841956 10:49688289-49688311 TTGTGTTGACAGACTAAACAGGG - Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1071739894 10:88345823-88345845 CTGTCTTTATAGATTAAAAATGG - Intronic
1072812533 10:98474279-98474301 CTGTGTCCAGAAACTAAACATGG + Intronic
1077852025 11:6082397-6082419 CTGTGGTCACAGAGAATACAAGG + Intergenic
1079521507 11:21332507-21332529 CTGTTTTCAGACATCAAACAAGG - Intronic
1080703730 11:34668453-34668475 CTGTTTTCACAGCTTCAGCAGGG - Intergenic
1080762005 11:35260220-35260242 TTGTTCTCACAGATTACACAGGG + Exonic
1081281348 11:41212282-41212304 CTGTGTTAAGAAATTAATCAAGG + Intronic
1082766758 11:57174925-57174947 TTGTATTCACAGATTCAACCAGG + Intergenic
1083076569 11:60045468-60045490 CTATTTTCACATATTAAGCAAGG - Intronic
1084765365 11:71304870-71304892 CTGTGTTCAAAAAATAAAAAAGG + Intergenic
1085728432 11:78975458-78975480 CTGTGACCACAGATTATTCAAGG - Intronic
1086258032 11:84903247-84903269 CTGTGTTCAGAGAGTAAAGAAGG - Intronic
1086320649 11:85643667-85643689 CTGTATCAACAGACTAAACAAGG + Intergenic
1087268478 11:96086473-96086495 CTCTGTTCCCAGATTAAAATGGG - Intronic
1090775380 11:129960257-129960279 CTTTGGTCACACATAAAACATGG + Intronic
1091009445 11:131985329-131985351 ATGTGTTCACAGATTGCACTTGG - Intronic
1091858364 12:3756926-3756948 CTTGGTTCATAGATGAAACAGGG - Intronic
1092399404 12:8161308-8161330 CTGGCTTCACAGAATAAACTAGG + Intronic
1094675624 12:32617339-32617361 CTGTGTTCAAAGATTAAATAAGG - Intronic
1096207566 12:49735798-49735820 CTTTGTTGACAGTGTAAACAAGG + Intronic
1097964813 12:65567511-65567533 CTATACTCACACATTAAACATGG + Intergenic
1099373621 12:81868623-81868645 CTATCTTCATAGATTAGACAGGG + Intergenic
1099743206 12:86668552-86668574 GTATGTGCACAGATTAAAAATGG - Intronic
1099955495 12:89349551-89349573 TTGTGTTCACAGATGAAGCCCGG - Exonic
1100871233 12:98912559-98912581 CAGAGTTCACAGATTAATGAGGG - Intronic
1101371005 12:104130488-104130510 CTATGTTCACAGATTATTAAAGG - Intronic
1101986579 12:109451814-109451836 CTGTGTTCCCACAGTATACAGGG + Intronic
1107427865 13:40312379-40312401 CTATGTTCACATATTACACATGG - Intergenic
1108778535 13:53797962-53797984 CTGTCTTCAAAGAGTAGACAGGG + Intergenic
1109225273 13:59686578-59686600 ATGTGTTCACGGACAAAACATGG + Intronic
1110905474 13:80882231-80882253 GTTTGTTGACAGATTACACAAGG + Intergenic
1110948462 13:81454788-81454810 ATGATTTAACAGATTAAACATGG + Intergenic
1111920397 13:94403870-94403892 TTGTGTTCTCATATTAAAGACGG - Exonic
1112071165 13:95852026-95852048 ATGTGTTTACAGACTAAATAGGG - Intronic
1112375316 13:98834589-98834611 ATGTGTTCACAGATTTAATCTGG - Intronic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1116480116 14:45387003-45387025 CCGTGGTCAAAGATTAGACAGGG + Intergenic
1117157504 14:52955299-52955321 CTGTTTTCACAGACCAAAGAAGG + Intergenic
1117379569 14:55147173-55147195 GTGTGATCCCAGATTCAACAGGG + Intergenic
1119718776 14:76877116-76877138 CTGTGGTCACATAATAAACGTGG + Intergenic
1124559213 15:30756496-30756518 CTGTGTTACCAGATCAAACTTGG + Intronic
1124683878 15:31761941-31761963 CTGTCTTTACAGATTTATCAGGG - Intronic
1127743327 15:61936908-61936930 GTGTGTGCACACAGTAAACAAGG - Intronic
1128333280 15:66770239-66770261 CTGTGGTCTCAGATTAACCAGGG + Intronic
1131842209 15:96449521-96449543 CTGTGTTGACAAAATAAGCAGGG - Intergenic
1132208118 15:100000294-100000316 CTGTCTTCACATATTTAAGAAGG - Intronic
1132333282 15:101027043-101027065 CTGTCTTCCCAGACTAAACATGG - Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1134874531 16:17685401-17685423 CTGTGTTTAGTGATTATACATGG + Intergenic
1135196594 16:20399791-20399813 ATTTGTTCAAAAATTAAACAGGG - Intronic
1135897956 16:26426877-26426899 CTTTGCCCACAGATTAAACTTGG + Intergenic
1137775893 16:51054057-51054079 CTGTCTGCACAGATAAAACTTGG + Intergenic
1137852577 16:51761516-51761538 CTGTCTTCTCAAAGTAAACAAGG - Intergenic
1138725435 16:59133149-59133171 CTGTGTTCACAAAGTAAACTGGG + Intergenic
1141357545 16:83362589-83362611 CTGTGTCCTCACATGAAACATGG - Intronic
1145077866 17:19870052-19870074 CTGTATTCACAGGCCAAACATGG + Intergenic
1149489611 17:57074113-57074135 CTCAGTTCACAGATGAGACAAGG + Intergenic
1150986828 17:70207312-70207334 CTGTGTTTAAAGAGTAAAAAAGG - Intergenic
1152143853 17:78555687-78555709 CAGGGTGCCCAGATTAAACATGG + Intronic
1155336284 18:24768677-24768699 CTACGTTGAAAGATTAAACAAGG - Intergenic
1155742478 18:29306451-29306473 CTGTTTTCACAGATTATCTAGGG - Intergenic
1155757262 18:29515284-29515306 CCAAATTCACAGATTAAACAAGG - Intergenic
1156982606 18:43308441-43308463 CTGTCTTCACCAATTAAAAATGG + Intergenic
1157281751 18:46350918-46350940 CACTGTTCACAAATTAAACCCGG - Intronic
1157671943 18:49538065-49538087 CTGTGTTTGCAGTTTAAGCAAGG - Intergenic
1158803801 18:60945593-60945615 CTGTGGTTGCAGATGAAACATGG + Intergenic
1162772555 19:12958033-12958055 CTGTGTGCACAGAAGACACATGG - Intergenic
1163989256 19:20983139-20983161 CTGTGGACACAGAGTAAAGAAGG - Intergenic
1164450891 19:28363457-28363479 CTATGACCTCAGATTAAACAAGG + Intergenic
1164956360 19:32390185-32390207 CTGTGTTCCCAGGTTTCACATGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926853888 2:17231049-17231071 CTGTGTTCTCACAATAAACAAGG + Intergenic
928776854 2:34775943-34775965 CTGTGATAACAAAATAAACAAGG + Intergenic
928777765 2:34787572-34787594 CTGTTTTCAGAGAATAAACCAGG - Intergenic
931755597 2:65371362-65371384 CTGTTTGAACAGATTAAACTGGG + Intronic
932265642 2:70365118-70365140 CAGTCCTCAAAGATTAAACAGGG - Intergenic
933369240 2:81394251-81394273 CAGTGATCACAGATGAAAAAGGG - Intergenic
936411672 2:112263795-112263817 CTGTCTTCACAGCTGCAACAAGG + Intergenic
939349760 2:141020331-141020353 CAGTGTTAACAAATTAATCATGG + Intronic
939988213 2:148853067-148853089 CTGTGTTCTCATATGATACAAGG + Intergenic
940390310 2:153124883-153124905 TTGGGTTCATAGATTAAGCAAGG - Intergenic
940736350 2:157457211-157457233 CTGTGTTCCCTGAACAAACATGG + Intronic
942408467 2:175681328-175681350 CTTTGTTCAGAAAATAAACATGG + Intergenic
945650707 2:212555936-212555958 ATGTGTTCTCACATTACACAAGG + Intergenic
945952143 2:216049374-216049396 CTGTGTTTAAAAATAAAACAGGG + Intronic
946825146 2:223670300-223670322 AGGTGTGAACAGATTAAACAGGG - Intergenic
947275063 2:228381420-228381442 CTATGTTTACAGTTTAAATAGGG + Intergenic
948723124 2:239913714-239913736 CAGTGTTGACAGATCAAACATGG - Intronic
1173689123 20:44945832-44945854 CTGTGTTCAAAGTTTAAAACGGG - Intronic
1174269896 20:49360290-49360312 CTCTGTACACAGATTAAAGAGGG + Intergenic
1178121371 21:29473574-29473596 ATGAGGTCACAGATTAAGCAGGG - Intronic
952523996 3:34190569-34190591 CTGTTTTCACAGAGACAACACGG + Intergenic
954372381 3:50175596-50175618 CTGTGTCCACAGATGACTCATGG - Intronic
956299132 3:67750473-67750495 CTGTGTTCTCAGATTCTTCAAGG - Intergenic
956489412 3:69754829-69754851 CTGTATTCACAGCATCAACAAGG + Intronic
957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG + Intronic
958038048 3:88192845-88192867 CAGGGTGCCCAGATTAAACATGG - Intergenic
958256763 3:91333528-91333550 GTGTGTACTCAGATTAAAAATGG + Intergenic
959161868 3:102733636-102733658 GTCTGTTCTCAGACTAAACATGG - Intergenic
959979540 3:112500021-112500043 ATGTATCCACAGATTAAAGACGG - Intergenic
961684214 3:128618172-128618194 CTGTGAACACTGATTAAACGTGG + Intergenic
962077288 3:132095957-132095979 CTGTGGTCACAGTTTCTACAAGG - Intronic
965516279 3:169624745-169624767 CTGTTTTCCCAGACCAAACATGG + Intronic
966215203 3:177494929-177494951 TTGTATTGACAGATTCAACATGG + Intergenic
967948169 3:194820460-194820482 CTGTGGTCACAGGCTAGACAGGG + Intergenic
969287955 4:6219292-6219314 CTGTGTTAAGAAATTAAAAATGG - Intergenic
969692632 4:8712012-8712034 CTGTGCTCACTGATTAACAAGGG - Intergenic
970431618 4:15994165-15994187 CTGTGTTCACAGATTAAACAAGG - Intronic
971083572 4:23244185-23244207 TTGTATTCACAGATTATACAGGG - Intergenic
971337209 4:25734423-25734445 TTGTATTAACAGACTAAACAAGG - Intergenic
972979689 4:44680908-44680930 CTCAGTTCAAAAATTAAACAAGG - Intronic
973694256 4:53474621-53474643 CTGTAGTAACAGAATAAACATGG - Intronic
974225669 4:59039620-59039642 ATGTGTTCACAGATGGAAAAAGG - Intergenic
974943547 4:68497947-68497969 CTGTGTTTACAGTTCATACATGG + Intergenic
975116306 4:70684761-70684783 CTGGGATAACAGGTTAAACAGGG + Intronic
975127148 4:70795581-70795603 CTGTGTGTACATATTATACAAGG + Intronic
975191503 4:71468273-71468295 CTTTGTGGAAAGATTAAACAAGG + Intronic
976391286 4:84506983-84507005 TTGTGTTTATATATTAAACAGGG + Intergenic
976759182 4:88529944-88529966 CTGTGTTCTCAGATTATATTAGG + Intronic
977486570 4:97655134-97655156 CTATTTTCACTGATAAAACATGG + Intronic
979059509 4:116039464-116039486 CTATGTCCTCAGATTAAACAGGG - Intergenic
979186367 4:117799573-117799595 CTGTATTAACAGACTAAAAAAGG + Intergenic
981611982 4:146603275-146603297 CTGTGTTCACAGAACACACTTGG + Intergenic
982660771 4:158203776-158203798 AAGTGTTCAGAGATTAAATATGG + Intronic
984061412 4:174992476-174992498 CAGTGTTCACAGCTTCAACAGGG + Intergenic
984501490 4:180564849-180564871 ATGTGTTCTTAGATTTAACAGGG + Intergenic
989466254 5:41758934-41758956 CTGTGTGCCCAGATAAAACAGGG + Intronic
989487354 5:42007562-42007584 CTGGGTACTCAGATTAATCAAGG - Intergenic
994771760 5:103990405-103990427 CTGCCTTCCCAAATTAAACAAGG + Intergenic
994781167 5:104092642-104092664 CTATGTTCACATATTATTCATGG + Intergenic
995622362 5:114040040-114040062 GTGTGTGCCCAGATTAAAAATGG + Intergenic
999524848 5:152393435-152393457 CCTTGTTTACAGAATAAACATGG + Intronic
999884221 5:155902595-155902617 CTGTGGTCACAGAATAACTAGGG - Intronic
1000380422 5:160624071-160624093 CTGAGTTCACAGCTAAATCACGG + Intronic
1000712359 5:164596400-164596422 ATGTGATCACAGAATAGACATGG - Intergenic
1003043028 6:2705506-2705528 CTGTGTTCCCTGTTTAAGCAGGG + Intronic
1004260249 6:14101641-14101663 CTGGAGTCACCGATTAAACAGGG - Intergenic
1008181495 6:48335606-48335628 ATGTGCTCACAGAGTAACCAGGG - Intergenic
1008836614 6:55839603-55839625 CTTTGTTCACAGACCAAGCATGG - Intronic
1008906886 6:56687648-56687670 CTGTGTTGACAAATTCAATATGG - Intronic
1008910732 6:56729630-56729652 CTGTGGGCTCAGATTAAATAGGG - Intronic
1008998573 6:57687634-57687656 GTGTGTACTCAGATTAAAAATGG - Intergenic
1012216137 6:96586930-96586952 CTGTGATAAGAGATGAAACACGG + Intronic
1012482817 6:99687012-99687034 TTGTGTTCACAGATCAAAAGGGG - Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013520380 6:110927252-110927274 CTGTGATCACAGAAAAAGCAAGG - Intergenic
1014406387 6:121057287-121057309 CTGTGTTGACAGATAAGCCAGGG + Intergenic
1014600145 6:123401371-123401393 CTTAGTCCTCAGATTAAACAGGG + Intronic
1015225197 6:130849755-130849777 CTTTCCTCACAGTTTAAACAAGG + Intronic
1015240341 6:131015480-131015502 TCGAGTTCACAGTTTAAACATGG + Intronic
1017002433 6:150005478-150005500 CTGTGTTGAAAAATTAAACGAGG - Intergenic
1017393336 6:153966363-153966385 CTGTGTGCACATATTTTACAAGG + Intergenic
1018294203 6:162328412-162328434 CTGTGTTCACAGAACAAGCAGGG - Intronic
1019903609 7:4043548-4043570 CTGAGTTCACCCATTTAACAAGG - Intronic
1021013273 7:15498506-15498528 TTGTGTGCACAGAATAAAGAAGG + Intronic
1021583636 7:22184231-22184253 CAGTGGACACAGAATAAACAAGG + Intronic
1022254249 7:28640281-28640303 CTGAGTTCACATGGTAAACATGG - Intronic
1023002700 7:35827906-35827928 CTCTGTACAAAGATAAAACATGG - Intronic
1023274558 7:38503825-38503847 ATGTGGACACAGACTAAACAAGG + Intronic
1023285293 7:38612798-38612820 ACGTGTTCAAAGTTTAAACAAGG + Intronic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1025146152 7:56506026-56506048 CTGAGTTAACAAATTATACAAGG + Intergenic
1025273387 7:57548892-57548914 CTCTGTTCATATATTAGACAAGG - Intergenic
1026432749 7:70363976-70363998 CTGTGTACACAAATAACACAAGG - Intronic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1028785982 7:94794830-94794852 CTATGCTCACAGTGTAAACAAGG + Intergenic
1033021569 7:137730319-137730341 CTGTGTTCAGAGGTGAACCACGG - Intronic
1036222948 8:6936131-6936153 CTGTGTTCCCAGGCTCAACAAGG - Exonic
1038113104 8:24522407-24522429 ATGTGTTCATACATTTAACATGG - Intronic
1038253083 8:25924682-25924704 CTTTGTTCGCAGAGAAAACAGGG + Intronic
1039095781 8:33883492-33883514 CTGTGTCCACAGTTTAATTAGGG - Intergenic
1039804636 8:40987618-40987640 CTGTCTTCACATCTTCAACAGGG + Intergenic
1039854752 8:41402605-41402627 CTGTGCTAACAGATAAAACAAGG - Intergenic
1040909640 8:52504896-52504918 CTGTGTTCAGAGACTAAAAATGG + Intergenic
1040931505 8:52739819-52739841 CTGTGCTCACAAATAAAGCAAGG + Intronic
1041546424 8:59048421-59048443 ATGTCTTCACAGATAAAAAAGGG - Intronic
1042090856 8:65158267-65158289 CTCTGGTCACAGTTTTAACATGG + Intergenic
1042215576 8:66427723-66427745 TTATTTTCACAGATGAAACAAGG - Intergenic
1043515542 8:80991643-80991665 CTTTGTTGACAAAATAAACATGG - Intronic
1043593394 8:81855947-81855969 CACTGTGCACAGATGAAACATGG - Intergenic
1043888894 8:85634251-85634273 CTGTCTTAACAGATAAAACAAGG + Intergenic
1046508047 8:115161486-115161508 CTGAGTTTAGAGATTAAAGATGG - Intergenic
1046930235 8:119834677-119834699 CTATGTACACAGTGTAAACAAGG - Exonic
1047547792 8:125836771-125836793 CTGTGCTCACAGATTCCACCTGG - Intergenic
1047745873 8:127844595-127844617 CTCTGTTCACAGTTAACACAGGG - Intergenic
1048192857 8:132306099-132306121 CTATGTTCCCACACTAAACATGG - Intronic
1050789307 9:9446315-9446337 GTCTCTTCACAGATAAAACAAGG + Intronic
1050836063 9:10079994-10080016 ATGTGTGGACAGAATAAACAAGG + Intronic
1051341660 9:16117741-16117763 ATGTGTTCACAGATTATTCTAGG + Intergenic
1051368505 9:16338544-16338566 CTGTGTACACAGATACCACACGG - Intergenic
1051399684 9:16666677-16666699 CTGTTTTCCTAGTTTAAACATGG + Intronic
1053555719 9:39134971-39134993 CTGTGATCACATCTTAACCATGG - Intronic
1054782687 9:69180039-69180061 TTATGTTCACAGAGAAAACATGG + Intronic
1055093343 9:72385254-72385276 CTGTGCTCACAGTTTTCACATGG + Intergenic
1056988071 9:91383492-91383514 CTAGGTACACAGATTAAACCCGG - Intergenic
1057718777 9:97516274-97516296 CTGTGTTCCCAGATTGAGCCGGG - Intronic
1058343391 9:103926330-103926352 CTGGGTTCTAAGATTAAAAATGG + Intergenic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1059703698 9:116800400-116800422 CTGTGTGCAAAAATTAAGCATGG - Intronic
1061017264 9:127989129-127989151 CTCTGTACACAGTGTAAACAGGG - Intergenic
1061647374 9:132015921-132015943 CTCTCTTCTCAGATTAAGCAAGG + Intronic
1190649052 X:52551193-52551215 CTGTGCTCACAGTGTAAATAAGG + Intergenic
1193031746 X:76906443-76906465 CTATGTACCCAGATTAAAAATGG - Intergenic
1193104016 X:77648659-77648681 CTTTTTGCACAGATTAATCAAGG + Intronic
1195729343 X:107949885-107949907 CTGAGTTTACAGATTTAACCAGG + Intergenic
1201313551 Y:12620925-12620947 GTATGTTCCCAGATTAAAAATGG - Intergenic