ID: 970438354

View in Genome Browser
Species Human (GRCh38)
Location 4:16057375-16057397
Sequence ATGCTGTCACTGATGAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970438354_970438355 7 Left 970438354 4:16057375-16057397 CCTAATTTCATCAGTGACAGCAT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 970438355 4:16057405-16057427 AAACATTTCAAATCATAATTCGG 0: 1
1: 0
2: 6
3: 52
4: 618
970438354_970438356 8 Left 970438354 4:16057375-16057397 CCTAATTTCATCAGTGACAGCAT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 970438356 4:16057406-16057428 AACATTTCAAATCATAATTCGGG 0: 1
1: 0
2: 3
3: 44
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970438354 Original CRISPR ATGCTGTCACTGATGAAATT AGG (reversed) Intronic
900755494 1:4431668-4431690 ATCCTGTCACTGGTTGAATTTGG + Intergenic
903864507 1:26388514-26388536 ATGAGGTCACTGATGAGATGGGG - Intergenic
905188374 1:36213464-36213486 ATGTTGTGACTGATGTAATATGG + Intergenic
906159007 1:43633809-43633831 ATGCTGACACTGATGGTCTTTGG - Intergenic
907896924 1:58700628-58700650 CTGCTCTCACTGATAAAATGGGG + Intergenic
910096847 1:83532729-83532751 ATGTTGTCTCTGTTGCAATTTGG - Intergenic
910255204 1:85241153-85241175 ATTCTGTCACTGATATAGTTTGG + Intergenic
910445275 1:87293777-87293799 TTGCTTTGACTGATGAATTTCGG + Intergenic
912126477 1:106545167-106545189 ATGCTATTACTGATGAATTCTGG - Intergenic
912259701 1:108098201-108098223 ATGCTGTCACCGATGATGCTTGG + Intergenic
912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG + Intergenic
913162608 1:116158220-116158242 ATGGTCTCACTGATGAATTCTGG - Intergenic
916899004 1:169200619-169200641 ACCCTGTCCCTGAGGAAATTAGG - Intronic
917197739 1:172484283-172484305 ATGCTGTCAATGATGTCCTTAGG + Intergenic
917669861 1:177263271-177263293 ATGCAGTTACTAATAAAATTAGG - Intronic
920781700 1:208997973-208997995 ATGCTCTCAGTGTTAAAATTAGG + Intergenic
921117546 1:212108073-212108095 ATGCTGCCACTGATGCTATTAGG + Intergenic
921933644 1:220776528-220776550 ATGCTGACAATGATCAGATTAGG + Intronic
1064465185 10:15572332-15572354 ATGGTGTCACTGATGGTACTTGG + Exonic
1066448499 10:35506579-35506601 ATGCTGTCACTCTTGTAATGAGG + Intronic
1068821933 10:61387541-61387563 GAGCTGTCATTGATGAGATTGGG - Intergenic
1069656856 10:70096320-70096342 ATTCTACCACTGATGACATTTGG + Intronic
1071766653 10:88673883-88673905 ATGCTGGAAGTGATTAAATTGGG - Intronic
1071928817 10:90441611-90441633 ATGCTGGCACTGATGTTAGTTGG - Intergenic
1074610698 10:115018312-115018334 ATGTTTTCACTCATTAAATTTGG - Intergenic
1074768506 10:116718146-116718168 AGGCTGTTCATGATGAAATTGGG - Intronic
1074814295 10:117133244-117133266 ATACTTCCAATGATGAAATTTGG - Intronic
1074822042 10:117186970-117186992 TTGCAGTCACTGATTTAATTTGG - Intergenic
1078516264 11:12025234-12025256 TTTCTGTACCTGATGAAATTTGG + Intergenic
1078754196 11:14193377-14193399 AAGCTGTCAGTGATGAGGTTCGG - Intronic
1080370179 11:31629585-31629607 ATGCTGTTAGGTATGAAATTAGG - Intronic
1081396356 11:42590789-42590811 TTTCTGTCAATGATTAAATTTGG - Intergenic
1084353314 11:68619310-68619332 ATCCTGCCAATGATGAAAGTTGG + Intergenic
1088000780 11:104877626-104877648 ATGCTCACACTGATGAAACCTGG + Intergenic
1089421726 11:118337048-118337070 GTTCTGTCTCTCATGAAATTAGG + Intergenic
1089657327 11:119959634-119959656 ATACAGTCACTGATGAAGCTAGG + Intergenic
1090415817 11:126539735-126539757 ATGCTGTCCCAGATGTAGTTGGG + Intronic
1090943397 11:131408718-131408740 ACAATGTCACTGATGAACTTGGG - Intronic
1091579133 12:1770882-1770904 ATGCAGTCTCTAATGAAAATTGG + Intronic
1092822921 12:12370710-12370732 ATGCTGTCACTGGCCAATTTTGG - Intronic
1096298598 12:50405697-50405719 ATGCAGTGACTACTGAAATTGGG + Intronic
1096850872 12:54435562-54435584 ATGCTGTGACTAGTGAAATCAGG - Intergenic
1098784651 12:74736578-74736600 ATTCTGTAACTCATGAAATTAGG - Intergenic
1098872382 12:75831564-75831586 ATGCTGTCTATGATGGATTTTGG + Intergenic
1100144651 12:91662937-91662959 ATGCTTTCACTGGTAAAATGAGG + Intergenic
1100869838 12:98898264-98898286 ATCATGGCACTAATGAAATTTGG + Intronic
1101937916 12:109073673-109073695 ATGCTGACACTGACCAAAGTGGG - Intronic
1104397639 12:128448123-128448145 TTGTTGTCACTGGTGAAAATTGG + Intronic
1107350080 13:39504751-39504773 GTGCTGTCACACATGAAACTGGG + Intronic
1109617120 13:64849915-64849937 ATGATGTTGCTGATGAGATTTGG - Intergenic
1109751925 13:66705344-66705366 ATGCTGGCATTAATCAAATTTGG + Intronic
1111204131 13:84981927-84981949 ATGCTATCACACATTAAATTAGG + Intergenic
1112085486 13:96027271-96027293 ATGGTGACCTTGATGAAATTTGG - Intronic
1112694225 13:101929447-101929469 AGCCTGTCAGTGACGAAATTAGG + Intronic
1113173417 13:107533319-107533341 ATGCTGTCACTGTGGTGATTTGG - Intronic
1115159904 14:30382051-30382073 ATGCATTCACTGATGTTATTTGG + Intergenic
1115951942 14:38731214-38731236 AAGCTGTCACTGGTCAAATCTGG + Intergenic
1117093991 14:52278684-52278706 CTGCTATCAGTGATGAACTTGGG - Intergenic
1117140607 14:52787235-52787257 ATACTGTGACTTATGAAATAAGG - Intronic
1118851785 14:69589393-69589415 AGGCAATCACTGATGACATTTGG + Intergenic
1119102501 14:71893253-71893275 ATTTTGTCACTGATGAAATGAGG + Intergenic
1120758666 14:88267047-88267069 ATGCTGTCACTGATGGATTTGGG - Intronic
1123703289 15:22931794-22931816 ATGCTGTCATTGACCAAATGTGG - Intronic
1124398936 15:29331635-29331657 ATGCTGTCATTGCTGAATATCGG - Intronic
1125410650 15:39402543-39402565 ATTCTGTCACTGAAGATTTTGGG - Intergenic
1128331116 15:66756308-66756330 ATGCTGTCACAGTTAAAATAAGG + Intronic
1129154917 15:73711759-73711781 ATAATGTCAGTGATGACATTTGG + Intronic
1133709067 16:8383631-8383653 ATTCACACACTGATGAAATTTGG - Intergenic
1134632345 16:15765951-15765973 ATCTTGTCACTGCAGAAATTGGG + Intronic
1138012147 16:53391811-53391833 TTGCCATTACTGATGAAATTAGG + Intergenic
1138740810 16:59307728-59307750 ATTTTGTCAGTGATTAAATTTGG - Intergenic
1141871159 16:86787209-86787231 ATGTTGTCAATCATGAAAGTCGG + Intergenic
1142913395 17:3113870-3113892 ATGCTGCCACTGAGGAGATGAGG - Intergenic
1144050334 17:11492515-11492537 ATGTTGTCAATCATAAAATTAGG + Intronic
1146115074 17:30128731-30128753 ATGCTTTCACTGTTGAAAGCTGG - Intronic
1148009874 17:44469597-44469619 ATTTTGTCACTGTTGAAAATGGG - Intronic
1149164425 17:53734009-53734031 ATGCTCTCAGTTCTGAAATTAGG + Intergenic
1151229586 17:72674269-72674291 ATACTGTCACTGATGTAAAAAGG - Intronic
1156373743 18:36494055-36494077 ATTCTTTCACTGATGTAAATTGG + Intronic
1157929333 18:51803758-51803780 ATGCTGTCAATGATTAGTTTAGG - Intergenic
1159134171 18:64317438-64317460 AGTCTGTCACTGATGGCATTTGG + Intergenic
1160618183 18:80149837-80149859 TTGCTGTCATTGTTGAAATTAGG + Intronic
1162671451 19:12260976-12260998 ATGATGACACTGATGACAGTGGG + Intronic
1164412355 19:28016528-28016550 ATGCTTGCACAGATGAGATTTGG - Intergenic
1164807197 19:31126210-31126232 ATGCTTTCACTTCTGGAATTTGG - Intergenic
1164915299 19:32047138-32047160 ATGCTGTCACCTCTGAAATTGGG - Intergenic
926789560 2:16556564-16556586 ATGCTGTCAAGGATGCAGTTGGG + Intronic
927802320 2:26112451-26112473 ACCCTGTCACTCAGGAAATTGGG + Intronic
928249706 2:29664716-29664738 ATGCTGTCACTCCTGATAGTAGG - Intronic
928458759 2:31450131-31450153 ATGCTGTCACTGCTGGATATGGG - Intergenic
931265086 2:60653436-60653458 TGGCTGGCACAGATGAAATTAGG + Intergenic
934207136 2:89940484-89940506 CTGCTGCCTCTGATGAACTTCGG + Intergenic
937049199 2:118874656-118874678 ATTCTCACACTGAGGAAATTGGG + Intergenic
937944321 2:127318561-127318583 ATGCTGTCACATGTGTAATTAGG - Intronic
938699449 2:133863176-133863198 AAGCTGCCCCTGATGAAAATAGG + Intergenic
938916971 2:135951615-135951637 GTGTTCTCACTGATGAAATCTGG - Intronic
939890794 2:147733503-147733525 ATCCTTTCTCTGATGAAATAGGG - Intergenic
941356608 2:164500875-164500897 ATGCTGACAGTGATGAGAATAGG + Intronic
941502592 2:166298372-166298394 ATGCTGCTACAGATGAAAGTGGG - Intronic
941931943 2:170950598-170950620 ATGCTGTCACTGAACAAAAAGGG - Intronic
943940287 2:193985486-193985508 ATGTTGTCAATGATGAAATGTGG - Intergenic
945316142 2:208372734-208372756 ATTCTATTAATGATGAAATTAGG + Intronic
945629036 2:212248451-212248473 ATACTGTCAATGATAAAACTTGG + Intronic
947643453 2:231720818-231720840 AGGCTGTCACTGGTGAGATCTGG + Intergenic
1169012106 20:2259425-2259447 ATGCTGGAACTGGTGGAATTAGG - Intergenic
1169668048 20:8061290-8061312 CTGCTGTCACTGCTAAAATTTGG + Intergenic
1173038465 20:39435692-39435714 ATGCTATCATTGAGGAAACTGGG - Intergenic
1174170359 20:48614003-48614025 ATGCTGTCACTGATTATAGAGGG - Intergenic
1175322308 20:58097677-58097699 ATGCTGTGCCTGCTGAACTTAGG + Intergenic
1176964475 21:15196031-15196053 GTGCTGTCACAGATGTAAATTGG + Intergenic
1176989120 21:15473060-15473082 ATGCTGTGACTGAAAAACTTTGG - Intergenic
1177299033 21:19216577-19216599 ATGCTTTCTTTGAGGAAATTGGG - Intergenic
1177386457 21:20415372-20415394 ATGATATCACTGATGAATTTTGG + Intergenic
1177830839 21:26137113-26137135 ATGCTGTCTCTACTGAAAATAGG - Intronic
1182486169 22:30640470-30640492 ATGCTGGCTCTGATGAAAGAGGG + Intronic
950230711 3:11273307-11273329 TTTCTGTCACTGAAGAAATCTGG - Intronic
952465916 3:33585764-33585786 ATGTGGTCACTGATTAAATGTGG + Intronic
953003790 3:38958784-38958806 ATGCTGTTCCAGGTGAAATTTGG + Intergenic
953510059 3:43526826-43526848 CTGCTGTTACTGATTAAAGTAGG - Intronic
956447939 3:69344138-69344160 ATGCTGTCCATGAAGAAATCAGG - Intronic
957380364 3:79420197-79420219 TTCCTGTCAATGATAAAATTAGG - Intronic
957566367 3:81889296-81889318 ATGTTCTCATTTATGAAATTAGG - Intergenic
959138951 3:102461289-102461311 ATGATGTGACTGCTTAAATTTGG + Intronic
959168497 3:102812988-102813010 ATGCTGTCACCTATAGAATTTGG - Intergenic
959953685 3:112211464-112211486 AAGCTGTGACAGATGAAATCTGG + Intronic
960633419 3:119756894-119756916 ATGTAGTCAGTGATAAAATTTGG - Intronic
962844069 3:139260202-139260224 ATGCAAGCACTGCTGAAATTGGG + Intronic
964813671 3:160693703-160693725 ATGATTTCACTGATGAATCTGGG + Intergenic
965017459 3:163175625-163175647 ATGCAGTCACTGTTTAACTTAGG + Intergenic
968275717 3:197438700-197438722 CTGCTGTCAATGATGAAGCTGGG + Intergenic
970438354 4:16057375-16057397 ATGCTGTCACTGATGAAATTAGG - Intronic
971063328 4:22997898-22997920 ATTCTGTCATTGATGGGATTTGG + Intergenic
971714681 4:30160236-30160258 TTGCTTTGACTGATGTAATTTGG + Intergenic
973655334 4:53041911-53041933 ATGCTGTCACTACTGAAAAGAGG - Intronic
974878579 4:67726428-67726450 ATACCCTCACTGATGTAATTAGG + Intergenic
975182876 4:71367257-71367279 ATGGTATCAGTGATAAAATTTGG + Intronic
977431657 4:96938087-96938109 ATGCTGTGACTGATGCTCTTAGG + Intergenic
978630762 4:110741349-110741371 ATGCTGTTAGACATGAAATTGGG - Intergenic
980752202 4:137105865-137105887 AAAATGTCACTGATGAATTTGGG + Intergenic
982477023 4:155866263-155866285 ATACTGTTATTGATGAAAATTGG - Exonic
983095537 4:163557192-163557214 ATGCTGTAAATGAGGAAATTTGG - Intronic
983654928 4:170073295-170073317 ATGTTGCCAGTGATGAAAGTGGG - Exonic
985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG + Intergenic
985815403 5:2124653-2124675 TTCCTGTAACTGATGACATTTGG - Intergenic
986037382 5:3953045-3953067 ATGTTGTCACTAATGGAAATGGG + Intergenic
990642848 5:57807081-57807103 ATGGTGTCTCTGTAGAAATTAGG - Intergenic
991032856 5:62100769-62100791 ATGCTGTAACTAATGGGATTAGG - Intergenic
992352728 5:75947617-75947639 TGGCTGCCACTGGTGAAATTAGG - Intergenic
992825438 5:80545514-80545536 ATTCTCTTACTGATGAAAATTGG - Intergenic
993187604 5:84639767-84639789 ATGTTGTCAATGATAAAATGAGG + Intergenic
993356486 5:86915366-86915388 ATACAGTCACAGATGAATTTAGG + Intergenic
994132829 5:96250149-96250171 ATGTTGTGATTGATGAACTTTGG + Intergenic
994610567 5:102032769-102032791 ATCCTGTGACTGGTGAAATTTGG + Intergenic
995838091 5:116418033-116418055 CTGCTGGCACTGAGAAAATTGGG + Intergenic
996573114 5:124953974-124953996 ATGCTGTCCCTGTCCAAATTAGG + Intergenic
997674851 5:135705294-135705316 ATGCTGTCACTGTTGATAAATGG + Intergenic
997866387 5:137467201-137467223 AGGATGTCACTTCTGAAATTAGG - Intronic
999096439 5:148982051-148982073 ATGATGTCAATAATGAATTTGGG + Intronic
1003307523 6:4943134-4943156 AAGCTGTCACAGAGGAAATCTGG - Intronic
1003666163 6:8113670-8113692 ATGTTCTCATTGCTGAAATTGGG - Intergenic
1004068294 6:12272969-12272991 CTGCTGTCACTGATCTAATGGGG + Intergenic
1004206722 6:13598363-13598385 AGGAGGTCATTGATGAAATTAGG + Intronic
1005808367 6:29496238-29496260 GAGCTGACACTGATAAAATTAGG - Intergenic
1006798996 6:36747740-36747762 AGGCTGACACTGGAGAAATTGGG + Intronic
1007222510 6:40290313-40290335 ATGTCCTCATTGATGAAATTAGG - Intergenic
1007518048 6:42429145-42429167 ATACTGTCACTAGAGAAATTAGG - Intronic
1010541194 6:77094230-77094252 ATCCTGTCTCTGAGGAAAATTGG + Intergenic
1012417144 6:99023525-99023547 AGGCTGTCATTGATAAGATTCGG - Intergenic
1013942050 6:115676353-115676375 TTGCTGTCATTGATGACAGTAGG - Intergenic
1013984989 6:116180762-116180784 ATTTATTCACTGATGAAATTGGG - Intronic
1014603202 6:123442148-123442170 GTGCTGGCACTGATGACCTTGGG + Intronic
1015721332 6:136245749-136245771 ATGCTGGCACTCAAGACATTTGG + Intronic
1018130074 6:160721560-160721582 ATGCAGTGACTGCTGAAATCTGG - Intronic
1018948992 6:168366061-168366083 ATGGAGTCACTGCTGGAATTAGG + Intergenic
1020501914 7:8933888-8933910 ATGCTGAGTCTGATGAAGTTTGG + Intergenic
1022269937 7:28796744-28796766 ATCCTTTCTCTGATGAAATAGGG + Intronic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1028216002 7:88134040-88134062 AGAATGTCACTGGTGAAATTTGG + Intronic
1030633820 7:111925719-111925741 ATGTTGCCACTGCTTAAATTTGG + Intronic
1030683553 7:112458769-112458791 ATTTTGTCATTGATCAAATTTGG + Intronic
1031100376 7:117472517-117472539 ATTGTGTCACTGATGAAAATAGG + Intronic
1031324461 7:120375567-120375589 ATGCCCTCTCTGATGAATTTAGG - Intronic
1031642668 7:124184412-124184434 ACGCTGTGACTGATTAATTTTGG - Intergenic
1031860500 7:126974552-126974574 ATACTGGAACTGATGAAATAAGG + Intronic
1031861789 7:126988416-126988438 ATTCTATCACTTATGAAAATAGG - Intronic
1034524852 7:151651762-151651784 ATGTTGTCACAGATGACATCAGG + Intronic
1035789919 8:2295587-2295609 ATGCTGTTACTTAAGATATTTGG + Intergenic
1035802886 8:2426118-2426140 ATGCTGTTACTTAAGATATTTGG - Intergenic
1038686806 8:29726395-29726417 ATTCTGTGACAGCTGAAATTTGG + Intergenic
1040049401 8:42997393-42997415 AAGCTGCCACTCATGACATTAGG + Intronic
1040098085 8:43467810-43467832 GTGATATCACTGATGATATTTGG + Intergenic
1040374769 8:46814437-46814459 AAGCTGTCACTCATGAAATCAGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040936375 8:52786141-52786163 ATGATGACTCTGTTGAAATTAGG + Intergenic
1042187346 8:66150296-66150318 TTTCTGTCACTGTTGAAAATTGG - Intronic
1042441587 8:68833241-68833263 ATGCAGTGAATTATGAAATTTGG - Intergenic
1043471311 8:80565997-80566019 AGGCTGTCACTGTTTAACTTGGG - Intergenic
1043605447 8:81993084-81993106 ATGGTGTCACTTCTGAGATTAGG - Intergenic
1043728214 8:83639817-83639839 TGGCTCTCACTGATGCAATTAGG - Intergenic
1044347944 8:91128402-91128424 ATGCTTTCACTGAAGAAAGTAGG + Intronic
1044502982 8:92982982-92983004 ATGTTCTCATTTATGAAATTAGG + Intronic
1044893587 8:96863769-96863791 ATGCTGTCACTGAGACACTTTGG - Intronic
1048528185 8:135223960-135223982 ATGCTATGACCTATGAAATTTGG - Intergenic
1048683795 8:136878503-136878525 AGGCTATCACTGATAAAAATAGG - Intergenic
1052032068 9:23640052-23640074 CTGCTGGCCGTGATGAAATTTGG + Intergenic
1052283399 9:26757609-26757631 ATCCTATCACTGATGAATCTGGG - Intergenic
1052732442 9:32305349-32305371 ATGCCTTCATTTATGAAATTGGG - Intergenic
1055440552 9:76332169-76332191 ATGGGATCACTGATGAGATTTGG + Intronic
1057994191 9:99805252-99805274 ATGTTGGCACTGCTGAAATTAGG - Intergenic
1058832959 9:108835801-108835823 ATGCAGTCACTGATGAACCCAGG + Intergenic
1061665327 9:132157455-132157477 ATACAGTCACAGTTGAAATTTGG - Intergenic
1185660571 X:1725613-1725635 ATGATGTCTGTGATGACATTAGG - Intergenic
1187023987 X:15413693-15413715 TTGGTGTCACTCATCAAATTTGG - Intronic
1188002082 X:24992385-24992407 ATTCTGTCAATTATGAAATCAGG - Intronic
1188814094 X:34689652-34689674 ATAATGTCAATGATGACATTGGG + Intergenic
1190970040 X:55339855-55339877 ATGCTGTCAAATATGGAATTTGG - Intergenic
1191884852 X:65877874-65877896 ATGCAGTCACTGGTAAAATGGGG + Intergenic
1192300958 X:69902209-69902231 ATGATGTCACTCATGAAATGGGG - Intronic
1195405424 X:104507900-104507922 ATGCTGTTACTGATGACACTAGG - Intergenic
1195436758 X:104853289-104853311 ATGCTGCCACTGATTCCATTGGG - Intronic
1201265707 Y:12204558-12204580 ATGGAACCACTGATGAAATTTGG + Intergenic
1201850385 Y:18473433-18473455 AAGCTGAAACTGATCAAATTTGG - Intergenic
1201882933 Y:18846944-18846966 AAGCTGAAACTGATCAAATTTGG + Intergenic