ID: 970438631

View in Genome Browser
Species Human (GRCh38)
Location 4:16060166-16060188
Sequence CTGAAAATTCAGAAGTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 453}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970438631_970438632 -10 Left 970438631 4:16060166-16060188 CCTTTGTACTTCTGAATTTTCAG 0: 1
1: 0
2: 6
3: 34
4: 453
Right 970438632 4:16060179-16060201 GAATTTTCAGTCATATAAATAGG 0: 1
1: 0
2: 2
3: 32
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970438631 Original CRISPR CTGAAAATTCAGAAGTACAA AGG (reversed) Intronic
901542604 1:9929653-9929675 CTCAAAATTCCGAGATACAACGG + Exonic
902791881 1:18774782-18774804 TTCAAAATTCAAAAGGACAAAGG - Intergenic
904570081 1:31457075-31457097 AAGAAAATTCAGAAGGAAAATGG - Intergenic
906813259 1:48850847-48850869 CTGAGAAATCAGAAGTTCATTGG + Intronic
907846759 1:58215525-58215547 CTGAAAATATATCAGTACAAGGG - Intronic
908568679 1:65385931-65385953 ATGAGAATTGAGAAGTACATAGG - Intronic
908578717 1:65490475-65490497 CAGAAATTTAAGAAGTCCAAGGG - Intronic
908658485 1:66413326-66413348 CTGAAACACCAGAAGTACTAGGG - Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909289659 1:73866402-73866424 CTGAAAATACAAAAATTCAATGG + Intergenic
910089587 1:83446360-83446382 TTTATAATTCAGAAGAACAATGG - Intergenic
910760766 1:90729256-90729278 CTGAACATTCAGAACTGGAACGG + Intergenic
910981910 1:92966329-92966351 CTGCAAGTTCAGTGGTACAAGGG - Intergenic
911210317 1:95132101-95132123 CTGCAAGTTGAGAAGTTCAAGGG - Intronic
911869875 1:103083481-103083503 TTGAAGATTCAAATGTACAATGG + Intronic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG + Intergenic
915748711 1:158184388-158184410 CTGTGAAATCAGAAGTGCAAAGG + Exonic
915750580 1:158206243-158206265 CTGATAAGACAGAAATACAAAGG - Intergenic
916768983 1:167889850-167889872 CTGATAATACAGAAATTCAAAGG - Intronic
917003049 1:170381922-170381944 CTGATAGTTCAGAAGTTCAGAGG - Intergenic
917186997 1:172368808-172368830 CTGATACTTCAGAAATACAAAGG + Intronic
918225231 1:182475057-182475079 CCAAAAATTCTAAAGTACAATGG + Intronic
919203108 1:194384720-194384742 CTTAAAATTTAAAAGGACAAAGG + Intergenic
919310089 1:195896023-195896045 CTGAGAATCCAGGAGTTCAAAGG + Intergenic
919336991 1:196248468-196248490 CTGATACTGCAGAAATACAAAGG + Intronic
919418599 1:197342250-197342272 CTAAAAATTCAATAGTAGAAAGG - Intronic
919489659 1:198190585-198190607 TTTAAAATTCAGAGTTACAAGGG - Intronic
919571238 1:199251147-199251169 CAGAAAGTTGGGAAGTACAAGGG + Intergenic
919688154 1:200503755-200503777 GTGAAAGTTCAGCTGTACAAAGG - Intergenic
920272151 1:204773760-204773782 CCGAACATTCAGAACAACAAAGG - Intergenic
920459642 1:206129362-206129384 CTGAAAATTCAGAGCTAAAGGGG + Intergenic
921461948 1:215438238-215438260 CTGATAACACAGAACTACAAAGG - Intergenic
923471228 1:234292718-234292740 CTGACAGTTCATAAGAACAAGGG - Intronic
924437997 1:244062173-244062195 TTGAAAATTCAGTTGTGCAATGG - Intergenic
924526567 1:244856880-244856902 ATTAAAATTCACAAGTTCAAGGG - Intronic
1062987187 10:1779911-1779933 CTGAACATTGAGAAGAACAGAGG + Intergenic
1063275968 10:4568337-4568359 CTGAAAATAAATAATTACAAAGG + Intergenic
1063538132 10:6905406-6905428 ATGAAAATTAAAAAGAACAATGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1064377482 10:14810073-14810095 CTGAAAATACAAAAGTTCACCGG + Intergenic
1064872699 10:19956539-19956561 TTGTAAATTCACAAGTCCAAAGG - Intronic
1065611965 10:27480696-27480718 TTGAAAATTCATAACTTCAAAGG - Intergenic
1068457356 10:57273936-57273958 CTGAAACCACAGAAATACAAAGG + Intergenic
1069414110 10:68183114-68183136 CTTATACTTCAGAAATACAATGG - Intronic
1069519367 10:69106318-69106340 CTGTAGATTCAGAGGTTCAAAGG - Intergenic
1071347242 10:84704400-84704422 CTAAAATTTGAGAAGTACCAGGG + Intergenic
1071501774 10:86209352-86209374 CTGTGAATTCACATGTACAAAGG - Intronic
1072020850 10:91399249-91399271 CTGATAGTACAGAAATACAAAGG + Intergenic
1073051081 10:100667877-100667899 CAGAAAATTCAAAAGAATAAGGG - Intergenic
1073397877 10:103233044-103233066 CAGGAAATTCAGAATGACAACGG + Intergenic
1074341843 10:112639109-112639131 CAGAAAGTTCAGAAACACAAAGG + Intronic
1076078615 10:127557580-127557602 CTGAAAAGTCTGATGTTCAAGGG - Intergenic
1077380217 11:2231137-2231159 CTGATACTACAGAAATACAAAGG + Intergenic
1078038193 11:7830958-7830980 CTGAAAATTCATCAAGACAATGG + Intergenic
1078070247 11:8103857-8103879 TGGAAAAATCAGAAGCACAAAGG + Exonic
1079707563 11:23639325-23639347 CTGATAATGCAGAAATTCAAAGG + Intergenic
1080205121 11:29719717-29719739 CTGATACTACAGAAATACAAAGG - Intergenic
1080636499 11:34128634-34128656 CTGAAAATACTGAAATAAAATGG + Intronic
1080947285 11:36988073-36988095 CTGAAAATCAAGAAGAAAAATGG + Intergenic
1082620317 11:55412605-55412627 CTGAAAAGACAGAAGTAAATAGG - Intergenic
1083124362 11:60549324-60549346 CTGAAACCAAAGAAGTACAAAGG + Intergenic
1083888292 11:65583428-65583450 CAGAGATTTCAGGAGTACAAGGG + Exonic
1084283862 11:68119080-68119102 CTGAAAATTCTCAACTAGAAGGG - Intronic
1085240895 11:75054249-75054271 CTGAAAAGTCAGGAGTAGGATGG - Intergenic
1085558927 11:77452106-77452128 CTAAAAATTCATAAGTAAATTGG + Intronic
1085802918 11:79608105-79608127 ATGAAAAATAAGAAGTAAAATGG - Intergenic
1085964523 11:81504934-81504956 TTGAAAATACAGAAATATAATGG + Intergenic
1086303033 11:85450176-85450198 CTGAAAATTGATAACCACAAAGG - Intronic
1086325935 11:85699485-85699507 AGGAAAATCCAGAAGTTCAAAGG + Intronic
1086397190 11:86428524-86428546 TTGACAACACAGAAGTACAATGG - Intergenic
1086606392 11:88701301-88701323 CAGAAAATTGACAAGTACAGTGG + Intronic
1087882706 11:103437361-103437383 ATGAAAAGACAGAAGAACAAGGG - Intronic
1088765840 11:112976435-112976457 TTTAGAATTTAGAAGTACAAAGG + Intronic
1090115778 11:123971374-123971396 CTGATACTGGAGAAGTACAAAGG - Intergenic
1090501326 11:127264440-127264462 TAGAAAATGCAGAAGTGCAAGGG + Intergenic
1091476417 12:778189-778211 CTAAACATTCAGTAGTATAAGGG - Intronic
1094276840 12:28686547-28686569 AAGGAAGTTCAGAAGTACAAAGG - Intergenic
1094734169 12:33214934-33214956 CTGAAACCACAGAAGTAGAAAGG + Intergenic
1096162312 12:49389026-49389048 CTTAAAAATCAGAAGAAAAAAGG - Intronic
1096629184 12:52914711-52914733 CTTATAATTGAGAAGTTCAAGGG + Intronic
1096917266 12:55046802-55046824 CTTAAAAATCAGAATTAAAAGGG + Intergenic
1096944874 12:55392797-55392819 CTCAAAATTCAGAATAAAAAGGG + Intergenic
1098319526 12:69227830-69227852 CTGATACTGCAGAAGTTCAAAGG + Intergenic
1098856285 12:75656465-75656487 CTGGAAATTCAGAAGTGTATAGG - Intergenic
1099215913 12:79853281-79853303 CTGATAACCCAGAAGTGCAATGG - Intronic
1099289431 12:80757730-80757752 CTGATAACACAGAAATACAAAGG + Intergenic
1099311575 12:81032806-81032828 GTAATAATTCAGAAGTATAATGG + Intronic
1099475902 12:83107335-83107357 CTGGAAGTTGAGAAGTCCAAGGG + Intronic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1100657029 12:96658269-96658291 CTGAGAATACAGAAGTTCAAGGG + Exonic
1101042435 12:100770498-100770520 CTGAAAACGTAGAAGTTCAATGG + Intronic
1101414633 12:104498492-104498514 CTAAAAAGCCAGAAGAACAAAGG + Intronic
1102144153 12:110642014-110642036 TTGAAAATTTAGAATTTCAAAGG + Intronic
1102196012 12:111025643-111025665 CTGAGAATCCAGAAGTTCCAAGG + Intergenic
1102288484 12:111679482-111679504 CTGAAGATTAAAAAGTCCAATGG - Intronic
1102575435 12:113853441-113853463 CTGCAACTGCAAAAGTACAAAGG + Intronic
1103262594 12:119601234-119601256 GTGAAATTTCAGAGGTTCAAGGG + Intronic
1103501617 12:121407379-121407401 CTGCAAATTCAGAAGCCAAAAGG + Intronic
1103501633 12:121407527-121407549 CTGCAAATTCGGAAGCCCAAGGG + Intronic
1104167527 12:126248397-126248419 CTGAAAAAGCAAAAGAACAATGG + Intergenic
1104377352 12:128276547-128276569 CTGAGAACTCAGAAGGAGAAGGG - Intronic
1104557010 12:129809594-129809616 CAGAAAATTCACAAAAACAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107335756 13:39353372-39353394 CAGAAAATGTAGAAGTAAAACGG + Intronic
1107872062 13:44756263-44756285 CTGAAAAGTCATCAGTAAAAAGG + Intergenic
1107872587 13:44760833-44760855 TTGAAAATTGAAAACTACAAAGG - Intergenic
1108144781 13:47464652-47464674 CTGAAAATTCAAAAGGCCAGAGG + Intergenic
1108564486 13:51682029-51682051 TTGAAAATTCACAACTGCAATGG - Intronic
1108857207 13:54809118-54809140 CTGAAGATTAGGAAGTACTAAGG + Intergenic
1108936141 13:55882550-55882572 CTGAAACTATAGAAATACAAAGG - Intergenic
1109144246 13:58757953-58757975 CTGACACTACAGAAATACAAAGG - Intergenic
1110043016 13:70789277-70789299 ATGAAAATCCAACAGTACAAAGG + Intergenic
1110368372 13:74713213-74713235 CTGAAGATTCAGAAGATCATTGG - Intergenic
1110548592 13:76785236-76785258 CTGATACTACAGAAATACAAAGG + Intergenic
1110672765 13:78201314-78201336 GTGAAAATTCAGCAGTTCAGTGG - Intergenic
1110789604 13:79573219-79573241 CTGAAAATTCTGAACTAAATTGG - Intergenic
1110917260 13:81037090-81037112 CTGAAACTACAGAAATTCAAAGG - Intergenic
1110948085 13:81449753-81449775 GTGAAAATTCAGATGTAAAAAGG + Intergenic
1111486914 13:88914621-88914643 ATGAAAGTTCAGAATTAAAATGG + Intergenic
1112314650 13:98350690-98350712 CAGAAAATTAAAAAGTACAGAGG - Intronic
1114147021 14:19989344-19989366 CTGATACTACAGAAATACAAAGG + Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114960390 14:27880447-27880469 CTGATACTTCAGAAATTCAAAGG - Intergenic
1115730337 14:36261840-36261862 ATGGAAAGTCAGAAATACAATGG - Intergenic
1115749403 14:36473882-36473904 CTGAAAATGCAGAACAAAAATGG + Intronic
1116775242 14:49172435-49172457 CTGATACTACAGAAATACAAAGG + Intergenic
1117064514 14:51997649-51997671 CTTGAAATTCAGAATTCCAAAGG - Intronic
1117679917 14:58193337-58193359 CTGAAAATCCTGAAATAGAATGG - Intronic
1117996006 14:61478974-61478996 ATAAAGATTCAGAGGTACAACGG + Intronic
1118513951 14:66507171-66507193 TTTAAAATTCAGAAGTTGAAAGG + Intergenic
1118562772 14:67104671-67104693 CTGATACTACAGAAATACAAAGG - Intronic
1118676773 14:68194761-68194783 ATTAATATTTAGAAGTACAAGGG + Intronic
1119935064 14:78584837-78584859 TTGAAAATGCAGAGGTACAGAGG - Intronic
1120206578 14:81593569-81593591 CACAAAACTTAGAAGTACAAAGG - Intergenic
1120511579 14:85421887-85421909 CTGATAATGAAGAAGTAGAATGG - Intergenic
1124807907 15:32904962-32904984 ATAAATATTCAGAAGTACCAAGG - Intronic
1124858365 15:33412711-33412733 CTGAAAATGCAGCAGTGGAATGG - Intronic
1125178639 15:36855866-36855888 ATAAAAATTCAGATGTTCAATGG + Intergenic
1125401573 15:39310125-39310147 CTCAAAATTCATTAGTACCAAGG - Intergenic
1126666404 15:51079179-51079201 CAGAAAATGCAAAAGTGCAAGGG - Intronic
1126718028 15:51542969-51542991 ATGAAAATACAGAATAACAAGGG + Intronic
1127177698 15:56378537-56378559 CTGACAATGCAGAAATTCAAAGG - Intronic
1127321431 15:57850485-57850507 GTGAAACTTCAGAATTCCAATGG - Intergenic
1130192947 15:81753693-81753715 CTGAAATGTCAGTAGTTCAAGGG + Intergenic
1130358312 15:83155935-83155957 ATGGTAATTCAGAAATACAATGG - Intronic
1131022020 15:89106918-89106940 CTGAAAAATCAGAATGACATGGG + Intronic
1131337564 15:91564038-91564060 CTGAAAATTCAGAACCAAGATGG + Intergenic
1131661443 15:94522101-94522123 GTGAAACTTCAGAGGTCCAAGGG - Intergenic
1132362783 15:101231470-101231492 CTCAAAATTCAGAAGTGCAAAGG - Intronic
1132370729 15:101295755-101295777 ATGAATATTCAGAAGTCTAAAGG - Intergenic
1132440178 15:101854835-101854857 CTTAAAATTCAGAACTCAAATGG + Intergenic
1134433487 16:14234071-14234093 CAGAAAAATTAGAATTACAAGGG - Intronic
1135289133 16:21219501-21219523 ATGAAAACTCAGTAGTATAAAGG + Intergenic
1139241775 16:65399630-65399652 ATGAAAATACAGAAGTTAAAAGG - Intergenic
1140880123 16:79190448-79190470 CTGAAAATTCAGACCCACAGAGG + Intronic
1144210705 17:13012773-13012795 CTGCAAATTCCGAAGTATCAGGG - Intronic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1144381306 17:14701254-14701276 CTGATAAATCAGAAGTAAAGAGG - Intergenic
1145851942 17:28108249-28108271 CTGACAATCCAAAAGTATAAAGG + Intronic
1147212192 17:38878131-38878153 CTGAACATGAAGAACTACAAGGG + Exonic
1147343257 17:39768234-39768256 CAGAAACTTCAGAAGTACTTGGG + Intronic
1149287506 17:55181207-55181229 TTGAATATTCAGAACTACCAAGG + Intergenic
1149622186 17:58054209-58054231 CTGAAATTTCACAAGTAGAAAGG - Intergenic
1149930271 17:60745626-60745648 CTGAAAATTAAAAGTTACAAAGG + Intronic
1150944464 17:69730089-69730111 CTGAAAATTCTGAATGACTAAGG - Intergenic
1154171897 18:12058448-12058470 CTGATACTTCAGAAATTCAAAGG + Intergenic
1154416054 18:14176202-14176224 CTGATACTTCAGAAATTCAAAGG + Intergenic
1155079857 18:22398046-22398068 CTGAAAATACAGAAGTGAAGTGG + Intergenic
1156247236 18:35313005-35313027 CTGTAATTTCAGAAATAAAAAGG + Intergenic
1156338582 18:36190224-36190246 CTAAAGATTCAGAAATACAAAGG - Intronic
1157929002 18:51799447-51799469 CTGATATTGCAGAAATACAAAGG - Intergenic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158819231 18:61139692-61139714 CTTAAAATTCAGTAGTTCAGAGG - Intergenic
1159027055 18:63192798-63192820 TTGAAAATGCAGAAGTAGACAGG - Intronic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159125124 18:64214881-64214903 CTGTCAATTCAGCAGTCCAAGGG - Intergenic
1159444253 18:68521339-68521361 CTGAATATTCAGACATATAAAGG + Intergenic
1159655035 18:71023165-71023187 CTGAAAACACAGACCTACAAAGG - Intergenic
1160439857 18:78881348-78881370 TTGAATATAGAGAAGTACAAAGG - Intergenic
1161380455 19:3962286-3962308 CAGATAATTCAGACTTACAAAGG - Intronic
1162669683 19:12245246-12245268 CTGAAAATGCATAATTGCAATGG + Intronic
1162755376 19:12855319-12855341 TTGAAAAATCAGAAGTTCTAGGG + Intronic
1163920578 19:20284779-20284801 CTGAACATCCAGAATTACAGAGG + Intergenic
1164044167 19:21520277-21520299 CCTAAAATTCAGATGTCCAAGGG + Intronic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1164924478 19:32118258-32118280 CAGAAAATTCACAAATACATGGG - Intergenic
1166194260 19:41195744-41195766 CTGAAAATTCATCAGTTGAATGG - Intronic
1168490298 19:56803339-56803361 CTGAAAATGTGGAAGTCCAATGG + Intronic
926848179 2:17165310-17165332 TTCAGAATTCAGAAGTACATTGG + Intergenic
927067214 2:19485285-19485307 CTGAAAAACCAGAGGTACAATGG + Intergenic
927067279 2:19486115-19486137 CTGAGAAATCAGAGGTACCATGG + Intergenic
929496235 2:42446569-42446591 CCCAAACATCAGAAGTACAATGG + Intronic
929926255 2:46213466-46213488 CTGAAACTGCAGAAATTCAAAGG - Intergenic
930285882 2:49427318-49427340 TTTAAAATGCAGAAGTAAAATGG - Intergenic
930303060 2:49641456-49641478 CTGAAGATATAGAAGTAAAATGG - Intergenic
931820938 2:65951551-65951573 CTGAAAACTCGGAAAAACAAGGG - Intergenic
933656945 2:84896250-84896272 CTGAAAATTCAGAAAAATCATGG + Intronic
934016093 2:87884617-87884639 TTGATAATACAGAAATACAAAGG + Intergenic
934531041 2:95089332-95089354 CTGACATTTCAGGAGTACAGTGG - Intronic
935761744 2:106327139-106327161 CAGAAAATTCAGTAATACACAGG + Intergenic
935984312 2:108658060-108658082 GTGAAAATTCAGGAGAACATTGG + Intronic
936022855 2:109008197-109008219 GTGAAAATACAGAAGCACATAGG - Intergenic
936136750 2:109901708-109901730 GTGAAAATTCAGGAGAACATTGG + Intergenic
936207947 2:110469777-110469799 GTGAAAATTCAGGAGAACATTGG - Intronic
936416413 2:112318263-112318285 CTCAAAATCCAGAAGCAAAAAGG + Intronic
936823360 2:116551699-116551721 CTGAAATTGCAGAAGTGGAATGG - Intergenic
936910377 2:117585005-117585027 CTGACAACACAGAAATACAAAGG + Intergenic
936994779 2:118402000-118402022 CTGATACTTCAGAAATTCAAAGG - Intergenic
937513366 2:122624561-122624583 CTCAAAATTTAGAAGTAAAAGGG - Intergenic
937788112 2:125926070-125926092 ATGAAAATTCAGAAGACCAGGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938252933 2:129829749-129829771 CAGAGAATTCAGTCGTACAAAGG + Intergenic
938270853 2:129969515-129969537 CAGCAAATTTAGAAATACAATGG + Intergenic
938811092 2:134853287-134853309 CTTAAAAGTCAGAAGTTCACAGG + Intronic
940176121 2:150879297-150879319 CTGAACATTCAGAAGTGCAAAGG + Intergenic
940235128 2:151503063-151503085 CTGGAAATGAAAAAGTACAATGG + Intronic
941465265 2:165818190-165818212 CTGATAGTTCAGAAGAATAAGGG + Intergenic
942366775 2:175236477-175236499 CAGAGATTCCAGAAGTACAAAGG - Intergenic
942912930 2:181267868-181267890 CTATAAATTCAAAACTACAAAGG - Intergenic
943552701 2:189359883-189359905 CTGATAACACAGAAATACAAGGG - Intergenic
943708013 2:191056574-191056596 ATATAAATACAGAAGTACAAAGG - Intronic
944469132 2:200034163-200034185 CTCAAAATTCAGAAATACAGTGG - Intergenic
945174330 2:207026947-207026969 CTGATAACACAGAAATACAAAGG + Intergenic
945483551 2:210368844-210368866 AAGAAAATTCAGAAGGAAAATGG - Intergenic
945702943 2:213193878-213193900 GTGAAAATTGCTAAGTACAAGGG + Intergenic
946459904 2:219859612-219859634 CTGAAAATTCTGAAGTAAACAGG + Intergenic
946559189 2:220893318-220893340 ATGAAAGTTCATAAGTACAGAGG + Intergenic
947138622 2:227000321-227000343 CTGAAATTTGAGAAGTACTTTGG - Intergenic
947294982 2:228621045-228621067 GTGAAAATTCAGCAATACATGGG - Intergenic
947306238 2:228750777-228750799 CTGAAAAGTCTGAAATACTATGG + Intergenic
948161100 2:235825278-235825300 CTGGAAATTCAAAAGGATAACGG - Intronic
1169705682 20:8501589-8501611 TAGAAAATTCAGAAGGACCAGGG - Intronic
1169889985 20:10441991-10442013 CTGTAACTTCAGAAGTTCTAGGG + Intronic
1170352447 20:15456766-15456788 CTCAAAATTCTGAGGTACAGTGG + Intronic
1170562232 20:17568382-17568404 CTGAATATTAAGAAGTGTAAGGG + Intronic
1171127985 20:22621270-22621292 GGGAAAATACAGAAGTTCAAAGG - Intergenic
1171515087 20:25724183-25724205 CTGATACCACAGAAGTACAAAGG - Intergenic
1172415022 20:34758168-34758190 CTGTATATCCAGAATTACAAAGG - Intronic
1172419309 20:34801517-34801539 CTGATACTTCAGAAATTCAAAGG + Intronic
1173108918 20:40166499-40166521 CTAATAATTCAGAATTTCAAAGG - Intergenic
1174255643 20:49252720-49252742 CTGGTAATTCAGACGGACAAAGG + Exonic
1175556394 20:59861157-59861179 CTGAAATTTCGGAAATAAAAAGG - Intergenic
1175821530 20:61912723-61912745 CTGAAAATTCATAATTAGAGGGG - Intronic
1176857288 21:13983093-13983115 CTGATACTTCAGAAATTCAAAGG - Intergenic
1176867321 21:14061138-14061160 CTGATACTTCAGAAATTCAAAGG + Intergenic
1177537696 21:22450049-22450071 TTGAAAATTCAGATATACAGGGG + Intergenic
1182007013 22:26969444-26969466 TTAAAAATTCAGAAGTTTAAGGG + Intergenic
1182313866 22:29429483-29429505 CTGGAAATCCAGAAATACAAAGG + Intergenic
950553394 3:13681050-13681072 CTGAAAACTCAGAGGTCCACAGG - Intergenic
951400704 3:22228972-22228994 CTAAAACTTCAAAAGTACAAAGG - Intronic
951404760 3:22282062-22282084 CTGATAACACAGAAATACAAGGG - Intronic
952079447 3:29740358-29740380 CAGCAAACTCAGAAATACAAGGG + Intronic
952512612 3:34072287-34072309 CTGGAAATTCTGACGTCCAAAGG + Intergenic
952775524 3:37042344-37042366 TTGAAATTTCAGAAGTGAAAAGG - Intronic
953625171 3:44565106-44565128 AGGAATAATCAGAAGTACAAAGG - Intronic
954506329 3:51078481-51078503 CTGAAATTTCATAATTACATTGG - Intronic
955422851 3:58756822-58756844 CTGAAAAGATAAAAGTACAAAGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956525240 3:70152343-70152365 ATGAAAATTCAAAAATGCAAGGG - Intergenic
956611673 3:71130083-71130105 CTGTAGATGCAGAATTACAAAGG + Intronic
957154243 3:76527310-76527332 TTAAAAAGTCAGAAGTGCAAGGG + Intronic
957220572 3:77377189-77377211 CATAAAATTCAAAAGTATAAAGG + Intronic
957227409 3:77467770-77467792 CTTAAAATTAAGAACTACACAGG - Intronic
957651811 3:83016295-83016317 CTGAAAAATTAGAAGTACGAAGG - Intergenic
957718104 3:83958771-83958793 CTGAAAATACGTAGGTACAATGG + Intergenic
958083458 3:88775912-88775934 TTGAAAATTCACAATTACTAAGG + Intergenic
958149622 3:89673063-89673085 CTGATACCTCAGAAATACAAAGG + Intergenic
958606245 3:96362026-96362048 CTAAAAATTCAAAAGGACTATGG + Intergenic
958681907 3:97342138-97342160 ATGAAAATTCGAAAGTAAAAGGG - Intronic
958989272 3:100823104-100823126 GTAAAAATTCAGATGTACAATGG + Intronic
960370954 3:116838732-116838754 CTGAAAAATGAGAAAAACAATGG - Intronic
960476131 3:118130912-118130934 CTGAAAATTGAGAACTACTCTGG - Intergenic
960598163 3:119426397-119426419 CTGATACTCCAGAAATACAAAGG - Intergenic
961091408 3:124115669-124115691 CTGGTCATTCAGAAGTACCAGGG - Intronic
961833269 3:129635885-129635907 CTGATAATCCAGAAGTGCAGCGG + Intergenic
962916683 3:139910829-139910851 CTACAATTTCAGAAATACAAAGG - Intergenic
962925851 3:139992790-139992812 CAGAAAATTGAGGAGTAGAAGGG + Intronic
964131880 3:153298312-153298334 CTAACAATTCAAAAGTAAAAGGG - Intergenic
965516516 3:169627754-169627776 GTTAAAATTAAGAAGAACAAAGG - Intronic
966690400 3:182735694-182735716 ATGAAGATTCAGCAGTACAAAGG + Intergenic
966705458 3:182908726-182908748 CTCATAATTCAGAACTGCAATGG - Intronic
966983533 3:185159387-185159409 CTGAAAATTCACAAATAGGATGG + Intergenic
969542464 4:7801781-7801803 CTGAAAAATCAGAATTGGAAAGG - Intronic
969899815 4:10338443-10338465 CTGAAAATTCAGTACCACATAGG - Intergenic
970071797 4:12167672-12167694 CTGAAAATGTAGAATAACAATGG + Intergenic
970438631 4:16060166-16060188 CTGAAAATTCAGAAGTACAAAGG - Intronic
970652810 4:18197407-18197429 TTTAAAATGCAGAAGTAAAAAGG + Intergenic
970915270 4:21325415-21325437 CTGATGATTCAGAAATTCAAAGG - Intronic
971355579 4:25892050-25892072 CTGAAAAGTCAGCAGTGAAATGG - Intronic
974194197 4:58550489-58550511 CTGTTAATTCACAATTACAATGG - Intergenic
974264836 4:59572185-59572207 CTCAAAGATTAGAAGTACAATGG + Intergenic
975223773 4:71845456-71845478 CTGATACCTCAGAAATACAAAGG - Intergenic
975671987 4:76789365-76789387 CTGACACTACAGAAATACAAAGG + Intergenic
976501558 4:85796498-85796520 CATAAAATTGAGAAGTCCAAGGG + Intronic
976618440 4:87102069-87102091 CTGAAAAAGCAGTTGTACAAAGG + Intronic
976796735 4:88942136-88942158 AAGATAATTCAGAATTACAATGG + Intronic
977083776 4:92568457-92568479 CAGAAACTTCAGAAGAATAAAGG - Intronic
977345832 4:95814712-95814734 CTGAAAATTCTGAAAGACAAAGG + Intergenic
977644474 4:99396908-99396930 CTGACACTTCAGAAATTCAAAGG + Intergenic
977830036 4:101579366-101579388 CTGAAAAGCCAGAATTACCATGG - Intronic
977835879 4:101646029-101646051 CTGAGAATAAAGAAGTAAAAAGG + Intronic
978180556 4:105789903-105789925 GAGAAAATTCAAAAGAACAATGG - Intronic
978278695 4:106983747-106983769 CTCAAAATTCAACAGTAAAAAGG + Intronic
979264555 4:118685748-118685770 GCGAAAATTGAGAACTACAAAGG - Intronic
979425317 4:120557242-120557264 CTGAAAATTCAGATGTGCAATGG - Intergenic
979644275 4:123049647-123049669 CTGATACTACAGAAATACAAAGG - Intronic
979964307 4:127059495-127059517 CTGATACTACAGAAATACAAAGG + Intergenic
979974757 4:127183484-127183506 CTGAAACTGCAGAAATTCAAAGG + Intergenic
980177261 4:129361929-129361951 TTTAAAAATCAGAAGTTCAAGGG + Intergenic
980410290 4:132409126-132409148 CTAAAAATTAAGAAGTTCAAAGG - Intergenic
981263639 4:142754042-142754064 CTGAAAAATCAGAATCACAATGG + Intronic
981823213 4:148909977-148909999 CTGAAAATTCATAATTAAAAGGG + Intergenic
981868981 4:149463541-149463563 TTCAAAATTCAGAATTACCATGG + Intergenic
981895941 4:149799653-149799675 CTGATACTGCAGAAGTTCAAAGG + Intergenic
982791726 4:159599970-159599992 TTCAAAATTCAAAAGTACAAAGG + Intergenic
983436949 4:167728245-167728267 TTAAAAATCCAGAAGTACAGTGG + Intergenic
983588260 4:169379422-169379444 CTGATAACTCAGAAATAAAAAGG + Intergenic
983772026 4:171562938-171562960 CTTAAAATTCAGGAATATAAAGG - Intergenic
983794198 4:171839746-171839768 ATGAAAATTCACAAGCAGAAAGG + Intronic
983876786 4:172886354-172886376 CTGAGACCTCAGAAATACAAAGG - Intronic
983990557 4:174114315-174114337 CTGAAAATTGAGGAGTAGAAAGG + Intergenic
984334439 4:178371039-178371061 CTGAAATCACAGAAATACAAAGG - Intergenic
984438689 4:179737451-179737473 GAGAAAATTCTGAAGAACAATGG - Intergenic
984591595 4:181623425-181623447 GTGAAAATGCTGAAGTACTAAGG + Intergenic
984821338 4:183885397-183885419 CTGAACACTCAGATGTCCAAAGG + Intronic
985117636 4:186607184-186607206 ATGAAATTTCAGAAGAATAATGG - Intronic
986345238 5:6828719-6828741 CTGAAATTTTAGAGGGACAAAGG + Intergenic
986544302 5:8879079-8879101 CTGAGACTTCAGAAATTCAAAGG - Intergenic
986890852 5:12303227-12303249 CTGATAACACAGAAATACAAAGG + Intergenic
987787249 5:22517428-22517450 CTGAAAATATTGAAGTTCAAAGG + Intronic
988457386 5:31398471-31398493 CTGAGAACTCAGAAGAACCAGGG - Intergenic
988955959 5:36319440-36319462 CTGATACTTCAGAAATTCAAAGG - Intergenic
989472966 5:41842165-41842187 TTGAAAATTCAGTATTATAAAGG + Intronic
990242274 5:53827343-53827365 CTGAAGATTGAGAAGGTCAAGGG + Intergenic
990530317 5:56667006-56667028 CTGGATATTCTGAAGTACAGAGG - Intergenic
992132899 5:73712329-73712351 CTCACAATTCACAAGGACAAAGG - Intronic
993162986 5:84313783-84313805 CTGCAAATTCAGAATTACCTGGG - Intronic
993220044 5:85082760-85082782 GTGAAAATTATAAAGTACAAAGG - Intergenic
993438391 5:87925352-87925374 CTGAAAATTCAGTAGCTCCATGG - Intergenic
994438853 5:99775400-99775422 CTGAAACTTCAGAAGTGCTAGGG - Intergenic
996162578 5:120183766-120183788 CTGATAATATAGAAGTTCAAAGG + Intergenic
996889336 5:128399215-128399237 GTGAAACTGCAGAACTACAAAGG + Intronic
996940325 5:128997461-128997483 CTGTAAATGTAGAAATACAAGGG + Intronic
996945857 5:129066857-129066879 CTGCAAATCCAGAAGTCCACTGG - Intergenic
996963079 5:129274741-129274763 CTTAAAATTTGTAAGTACAATGG - Intergenic
996999022 5:129736296-129736318 CCCAAAATACAGAAGCACAATGG + Intronic
998494659 5:142577382-142577404 CTTAAAATTGAGAAATAAAAAGG - Intergenic
998686016 5:144526646-144526668 CTGACAGCTCAGAAATACAAAGG + Intergenic
999196765 5:149786683-149786705 CTGAAAGTTGAGAAGATCAAGGG + Intronic
999405950 5:151306939-151306961 CTGATACTGCAGAAATACAAAGG - Intergenic
1000116770 5:158161032-158161054 CTGAATGTTCAGAATTAAAAAGG - Intergenic
1000546100 5:162604683-162604705 ATGAAAATTCAAAACAACAATGG - Intergenic
1000898143 5:166881116-166881138 CTGAAAATGGAAAAGGACAAAGG - Intergenic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1003212873 6:4082770-4082792 ATGAAAACTCAGAAATACAGGGG - Intronic
1004062678 6:12213433-12213455 CAGAAGATTCAGAAGTGCTATGG - Intergenic
1004323716 6:14654324-14654346 CTGAAGCTTCAGAAATACATAGG - Intergenic
1004587566 6:17016627-17016649 CTGAAGTTTTAGAAGTAAAATGG - Intergenic
1004798632 6:19118426-19118448 CTGATACTACAGAAATACAAAGG + Intergenic
1008487936 6:52055497-52055519 CTGAAAACTCAGAAGCACAAAGG - Intronic
1009634794 6:66251905-66251927 CTGAAACTGCAGAAATTCAAGGG + Intergenic
1012020909 6:93917962-93917984 ATGAAGATTAAAAAGTACAAGGG + Intergenic
1013120710 6:107138141-107138163 CTGAAAATTCTGAAAAACATAGG + Intergenic
1013156728 6:107498968-107498990 CTCAAAATTCACAATTAAAATGG - Intronic
1013548257 6:111181610-111181632 TTGAAGATTCAGAAATACAATGG + Intronic
1013874712 6:114810980-114811002 GTGAAATGTCAGATGTACAAAGG - Intergenic
1014096192 6:117464787-117464809 GTGAACATACAGAAGAACAAGGG + Intronic
1014145257 6:117990189-117990211 AGTAAAATTCAGAAGTACACTGG - Intronic
1014334354 6:120113976-120113998 CTGCGAATTTAGAAGTGCAAAGG - Intergenic
1014775751 6:125507647-125507669 CGGAAAAATGAGAAGTAAAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015068823 6:129064599-129064621 CTGATACTTCAGAAATACAAAGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017381573 6:153837603-153837625 CTGAAAATTCTGCAATACCAAGG - Intergenic
1018445023 6:163848910-163848932 CTGATACCACAGAAGTACAAAGG - Intergenic
1020369946 7:7421121-7421143 CTGTAAATTCAGCAATAAAAAGG + Intronic
1020985020 7:15122345-15122367 CTGCAGATACAGAAGTACACAGG - Intergenic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1021685193 7:23178732-23178754 TTGATAATTCAGGGGTACAAGGG + Intergenic
1022213313 7:28233254-28233276 GTGCAAATTTAGAAGAACAAGGG - Intergenic
1023409270 7:39872504-39872526 CTTAAAATTCAGAAAAAAAAGGG - Intergenic
1023636187 7:42213166-42213188 TGTAAAATTCAGAAGTAGAAGGG - Intronic
1025043663 7:55671526-55671548 CTTAAAATTCAGAAAAAAAAGGG + Intergenic
1025111339 7:56218840-56218862 CTGAAATTTGAGAAGGACACTGG - Intergenic
1025136585 7:56420031-56420053 CTTAAAATTCAGAAAAAAAAGGG + Intergenic
1026306568 7:69147621-69147643 CTGAAATTTAAGAAGGACACTGG + Intergenic
1027306446 7:76902798-76902820 TTTATAATTCAGAAGAACAATGG - Intergenic
1027475585 7:78627305-78627327 CTGAATATTCAGAAGTATGGTGG - Intronic
1027597325 7:80190039-80190061 CTGAATATACAGAATTATAAAGG - Intronic
1027670103 7:81086131-81086153 TTGAAATTTCAGCAGCACAATGG - Intergenic
1028198058 7:87930081-87930103 CTGATAACACAGAAATACAAAGG + Intergenic
1028673381 7:93430570-93430592 AAGAAAATTAAGAAATACAATGG - Intronic
1028967914 7:96823426-96823448 CTGAAAATCCAGAAGTACGAAGG + Intergenic
1029930732 7:104367927-104367949 CTTAAAGTTCAAAAGGACAAGGG - Intronic
1030340868 7:108378711-108378733 GTGAAATTTCAGAAATCCAAAGG + Intronic
1030841661 7:114360550-114360572 CAGGAAATTCAGAAGTAATAGGG - Intronic
1031100583 7:117475389-117475411 CTGAACATTCCACAGTACAAGGG + Intronic
1031215048 7:118879670-118879692 CTGAAAATTAAAAAATAAAATGG + Intergenic
1031231337 7:119110962-119110984 CTGATACTGCAGAAGTTCAAAGG - Intergenic
1031260306 7:119509596-119509618 CTGATACTTCAGAAATTCAAAGG + Intergenic
1031660717 7:124420969-124420991 CTGTAAATTCAGAAATAAATGGG - Intergenic
1031901098 7:127412103-127412125 ATGAAAGAGCAGAAGTACAATGG - Intronic
1034339844 7:150345545-150345567 ATAAAAATTTAAAAGTACAAAGG - Intergenic
1034892170 7:154850763-154850785 CTGATAACACAGAAGTACAAAGG - Intronic
1035492686 7:159294078-159294100 CTGAGAATTCAGAAATACCAGGG + Intergenic
1036009472 8:4705271-4705293 GTGAAAATTGAGTAATACAATGG + Intronic
1036059024 8:5294257-5294279 CTGAAGATTCAGGAGAACAAGGG - Intergenic
1036165737 8:6431122-6431144 CAGATAATTCAGAGGTAGAAGGG - Intronic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1037061293 8:14512833-14512855 ATGAAACTTCAGAAGCACCAGGG - Intronic
1038690309 8:29755596-29755618 GTGAAACTCCAGAAGAACAAGGG + Intergenic
1038812595 8:30865144-30865166 CTGAAACCACAGAAATACAAAGG + Intronic
1039679250 8:39711435-39711457 CTCAAAAATCAGACTTACAACGG + Intronic
1039934323 8:42027609-42027631 CTGATACCACAGAAGTACAAAGG - Intronic
1042055431 8:64759636-64759658 ATGAAAATTCAGACCTAGAATGG + Intronic
1042726533 8:71884450-71884472 CTGATACTTCAGAAATTCAAAGG - Intronic
1043179655 8:77071064-77071086 CTAAAAAAACAGGAGTACAATGG - Intergenic
1043618634 8:82159813-82159835 CTGAAAAGTTAGAAGCCCAATGG - Intergenic
1043627272 8:82277262-82277284 CTGATACTTCAGAAATGCAAAGG + Intergenic
1044349385 8:91145854-91145876 ATGAAATTTTAGAATTACAATGG - Intronic
1045803749 8:106132251-106132273 CTGATTATTCACAAGTATAAGGG + Intergenic
1045923636 8:107562745-107562767 CTGTATATTCAGAATAACAAAGG - Intergenic
1046150283 8:110214966-110214988 CTGATAATGCAGAAGTTCAAAGG + Intergenic
1046367762 8:113258755-113258777 GAGAAAATTCAGCAGTAAAAAGG + Intronic
1046435793 8:114187732-114187754 ATGAAAATTCAGAATGACTATGG + Intergenic
1046576617 8:116037721-116037743 CCAAAAATTCAGAAACACAAAGG - Intergenic
1046921086 8:119729463-119729485 CAGAAAATTCATAAGTATATGGG + Intergenic
1048361544 8:133701340-133701362 CTGTAAACTCAGAAGTAAAGGGG - Intergenic
1048589750 8:135810409-135810431 CTGACAGTGAAGAAGTACAAAGG + Intergenic
1048644344 8:136402152-136402174 CTGATAATACAGAAATACAAAGG + Intergenic
1050040200 9:1483134-1483156 CTGATACCACAGAAGTACAAAGG - Intergenic
1050138967 9:2497606-2497628 CTCAAAGTTCAGAAACACAATGG - Intergenic
1050679763 9:8097023-8097045 ATGAAAATATAGAAGTAGAAAGG - Intergenic
1050754501 9:8984588-8984610 CTGAGAAGTCAGAAGAAAAATGG - Intronic
1050980266 9:12002533-12002555 CTGAAAATACAGAAGAATAGTGG + Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051371203 9:16360601-16360623 CTGAAACTGCAAAAGTCCAAAGG - Intergenic
1052931616 9:34060356-34060378 CTGAAAATTCAGTAGATAAATGG + Intergenic
1053409319 9:37905245-37905267 CTGGAAATTCAGAAGCATGAGGG + Intronic
1054890689 9:70248413-70248435 CTGAAAATTCATAAGTTTAGAGG + Intergenic
1055644633 9:78351236-78351258 CTGAAAACTCAGAAGTTCATTGG + Intergenic
1055862485 9:80769433-80769455 ATGAAAATCCAGAAGTCAAAAGG + Intergenic
1056442418 9:86634145-86634167 CTGAGCATTCAGAATCACAAAGG + Intergenic
1058133594 9:101281757-101281779 CTGACACTACAGAAATACAAAGG + Intronic
1058272458 9:102989548-102989570 CTGAAACCACAGAAATACAAAGG + Intergenic
1058565560 9:106281161-106281183 CTGATAATATAGAAATACAAAGG - Intergenic
1058770479 9:108226481-108226503 CTGAGAATTTAGAAGTGGAAAGG - Intergenic
1059508279 9:114819787-114819809 CTGAAAATTTTGAAATACAGAGG + Intergenic
1059702050 9:116784766-116784788 CTGAAAATACAAAAGTAGACAGG + Intronic
1061771355 9:132925740-132925762 CTGAAAATGTAAAAGAACAAGGG + Intronic
1062292690 9:135804162-135804184 CTGAGAATTCAGAAGCAAATGGG - Intergenic
1186144208 X:6608905-6608927 TTGAAAATTCAGCAGAAAAAAGG - Intergenic
1187572937 X:20523673-20523695 CTGAAAAAGCAGAACTATAAGGG + Intergenic
1188145804 X:26611820-26611842 CTGAAAATGCAGGATTACAAGGG + Intergenic
1188253276 X:27926670-27926692 CTGAAAGGTGACAAGTACAATGG - Intergenic
1188579478 X:31692590-31692612 CTGATAACACAGAAATACAAAGG + Intronic
1188741790 X:33792672-33792694 CTGAAACTACAGAAATTCAAAGG - Intergenic
1190187141 X:48245142-48245164 CTGAAAATGCAGAAAAAAAATGG + Intronic
1190200803 X:48358898-48358920 CTGAAAATGCAGAAAAAAAATGG + Intergenic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190656034 X:52612922-52612944 CTGAAAATGCAGAAAAAAAATGG + Intergenic
1190762237 X:53446385-53446407 CTGAGAATCCAGAAATACAAAGG + Intergenic
1190922392 X:54867096-54867118 CTGAAACCACAGAAATACAAAGG - Intergenic
1191179434 X:57544469-57544491 CTGAAACTACAGAAATTCAAAGG + Intergenic
1192075296 X:67989108-67989130 CTGAAAACTCAGAAGAGGAATGG + Intergenic
1192241306 X:69331851-69331873 CTGATAAAACAGAAATACAAAGG - Intergenic
1192310062 X:70004112-70004134 CTGACATTTCAGAAGCATAATGG - Intronic
1192844736 X:74894372-74894394 CTGATACTTCAGAAATCCAAAGG + Intronic
1192927705 X:75773851-75773873 CTGATAATACAGAAATTCAAAGG + Intergenic
1192990656 X:76452566-76452588 CTGATACCTCAGAAATACAAAGG - Intergenic
1193561718 X:83025983-83026005 CTGATAATGCAGAAATACAAAGG + Intergenic
1193957662 X:87882192-87882214 CTGATAATGCAGAAATTCAAAGG - Intergenic
1194045283 X:88994004-88994026 CTAAAAATCCAGATGTAAAAGGG + Intergenic
1194210992 X:91068463-91068485 GTAAAAATTAAGAAGGACAAAGG + Intergenic
1194521907 X:94930329-94930351 CTGATGATGCAGAAGTTCAAAGG - Intergenic
1194530964 X:95047684-95047706 CAGAAAAATAAGAACTACAACGG + Intergenic
1194919552 X:99748760-99748782 TTGAAAATACAGAAATCCAAAGG - Intergenic
1194921061 X:99765039-99765061 CTGAAAGTGCAGAAATTCAAAGG + Intergenic
1195874636 X:109526460-109526482 CAGAAAAGTCAAAAGTAAAAAGG + Intergenic
1196233192 X:113249337-113249359 CTGATAATGCAGAAATTCAAAGG - Intergenic
1196366370 X:114928708-114928730 CTGAAAATTAATAAGAAAAAAGG - Intergenic
1196574684 X:117304366-117304388 CTTCAAATACAGAAGCACAAAGG + Intergenic
1198230016 X:134680088-134680110 CTGAATCTTCAGAAGGACATGGG + Intronic
1198267230 X:135021406-135021428 CTGCAAATTCAGAAGAGAAATGG + Exonic
1198270311 X:135051058-135051080 CTGCAAATTCAGAAGAAAACAGG + Exonic
1198514899 X:137396719-137396741 CTGATACTTCAGAAATTCAAAGG - Intergenic
1198612277 X:138415309-138415331 CTGATACTTCAGAAATTCAAAGG + Intergenic
1199128393 X:144153926-144153948 TTGATAATACAGAAATACAAAGG - Intergenic
1199150798 X:144484006-144484028 TTGGAAATTTAGAATTACAATGG + Intergenic
1199304277 X:146249106-146249128 CTGATACTTCAGAAATTCAAAGG + Intergenic
1199421265 X:147647514-147647536 CTGAAAAACCACAAGCACAATGG + Intergenic