ID: 970435428

View in Genome Browser
Species Human (GRCh38)
Location 4:16029652-16029674
Sequence TCTTTTCTTTAGGGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970435428_970435434 2 Left 970435428 4:16029652-16029674 CCCTTCACCCCCTAAAGAAAAGA 0: 1
1: 0
2: 3
3: 32
4: 297
Right 970435434 4:16029677-16029699 TACATTTTTTAAAATAAAAAAGG 0: 1
1: 6
2: 48
3: 459
4: 2963

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970435428 Original CRISPR TCTTTTCTTTAGGGGGTGAA GGG (reversed) Intronic
901583086 1:10262141-10262163 TCTTTTTTTTGGGGGGTGCGCGG + Intronic
902567561 1:17322482-17322504 TCTTTTTTTTTGGGGGGGGATGG - Intronic
903393778 1:22983751-22983773 GCTGTGCTTTAGGGTGTGAAAGG - Intergenic
903898510 1:26624806-26624828 GGTTTTCTTTGAGGGGTGAATGG - Intergenic
906076484 1:43055807-43055829 TGTTTTCTTTAGGGGGAGTGGGG + Intergenic
907144276 1:52218629-52218651 TGTTTTATTTAGGGTGCGAATGG + Intronic
908238336 1:62168532-62168554 TCTTTTCTTTTTGGGGGGAGTGG - Intergenic
909754971 1:79214404-79214426 TCTTTTCTTTATGTAGAGAAGGG + Intergenic
910015759 1:82521275-82521297 TCTTTTCTTTAGGATAAGAAGGG + Intergenic
910242963 1:85108067-85108089 TCTGTTGTTTGGGGGGTTAAAGG - Exonic
910509823 1:87991303-87991325 TGTTTTATTTAGGGAGAGAAAGG + Intergenic
913231918 1:116747039-116747061 GCTTTTGTTTAGTGTGTGAATGG - Intergenic
917271765 1:173283287-173283309 TCTCTTTTTTGGGGGGGGAAAGG - Intergenic
918377863 1:183927078-183927100 TATGTTCTTTAGGGGGAAAACGG - Exonic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
922191789 1:223325156-223325178 TCTTTTCTTTGGGGGAAGACAGG - Intronic
924671288 1:246128723-246128745 TTCTCCCTTTAGGGGGTGAAAGG + Intronic
1062885486 10:1012986-1013008 TCTTTTTTTTAGGGGGGAGATGG + Intronic
1065957085 10:30703505-30703527 CCTTTTCTGTAGGGTGGGAAGGG - Intergenic
1065974342 10:30829352-30829374 TCCTTTCTTTCTGGGCTGAAGGG - Intronic
1069161167 10:65094026-65094048 TCTTTTATTTGTGGGGTGAGGGG - Intergenic
1071934402 10:90511474-90511496 CCTTTCCTTAAGGGGGTGAGTGG - Intergenic
1072392406 10:95000493-95000515 TCTTTTCTTTTGGGGGGGGAGGG - Intergenic
1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG + Intergenic
1075801057 10:125153513-125153535 TCTCTGCTGGAGGGGGTGAAAGG - Intronic
1077715413 11:4575463-4575485 TCTTTTTTTTGGGGGGGGAGGGG - Intronic
1080339921 11:31250515-31250537 TCTATTCTTTAAGGGGTTTAGGG - Intronic
1082215490 11:49562247-49562269 TGTTTTCTTTATGGAGTGCAGGG + Intergenic
1082889238 11:58120915-58120937 TTTTTTGTTAAGGGGGTGGAAGG - Intronic
1082910683 11:58370870-58370892 TATTTTCTTTAGGAGATAAAAGG - Intergenic
1083082578 11:60109196-60109218 TCTTTTTTTCGGGGGGTGGAGGG - Intergenic
1083316964 11:61821364-61821386 TCTTTTCTTTAGAGAGAAAATGG - Intronic
1084447356 11:69211507-69211529 TCTTTTCTGAAGGGGGCAAATGG + Intergenic
1084616710 11:70241140-70241162 TCTTTTTTTTTGGGGGGGGACGG + Intergenic
1085087335 11:73678727-73678749 TTTTTTTTTTGGGGGGGGAATGG + Intronic
1085507669 11:77069432-77069454 TCTTGGCTTTAGTGGGTGAAGGG + Intronic
1085701461 11:78749726-78749748 GCCTTTCTATAGGGTGTGAATGG + Intronic
1086295259 11:85359846-85359868 TCTTTTCTTTTGTGTGTGACGGG - Intronic
1086634082 11:89062233-89062255 TGTTTTCTTTATGGAGTGCAGGG - Intronic
1087376934 11:97354334-97354356 TCTTTTTTTGAGGGTGAGAAAGG - Intergenic
1087474031 11:98615192-98615214 TTTTTTCTTTAGTGGGTGGCTGG + Intergenic
1088329373 11:108634270-108634292 TCTTTTTCTTATGGGTTGAATGG + Intergenic
1088603611 11:111507726-111507748 TCTCCTCTTTAGGGGCTGACAGG - Intronic
1088793610 11:113248629-113248651 TCTTTTTTTGAGGGGGTACAAGG - Intronic
1089334254 11:117712233-117712255 TTTCTTCTTCAGGGGATGAAGGG - Intronic
1091147658 11:133293861-133293883 TTTTTTCTTTAGGATGTTAAGGG - Intronic
1092084926 12:5748858-5748880 TTTTTTTTTTGGAGGGTGAAGGG - Intronic
1100845417 12:98653319-98653341 TGTTTTCTTTGGGTGGTGATTGG + Intronic
1101484941 12:105147153-105147175 ACTTTTCTTTGGGGGTTGAGTGG + Intronic
1103770256 12:123317007-123317029 TCTTTTCTTTTGGTGGAGAAAGG + Intronic
1103869904 12:124084030-124084052 TCTTTTTTTTAGGGGGAGGACGG + Intronic
1104143874 12:126013762-126013784 TCTTTTTTTTGGGGGGGGGATGG - Intergenic
1105575990 13:21652253-21652275 TGTTTTCTTTTGTGGATGAAGGG + Intergenic
1105738303 13:23295403-23295425 TTTTTTGTTTAGGGCCTGAAGGG + Exonic
1107083275 13:36397777-36397799 TCTTTTTTTTTGGAGATGAATGG - Intergenic
1107557270 13:41527805-41527827 TCTTTTCCTTAGGAAGTCAAGGG - Intergenic
1107744162 13:43487278-43487300 TCCTTTCTGTTGGGGATGAATGG + Intronic
1107885346 13:44870493-44870515 TCTTCTCTTTGGGGGCTGCAAGG + Intergenic
1108478600 13:50844176-50844198 TCTTTTGTTTGGGGGATGCAAGG - Intergenic
1108650394 13:52472626-52472648 TCTTTTCTTTTTTGGGAGAAAGG - Intronic
1109563918 13:64085971-64085993 TCTTTTTTTTGGGGGGTGCGGGG - Intergenic
1110337397 13:74347569-74347591 TTTTTTTTTTATGGGGGGAAGGG - Intergenic
1111614132 13:90642507-90642529 TATTTTCTATAAAGGGTGAAGGG - Intergenic
1112777328 13:102859207-102859229 TCTGTCCTATAGTGGGTGAATGG - Intronic
1114152317 14:20057180-20057202 TGTTTTCTTTGGGGGGTGGTGGG - Intergenic
1115572215 14:34677342-34677364 TCTTTTTTGTAGGGGCTGGATGG + Intergenic
1118001121 14:61524958-61524980 TCTTATTTTTAGGGGATGGAAGG - Intronic
1118113533 14:62749522-62749544 TCTCTTCCTTAGGAGGGGAAGGG + Intronic
1118596377 14:67438402-67438424 TCCTTTCTTTATGGGGTTAGAGG + Intergenic
1119057027 14:71432990-71433012 TCTTTTGCTTAGAGTGTGAATGG + Intronic
1119501674 14:75133749-75133771 TATGTCCTTTAGTGGGTGAATGG + Exonic
1120896174 14:89534467-89534489 TCCTTTCTTTAAGGGCTAAAAGG - Intronic
1121404815 14:93713243-93713265 TCTTTCCTGTAAGGAGTGAAGGG + Intergenic
1121412105 14:93755353-93755375 TCTTTTTTTTACGAGCTGAATGG + Intronic
1121945148 14:98113248-98113270 TCTGTTCCTTAGCAGGTGAAGGG - Intergenic
1124797288 15:32794184-32794206 TTTTTTCTTTTGGGGGCGAGGGG - Intronic
1125208655 15:37184440-37184462 TCTTTACTTTGGGGAGTAAAAGG + Intergenic
1125458762 15:39888243-39888265 TGGTTTTTTTGGGGGGTGAAGGG + Intronic
1128030868 15:64478922-64478944 TGTTTTCTTTAGTGGTTGAAAGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130990027 15:88870710-88870732 CTTTTTATTTTGGGGGTGAATGG - Intronic
1131823774 15:96299692-96299714 TCTTATCTTTTGGGGGGAAAGGG + Intergenic
1131951995 15:97691228-97691250 ACTTTTGCTTAGGGCGTGAAGGG - Intergenic
1132983004 16:2748873-2748895 TCTTTTCTGGAGGGGGAGGAGGG - Intergenic
1134095364 16:11415175-11415197 CCTGTTCTGTAGGGGGTGATGGG - Intronic
1134211154 16:12278453-12278475 TCTTTTCTTTTGAGGGTGAGGGG - Intronic
1135094807 16:19555993-19556015 AGTTTTCTTTAGGGAATGAATGG - Intronic
1136521773 16:30801356-30801378 TCTTTTTTTTAGAGAGAGAAAGG + Intergenic
1137805119 16:51297580-51297602 TGTAGTCTTTAGGGGGTGATAGG + Intergenic
1138125521 16:54435439-54435461 TGTTTTCTATAGGGGTTCAAGGG + Intergenic
1138134478 16:54509692-54509714 TCTTCTCTTCAGAGGCTGAAGGG + Intergenic
1139843462 16:69901378-69901400 TCTTTTCTTTAGGATGTGAAAGG + Intronic
1140592537 16:76370809-76370831 TATTTTCTTTATGGGTTGAAAGG - Intronic
1140723401 16:77790123-77790145 TCTGTTCTCAAGGTGGTGAACGG - Intronic
1140778510 16:78272876-78272898 TGTTGTCTTGTGGGGGTGAAAGG - Intronic
1140837967 16:78812723-78812745 TTTTTTTTTTAGGGGGTGGGAGG - Intronic
1146236171 17:31165658-31165680 ACTTTTCTTTAGGGGAAGATAGG + Intronic
1147654225 17:42079666-42079688 TCTTTTTTTTGGGGGGTGATGGG - Intergenic
1148531450 17:48397228-48397250 TCTTTCTTTTAGGGGGGGGATGG + Intronic
1148611331 17:48966550-48966572 TCTTTTTTTTTGGGGGGGGATGG - Intronic
1149203761 17:54219074-54219096 TATTTTCTTGAGGGAGTGGATGG - Intergenic
1149579009 17:57734976-57734998 TTTTTTCTTTCTGGGGTGGAGGG - Intergenic
1149751194 17:59146995-59147017 TCTTTTTTTTTGGGGGGGACGGG + Intronic
1150844097 17:68637511-68637533 TCCTTTCTTTAGGTGAGGAAGGG + Intergenic
1152002619 17:77655942-77655964 TCATCTCTTGAGGGGGTGAGGGG - Intergenic
1152320903 17:79608466-79608488 TTTTTTCTTTGGGGGGAGGAGGG + Intergenic
1153744818 18:8166983-8167005 TCTTTTATTAACTGGGTGAAGGG - Intronic
1156706105 18:39884339-39884361 TCTTCTCTATGGGAGGTGAAAGG - Intergenic
1160302551 18:77697648-77697670 CCTTTTCTTTATGGGGTAAATGG + Intergenic
1163535991 19:17876854-17876876 TTTTTTTTTTAGGGGGGGGACGG - Intronic
1165024610 19:32950557-32950579 GCTTTTTTTGTGGGGGTGAAGGG - Intronic
1165209550 19:34223077-34223099 TCTTTTTTTTGGGGGGTGGAGGG + Intronic
926316975 2:11717011-11717033 TCTTGTCTTTAGGTTGGGAAAGG + Intronic
926348111 2:11968097-11968119 TCTTTTCTTTACGGGGACAGTGG + Intergenic
926511560 2:13787372-13787394 TCTTTTTTTTGGGGGGGGGAAGG + Intergenic
933088458 2:78087775-78087797 CCTTTTCTTTAGGGTCTAAAAGG - Intergenic
933978689 2:87532812-87532834 CCTTTTCTACAGGGGCTGAATGG - Intergenic
935224308 2:101039807-101039829 TCTTTTTTTTGGTGAGTGAAAGG + Intronic
936315143 2:111417983-111418005 CCTTTTCTACAGGGGCTGAATGG + Intergenic
937274688 2:120676131-120676153 TCTTTTCTTTAACGGGTCATTGG - Intergenic
937463253 2:122107734-122107756 TCATTTCTTTCTGGGGAGAAGGG + Intergenic
939367517 2:141252195-141252217 TTTTTTTTTTAGGGGGTGGGGGG - Intronic
939797061 2:146658149-146658171 TCCTTTCTTTAGAAGGTAAAGGG - Intergenic
939844125 2:147222439-147222461 TCTTTTCTTTTGGGAGGGATAGG + Intergenic
939875996 2:147578316-147578338 ACTTTTCTATAGGGGGAGAAAGG + Intergenic
941039691 2:160607133-160607155 TCTTTTTTTTGGGGGGTGGGGGG + Intergenic
941923093 2:170871047-170871069 TCTTCTTTTTTGGGGGTGGAGGG + Intergenic
942226300 2:173819467-173819489 TCTTTTCTTTATGAAGTGTAGGG - Intergenic
942471810 2:176268694-176268716 TCTCACCTTTCGGGGGTGAACGG - Intergenic
942612510 2:177756449-177756471 TCTTTTCTGTTGGTGGTGAGGGG + Intronic
943199630 2:184803857-184803879 TCTTTTTTTTTGGGGGGGAGGGG + Intronic
944240713 2:197482689-197482711 TCTTCTTTTTTGGGGGTGAGGGG + Intergenic
946424045 2:219582792-219582814 TCTCTTCCTTAGTGGGGGAAGGG + Intergenic
946834387 2:223757702-223757724 TCTTTTCTTTGGGGAGGAAAGGG + Intronic
947165070 2:227253549-227253571 TTTTGTCTTTAGGGTGTGAAAGG + Exonic
947165383 2:227256331-227256353 TCTTTTCTTTAGGGAGTCAAGGG + Exonic
1169454360 20:5739083-5739105 TTTTTTTTTTAGGGGGGGACAGG + Intergenic
1169564357 20:6837274-6837296 TTTTTTTATTAGGGGGTGCAGGG + Intergenic
1169608692 20:7353585-7353607 TCTTTTCTTTAGAGAGAGAGAGG - Intergenic
1170193709 20:13669281-13669303 TCTTTTTTTTGGGGGGGGGATGG + Intergenic
1171028651 20:21655916-21655938 TCTCTTCCTTAGTGGGGGAAGGG - Intergenic
1172259243 20:33547945-33547967 TCTTTTCTTTTTGTGGAGAATGG + Intronic
1173096089 20:40029747-40029769 ACTTTTCTTTAGTGCATGAAAGG - Intergenic
1174767679 20:53269220-53269242 TTTTTTCTTTAGGTGATCAAGGG - Intronic
1174904532 20:54536717-54536739 TCTCTTCTTTAGTGTTTGAATGG - Intronic
1175584719 20:60129357-60129379 TCTGTCTTTTAGTGGGTGAATGG + Intergenic
1176720774 21:10390764-10390786 TATTTTTTTGAGGGGGGGAAGGG - Intergenic
1177244904 21:18510559-18510581 TCTTTGCTTCAGAGGGTGCAAGG + Intergenic
1177685978 21:24438032-24438054 TCTTTTTTTTGGGGGGGGATGGG - Intergenic
1177887397 21:26762853-26762875 TCCTTGCTTTAAGGTGTGAAAGG + Intergenic
1178115176 21:29409569-29409591 TTTTTTCTTTTGGTGGTTAATGG - Intronic
1178722084 21:35018984-35019006 GGTTTTCTTTGGGGGTTGAAGGG + Intronic
1178730920 21:35101755-35101777 TCTTTCTTTTAGGGGGTGACAGG + Intronic
1180301965 22:11043557-11043579 TTTTTTTTTGAGGGGGGGAAGGG - Intergenic
1180698752 22:17770407-17770429 TCTTTGGTTTTGGGGGAGAATGG + Intronic
1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG + Intronic
1182908469 22:33959052-33959074 TCTTTTCTTTTGGGGGGGGTTGG + Intergenic
1184546764 22:45175486-45175508 TCATTTCTTTAGGCAGTAAATGG + Intronic
949271747 3:2225149-2225171 TCTTTTTTTTTGGGGGTGGTGGG - Intronic
951651462 3:24955684-24955706 CCTTTTTTTTAGGGGGTGGAAGG + Intergenic
951910925 3:27749463-27749485 TCTTTTTTTTAGGGGGGGACTGG + Intergenic
952000369 3:28778298-28778320 TCTTTTCTTAATGGGGCAAAAGG + Intergenic
952335328 3:32398980-32399002 TCTTTTCTTTTTGGGGGGATGGG - Intronic
952567557 3:34677524-34677546 TTTTTTCTTTTGGGGGAGGAGGG + Intergenic
953168769 3:40488654-40488676 TTTTTTTTTTAGGGGGTGGGGGG + Exonic
955013188 3:55040083-55040105 TCTCTTCTTTAGTTAGTGAATGG + Intronic
955430269 3:58836561-58836583 TCTGTTCTTCATGGGCTGAAGGG + Intronic
956178276 3:66494721-66494743 TCTTTTTTGTAGGGGGTGGTGGG - Intronic
957254935 3:77824953-77824975 TCTCTTCTGTAGGGGGTGGGGGG + Intergenic
957384482 3:79478389-79478411 TCTTTTTTTTGGGGGGTGGGGGG - Intronic
957414925 3:79889633-79889655 TTAATTTTTTAGGGGGTGAATGG - Intergenic
957836712 3:85603289-85603311 TCTTTTTTTGAAGGGGAGAAGGG + Intronic
959010477 3:101070179-101070201 TATCTTCTTTAGGGGCTGAATGG + Intergenic
959914077 3:111796204-111796226 TGTTTTCTTTAGAGGGAGAGAGG + Intronic
960471734 3:118074893-118074915 TCTTTTGTTTAGGGGAAGTAAGG - Intergenic
960482957 3:118215520-118215542 TTATTTCTTTTGGGGGTGAGGGG + Intergenic
960493470 3:118347196-118347218 TCTTTTCTTGTGGGGGAGGAGGG - Intergenic
961413449 3:126740487-126740509 CATTTTCTTTGGGGTGTGAAGGG - Intronic
962294718 3:134172634-134172656 GCTTTTTTTTAGGGAGAGAAAGG - Intronic
962677240 3:137765898-137765920 TCTTTTCTTCAGGGGACAAAAGG - Exonic
964384635 3:156134385-156134407 TCTTTACTTTAGGGAGGGATGGG + Intronic
966609723 3:181856446-181856468 TATTTTGTGTAGGGGGTAAAAGG + Intergenic
967353593 3:188543076-188543098 TCTTTCCTTTAGGATGTGACTGG + Intronic
967656474 3:192056279-192056301 TTTTTTTTTCAGGGGGTGGATGG - Intergenic
967694046 3:192510721-192510743 GATGTTCTTTAGTGGGTGAATGG + Intronic
968896150 4:3404814-3404836 TCTTTTCTGTAGAGGGTGTCAGG + Intronic
970435428 4:16029652-16029674 TCTTTTCTTTAGGGGGTGAAGGG - Intronic
970598114 4:17618313-17618335 TTTTTTCTTGAGTGGGTGGAGGG + Intronic
970842813 4:20495133-20495155 TCTTTTCTTTACAGTCTGAAAGG - Intronic
971961316 4:33490711-33490733 TCTTTTCTTCCTGGGGTGGAAGG + Intergenic
972307589 4:37846918-37846940 TTTTTTCTTTCAGTGGTGAATGG + Exonic
972475175 4:39443368-39443390 TCTTTTTTTTGGGGGGAGTAGGG - Intronic
973088033 4:46093261-46093283 TCCTTTTTTTTGTGGGTGAATGG - Intronic
974380408 4:61132577-61132599 TCTTTTCTCTAGTAGGAGAATGG - Intergenic
976358372 4:84147619-84147641 TCTTTTCATTATGGACTGAAAGG - Intergenic
976385517 4:84453405-84453427 TCTTTGGTTTAGGGGTTGAAGGG + Intergenic
976965769 4:91038812-91038834 TATTTTATTAAGGGAGTGAAGGG + Intronic
978415567 4:108472278-108472300 AATTTTCTTTAGCAGGTGAATGG + Intergenic
980920668 4:139083353-139083375 TTGTTTTTTTAGGGGGAGAATGG - Intronic
982149682 4:152439235-152439257 TTTTTTTTTTAAGGGGTGAGAGG + Intronic
982730964 4:158954837-158954859 TTTTTTCTCTAAGAGGTGAATGG - Intronic
983482805 4:168295985-168296007 TCTTCTCTTCAGAGGGTGAGGGG + Intronic
985283134 4:188306645-188306667 TATTTTCTTTTGTGGGAGAAGGG + Intergenic
986391444 5:7290959-7290981 GCTTTTTTTTAGGGTGTGTAAGG + Intergenic
987513229 5:18870273-18870295 TTTTTTCTGTAGGGTTTGAAAGG - Intergenic
987885941 5:23812273-23812295 TTTTATTTTTAGGGGGTGAAAGG + Intergenic
988212716 5:28226582-28226604 TATGTTCTTCAGTGGGTGAAAGG - Intergenic
988460929 5:31437354-31437376 TCTTTTCTTGCGGGGGTGGGTGG - Intronic
988963329 5:36391111-36391133 TCTTTTCCTTTGGTGGTGAGTGG - Intergenic
990858952 5:60304158-60304180 TCTTTTCTTTATTGGATAAAAGG + Intronic
990906333 5:60807169-60807191 TTTTTTCTCCAGGTGGTGAATGG + Intronic
990906561 5:60809816-60809838 TTTTTTCTCCAGGTGGTGAATGG + Intronic
992141836 5:73805196-73805218 TCTTTTTTTTAGGGTGGTAAAGG + Intronic
992731993 5:79680963-79680985 TCTTCACTTTTGTGGGTGAAAGG + Intronic
993457218 5:88141057-88141079 TCTGGTATTTAGGGGGAGAAAGG + Intergenic
993600206 5:89913514-89913536 TCATTTCTTTTGTGTGTGAATGG - Intergenic
993651771 5:90530026-90530048 AATTTTCTTTAGGGTGGGAAAGG + Intronic
995397204 5:111699547-111699569 ATTTTTCTTGAGAGGGTGAAGGG - Intronic
995606625 5:113863525-113863547 TATTTTCTTTTGAGGATGAAAGG + Intergenic
995661757 5:114491846-114491868 TGTTCTTTTTAGGGGGTGTAGGG + Intronic
996214519 5:120850501-120850523 TCTTTTATTTGGGAGGAGAAAGG - Intergenic
997083777 5:130772093-130772115 TCTTGTTTTTAGGGGGAGAAGGG + Intergenic
997793316 5:136782645-136782667 TCTTTCCTCTAGGTGGTGAATGG + Intergenic
997810161 5:136959368-136959390 TCTTTTCTTTATGGGGGGTGGGG + Intergenic
998377945 5:141703382-141703404 GCTTTTATTAAGGGTGTGAAGGG + Intergenic
998542647 5:142997406-142997428 TCTTTTCTTGAGGGGTTGGTGGG + Intronic
998892072 5:146757028-146757050 TCTTGTTTTTAGGATGTGAAAGG + Intronic
999360289 5:150979602-150979624 TATTTTCTTTAGGGGAAAAATGG - Intergenic
999370904 5:151054678-151054700 TCTTTTTTTTAAGGGGTGTTGGG - Intronic
999785230 5:154884428-154884450 GCTTTTATTTAGGGTGTGAATGG - Intergenic
1000150935 5:158500275-158500297 TCTTTTCTTTACCAGCTGAACGG + Intergenic
1001466282 5:171969267-171969289 TCTTTTTTTTGGGGGGTGATGGG - Intronic
1001872986 5:175173254-175173276 TGTTTCCTTTTAGGGGTGAATGG + Intergenic
1002807196 6:588650-588672 TCTTTTCATTAGAAAGTGAAGGG - Intronic
1003032103 6:2610600-2610622 GATGTTCTTTAGTGGGTGAATGG - Intergenic
1003742036 6:8951773-8951795 TCTTTTCTAAAGGGGGTGGCGGG - Intergenic
1003838038 6:10092539-10092561 TCTTTTTTTTGGGGGGGGTAGGG + Intronic
1004343805 6:14830199-14830221 TCTTTTCTTTAGAGAGGAAAAGG - Intergenic
1004343821 6:14830355-14830377 TATGTTCTTTAGGGGAAGAAAGG - Intergenic
1004660979 6:17708913-17708935 TAGTTTCTTTAGGCGCTGAAAGG - Intergenic
1005101105 6:22173352-22173374 TCTTTGCTTCAGAGGGTGCAAGG + Intergenic
1006117872 6:31784855-31784877 TCTTTCCTTGAGGGGGAGAGAGG + Intronic
1007059492 6:38924498-38924520 TCTTTTTTTTGGGGGGGGGATGG - Intronic
1007187112 6:39981329-39981351 TTTTTTTTTTAAGGGCTGAATGG + Intergenic
1009805488 6:68596846-68596868 TATTTGCTTTATGGGGTCAATGG + Intergenic
1011568498 6:88707385-88707407 TTTATTCTTTTGGGGGTGGAGGG + Intronic
1011706815 6:90008846-90008868 TCTTTCTTTCAGGGTGTGAACGG - Exonic
1012095157 6:94948349-94948371 TCTTTTATTTATATGGTGAAAGG + Intergenic
1013619536 6:111873878-111873900 TCTTTTCATTTGAGGGTGAGAGG + Intergenic
1013906011 6:115220870-115220892 TCCTTTTTTTAGGGGGTGGGGGG - Intergenic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1014920057 6:127203306-127203328 TGGTTTCTTTTGGGGGTGAAAGG - Intergenic
1015060376 6:128957592-128957614 TGCTTTTTTTAGGGGGGGAAGGG + Intronic
1015827545 6:137330538-137330560 GCGTTTCTCTTGGGGGTGAAAGG + Intergenic
1016246347 6:141985954-141985976 TCTTTTTTTTGGGGGGTGGGGGG + Intergenic
1016505365 6:144772981-144773003 TTTTTTTTTTGGTGGGTGAAGGG + Intronic
1017114565 6:150964957-150964979 TCTCTCCTGTAGGGGGTGACAGG + Exonic
1017424033 6:154302477-154302499 TCTTCTCTTTAGTGGGGGAAGGG + Intronic
1020360515 7:7322420-7322442 TCTTATCATTAGGGGAGGAATGG + Intergenic
1020661458 7:10988642-10988664 ACTTTTCTTTTGGGGGTACAAGG + Intronic
1020744397 7:12064033-12064055 ACTTTTCTTGAGGGGAGGAAGGG - Intergenic
1020888464 7:13849370-13849392 TCTTATCTCTGGGGGGTGATGGG + Intergenic
1020982156 7:15084467-15084489 TATTTCATTTAGGGGGAGAAAGG - Intergenic
1021452536 7:20796241-20796263 TCTTTTCTTTTTGGGGGGGAGGG + Intergenic
1021616002 7:22503965-22503987 TCACTTCTTTAGGGGTTGATGGG - Intronic
1021676218 7:23083123-23083145 TCTCTTCCTTAGTGGGGGAAGGG + Intergenic
1022633594 7:32109786-32109808 TCTTTTCTTTAGAGGGAAGAGGG + Intronic
1022925794 7:35055168-35055190 TCACTTCTTTAGGGGTTGATGGG - Intergenic
1024712214 7:52028879-52028901 TCTCTTCTTTAGGCAGTGAATGG - Intergenic
1025277451 7:57596015-57596037 TATTTTTTTTTGGGGGGGAACGG + Intergenic
1026122145 7:67547443-67547465 TCTTTTCCTAAGGGAGAGAATGG - Intergenic
1027265082 7:76490322-76490344 TCTTTTTTTGGGGGGGTGAGGGG - Intronic
1027316455 7:76988425-76988447 TCTTTTTTTGCGGGGGTGAGGGG - Intergenic
1028376472 7:90150377-90150399 TCACTTCTTTAGGGGTTGATGGG + Intergenic
1028503033 7:91540020-91540042 TCTTTGGTTTTGGTGGTGAAAGG - Intergenic
1029433568 7:100548296-100548318 TCTTTTTTTTGGGGGTTGGAGGG + Intronic
1029790300 7:102836430-102836452 TCTTATCTGTAGGGGGGAAATGG - Intronic
1029823799 7:103169861-103169883 TCACTTCTTTAGGGGTTGATGGG - Intergenic
1030660589 7:112214677-112214699 CCTTTGCTTCATGGGGTGAAGGG + Intronic
1030932806 7:115546025-115546047 TATTTTCTTTTGTGGGTGACTGG + Intergenic
1031227580 7:119060255-119060277 CCTTTTATTTTGGGGGTGGAGGG + Intergenic
1031701207 7:124929415-124929437 TCATTTATTTAGCGGGTGAAGGG - Intronic
1032317035 7:130847771-130847793 TCTTATTTTTCGGGGGTGAGGGG + Intergenic
1036064771 8:5367599-5367621 ACATGTCTTCAGGGGGTGAATGG + Intergenic
1039418048 8:37412543-37412565 TCCCTCCTCTAGGGGGTGAAAGG + Intergenic
1039954925 8:42199899-42199921 TGTTTGCTTTAGGGAGTGGAAGG - Intronic
1041650706 8:60299403-60299425 TCTCTTTTTTAGGGGAAGAAAGG - Intergenic
1041875323 8:62681330-62681352 TTTTTTCTTTAGGAAGGGAAAGG - Intronic
1043910393 8:85857400-85857422 TTTTATTTTTAGGGGGTGGAAGG - Intergenic
1044105531 8:88201132-88201154 TTTTTTTTTTGGGGGGGGAAAGG - Intronic
1044658815 8:94575456-94575478 GATTTTCTTTAGTAGGTGAATGG + Intergenic
1044659063 8:94578015-94578037 TCTTTTCTTTTGGAGGGAAAGGG + Intergenic
1044854648 8:96462763-96462785 TCTTTCATTCAGGGAGTGAATGG - Intergenic
1045382883 8:101644389-101644411 TGTTTTCTTAAGGTGTTGAAAGG - Intronic
1045708699 8:104958184-104958206 TATTTTCTTGAGGGGGGAAATGG - Intronic
1049736184 8:144207167-144207189 TCTTTTTTTTGGGGGGTGGGGGG + Intronic
1051724261 9:20072338-20072360 TCTTGCCTTGAGTGGGTGAAAGG + Intergenic
1051882450 9:21853283-21853305 TCTTAACTTTAGGGGGGAAAAGG + Intronic
1052482015 9:29042442-29042464 TCTGTCCTTCAGTGGGTGAATGG + Intergenic
1053504631 9:38631161-38631183 TCTTTTTTTTGGGGGGGGATGGG + Intergenic
1054705398 9:68456297-68456319 TCTTTTTTTTTGGGGGTGGGGGG + Intronic
1055274980 9:74605031-74605053 TCTTTTCTTTCTAGGATGAAGGG - Intronic
1057041460 9:91850910-91850932 TATTTTTTTCAGGGGGTGACTGG + Intronic
1057398719 9:94703477-94703499 TCTGTTCTCTAGGGGGAAAATGG + Intergenic
1057481345 9:95447575-95447597 GCTTTTCTTTTGTGGGTGGAAGG - Intronic
1057619783 9:96624663-96624685 TCTTTTTTTGAGGGGGGGACAGG + Intergenic
1057783438 9:98069189-98069211 AATGTTCTTTAGTGGGTGAATGG + Intronic
1058005677 9:99911336-99911358 TCTTTTTTTTAATGGCTGAACGG + Intronic
1058883266 9:109303673-109303695 TCTTTTCTTTTTGTGGAGAAGGG + Intronic
1058938510 9:109791568-109791590 GCTTTTCTTAAGGGGTTGGAGGG + Intronic
1059221107 9:112619544-112619566 TCTTTTCTTTTTGGGGGGAAAGG + Intronic
1059645292 9:116260212-116260234 TCTTTTGTTTTTGGTGTGAAAGG - Intronic
1059896421 9:118871138-118871160 TCATTTTTTTGGAGGGTGAAGGG - Intergenic
1061160582 9:128891739-128891761 TCTTTTCCTTAGGGGGTACATGG - Intronic
1062654925 9:137598893-137598915 TCTTTTTTTTCTGGGGTGAAAGG + Intergenic
1188143059 X:26576069-26576091 TCCTTTCTTTAGGGGGTTAGTGG + Intergenic
1188415720 X:29931483-29931505 TTGTTTCTTTAGGGGTTTAATGG - Intronic
1188489606 X:30723465-30723487 TCTCTTCTTTTTGGGGGGAAAGG - Intronic
1190689200 X:52899453-52899475 TATTTTCTTTTGTAGGTGAAAGG + Exonic
1190696783 X:52956339-52956361 TATTTTCTTTTGTAGGTGAAAGG - Exonic
1191830827 X:65414263-65414285 TTTTTTTTTGAGGGGGGGAAGGG + Intronic
1193120667 X:77819776-77819798 TCTCTTCCTTAGTGGGGGAAGGG + Intergenic
1194525088 X:94968258-94968280 GCTTTTCTTTAGGGTGAGATTGG - Intergenic
1196172199 X:112601875-112601897 TCTTTTGTGTAGTGGGAGAAGGG + Intergenic
1197496857 X:127195098-127195120 TGTTTTCCTTAGAGTGTGAATGG + Intergenic
1198011252 X:132557161-132557183 TAGTTTCTTTAGGTGGAGAATGG - Intergenic
1198844109 X:140891100-140891122 TCTTTTCTGTAGGAGATGAAAGG - Intergenic
1198852774 X:140983228-140983250 TCTTTTTTTTGGGGGGGGGACGG - Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199854398 X:151748449-151748471 TCTTTTTTTTGGGGGGTGGGGGG - Intergenic
1200910493 Y:8527431-8527453 TCTTTTCTTTGTGGGATGCATGG + Intergenic
1201968533 Y:19766110-19766132 TCATTTCATTATAGGGTGAAAGG + Intergenic
1202037899 Y:20654069-20654091 TTTTTTCTTTCAAGGGTGAAAGG - Intergenic