ID: 970440960

View in Genome Browser
Species Human (GRCh38)
Location 4:16080910-16080932
Sequence CCGCAGCCACCCACCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970440953_970440960 10 Left 970440953 4:16080877-16080899 CCAGTAGCCACATCCAGGGTCCT 0: 1
1: 0
2: 1
3: 10
4: 169
Right 970440960 4:16080910-16080932 CCGCAGCCACCCACCCATCAGGG 0: 1
1: 0
2: 2
3: 17
4: 229
970440956_970440960 -3 Left 970440956 4:16080890-16080912 CCAGGGTCCTGTTCTGGCAGCCG 0: 1
1: 0
2: 1
3: 9
4: 170
Right 970440960 4:16080910-16080932 CCGCAGCCACCCACCCATCAGGG 0: 1
1: 0
2: 2
3: 17
4: 229
970440957_970440960 -10 Left 970440957 4:16080897-16080919 CCTGTTCTGGCAGCCGCAGCCAC 0: 1
1: 0
2: 1
3: 17
4: 176
Right 970440960 4:16080910-16080932 CCGCAGCCACCCACCCATCAGGG 0: 1
1: 0
2: 2
3: 17
4: 229
970440954_970440960 3 Left 970440954 4:16080884-16080906 CCACATCCAGGGTCCTGTTCTGG 0: 1
1: 0
2: 1
3: 13
4: 206
Right 970440960 4:16080910-16080932 CCGCAGCCACCCACCCATCAGGG 0: 1
1: 0
2: 2
3: 17
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970440960 Original CRISPR CCGCAGCCACCCACCCATCA GGG Intronic
900663241 1:3796491-3796513 TGGCAGGCACCCACCCACCAGGG + Exonic
901417404 1:9127444-9127466 CCACACCCAGCCAGCCATCACGG + Intronic
901759234 1:11459930-11459952 CCTCAGCCATCCAGCCATCCTGG + Intergenic
905629556 1:39511072-39511094 CCCCAGACACCCACCACTCAAGG - Intronic
905668203 1:39775118-39775140 CCCCAGCCACCCACCACTCAAGG + Intronic
906130072 1:43450675-43450697 CCACAGCCACTGACCCATCCAGG + Exonic
907381845 1:54097090-54097112 CCGAAGCCTCCCACACCTCAGGG + Exonic
907529457 1:55079312-55079334 GCCCAGCCAGCTACCCATCAGGG - Intronic
908295617 1:62709701-62709723 CCTCAGCCCCCCACACAGCAGGG + Intergenic
910379385 1:86609484-86609506 CAGCTGACACCCACCCATGAAGG - Intergenic
910863334 1:91764608-91764630 CCCGAACCACCCACACATCAGGG - Intronic
912680803 1:111727611-111727633 CCTCTGCCACCCTCCCAACAAGG + Exonic
920538640 1:206759951-206759973 CCTCAGCCTCCCACCAATCCTGG - Intergenic
921885292 1:220299049-220299071 CTGCAGGCACCCAGCCATCGTGG - Intergenic
921995743 1:221416175-221416197 CCCCACCCACCCACTCAGCAAGG + Intergenic
922461938 1:225819973-225819995 CCGCAGCCACCAGCTCATCAAGG + Intronic
923084168 1:230689747-230689769 GCACAGCCACCCACCGCTCAGGG - Intronic
923492594 1:234497602-234497624 ACCCACCCACCCACCCTTCAGGG - Intergenic
1062885134 10:1010736-1010758 CCGCCTCCACCCACCCACCCCGG + Intronic
1063703425 10:8407938-8407960 TCACAGGCACCCTCCCATCATGG - Intergenic
1063984105 10:11483129-11483151 CCGCAGCCACCCTTCCATTTCGG + Intronic
1067344416 10:45427505-45427527 CAGAAGCCACCCACCCAGGACGG - Intronic
1069034413 10:63631662-63631684 CCTCAGCCTCCCAACCAGCAAGG + Intergenic
1070170916 10:73932199-73932221 CCGCAGGCACCCAGCCATCCTGG - Intergenic
1075558079 10:123447696-123447718 CCTCAGCCTCCCACTCTTCATGG + Intergenic
1075727676 10:124618849-124618871 CCCCCACCACCCACCCACCAGGG - Intronic
1076401187 10:130186538-130186560 CCGCACCCCACCACCCCTCAAGG - Intergenic
1076622997 10:131804745-131804767 CCGCAGCCTCTCGCCCATCCTGG + Intergenic
1076625852 10:131821572-131821594 CAGCAGCCCCACACCCCTCAGGG + Intergenic
1076810633 10:132884720-132884742 GTGCAGCCACCCGCCCATCGGGG + Intronic
1076810646 10:132884760-132884782 CTGCAGCCACCCGCCCATCGGGG + Intronic
1076869053 10:133183799-133183821 CCGCAGCCACCCACCCGACACGG - Intronic
1077129285 11:962034-962056 TCGCCGCCACCTGCCCATCAGGG + Intronic
1077437233 11:2548835-2548857 CCTCAGACACCCACCCACCTGGG - Intronic
1079386001 11:19980251-19980273 CCGCCTCCACCCACCTATCATGG + Intronic
1081850425 11:46271828-46271850 CCACTGCCACCCACCCTTCTGGG + Intergenic
1083040576 11:59681560-59681582 CCCCAGCCCGCCACCCATAAAGG + Intergenic
1084268382 11:68016561-68016583 CCCCAACCCCTCACCCATCAGGG + Intronic
1084561782 11:69909675-69909697 CAGCAGGCGCCCACCCACCACGG + Intergenic
1085255822 11:75172405-75172427 CACCAGGCACCCACCCATCGGGG - Exonic
1087795580 11:102452510-102452532 CCGCAGCCACTTACCCGCCATGG + Exonic
1087921859 11:103876004-103876026 AAGCAGCCACCAACCCACCAAGG + Intergenic
1088013848 11:105035895-105035917 CATGAGCCACCCACCCATCCTGG + Intergenic
1089610398 11:119665440-119665462 CCGCAGCACTCCACCCATCCTGG + Intronic
1089647919 11:119892312-119892334 CCCCACACACCCACCCACCATGG + Intergenic
1089975766 11:122730233-122730255 CCACAGCCACCAAGCCATCTCGG - Intronic
1093578239 12:20761064-20761086 CCTCAGCCACCCAACCAGCTGGG - Intergenic
1093772790 12:23037085-23037107 CCCCACCCACCCACCCTTCCTGG - Intergenic
1093772807 12:23037137-23037159 CCCCACCCACCCACCCATCCTGG - Intergenic
1093918024 12:24827674-24827696 CCTCAGCCTCCCACACAGCAGGG - Intronic
1095803218 12:46290683-46290705 CCCCACCCACCCATCCAACAGGG - Intergenic
1096017303 12:48288625-48288647 ACGTAGCCACTCCCCCATCAAGG - Intergenic
1098136941 12:67412905-67412927 CCCCAGCCTCCCAACCATCTGGG - Intergenic
1103565865 12:121814926-121814948 CTGCACCCACCCACCCACCTTGG - Exonic
1103593700 12:122010130-122010152 CGGCAGCCACCCTCGCATCCAGG - Intergenic
1104683467 12:130768500-130768522 CCCCTGCAAGCCACCCATCAGGG - Intergenic
1104710092 12:130979647-130979669 CTGCACCCACCGTCCCATCATGG + Intronic
1105236143 13:18555244-18555266 CCGGAGCCACCCAACCTTCCTGG - Intergenic
1106978072 13:35246557-35246579 CTGGATCCAGCCACCCATCAGGG + Intronic
1107830984 13:44373749-44373771 CCGCAGCCACCTACCCCGCGCGG - Intronic
1115869192 14:37780775-37780797 CCCTAGCCTCCCACCCACCATGG + Intronic
1116464323 14:45214122-45214144 CCCCAGCCCCACACCCATAAAGG + Intronic
1118979153 14:70701959-70701981 CCTCAGCCATCCACCCCTCCAGG + Intergenic
1119432559 14:74578051-74578073 CCGCTGCCACCCTCCCCTCTGGG - Intronic
1119687567 14:76644847-76644869 CAGCAGCCTCCGACCCATCCAGG - Intergenic
1121000583 14:90449574-90449596 CAGCAGCCACCCTTACATCAGGG + Intergenic
1121341463 14:93107633-93107655 CCGCATCCCCCCACCCCTCCAGG - Intronic
1121944415 14:98105259-98105281 CAGCAGCCCACCACCCTTCAAGG + Intergenic
1122153622 14:99737752-99737774 CGGCTGTCACCCACCCAGCAGGG - Intronic
1122424986 14:101600760-101600782 AGGCAGCCACCTCCCCATCATGG + Intergenic
1122900157 14:104779092-104779114 CCCCAGCCTCCCACCTAGCAGGG + Intronic
1124966638 15:34437153-34437175 CCGCACCCGCCCGCCCATCGTGG + Intronic
1125346495 15:38723866-38723888 TCCCAGCCAACCACCCATCCAGG - Intergenic
1125610387 15:40965497-40965519 CAGGAGCCACCCACCCAGCCTGG + Intergenic
1125759336 15:42086195-42086217 CCCCACCCACCCACCCACCTGGG + Exonic
1130251705 15:82304234-82304256 CCCAAGCCACCCACCCACCCAGG - Intergenic
1131427848 15:92361458-92361480 CCGCAGCCAGGCACTCATGACGG - Intergenic
1132587510 16:711950-711972 CTGCAGCCACCCAGCCGTCCAGG - Intronic
1132600342 16:770206-770228 CCGCAGCCACCCCACCGTCAGGG - Exonic
1132674266 16:1115157-1115179 CCCCGGCCACCCACACACCAGGG - Intergenic
1133811123 16:9161788-9161810 CCTCAGCCACACACACATTAGGG - Intergenic
1133976161 16:10601202-10601224 CAACACCCACCCACCCATCCTGG - Intergenic
1134050122 16:11131512-11131534 CCACACCCACCAACCCACCAGGG - Intronic
1134194995 16:12152968-12152990 CCCCTGCCATCCATCCATCATGG + Intronic
1136184707 16:28580456-28580478 CGGCAGCCACCCATCCAGCCGGG - Intronic
1138509181 16:57498078-57498100 ACCCACCCACCCACCCACCATGG + Intergenic
1139923906 16:70475281-70475303 ACGCAGGCACCCACCCACCCTGG - Intronic
1140125997 16:72119515-72119537 CCCCAGCCACCTACCCAGCCTGG - Intronic
1140905932 16:79409019-79409041 CCCCACCCACCCACCCCTTATGG - Intergenic
1140914539 16:79482675-79482697 CAGCAGCCACCACCCCATCCTGG - Intergenic
1142153615 16:88523457-88523479 CCGGGGCCACCCGCCCATCCTGG - Intronic
1142378438 16:89718624-89718646 CCGAAGCCTGGCACCCATCAAGG + Intronic
1148090661 17:45020828-45020850 CTGCAGCCCCCCACCCCTGAGGG - Intergenic
1148229626 17:45923484-45923506 CCGGAGCCATCCAGCCCTCAGGG + Intronic
1148778334 17:50108357-50108379 CCTCATTCTCCCACCCATCAAGG + Exonic
1151206012 17:72507528-72507550 AAGCAGCCACTCACCTATCAAGG + Intergenic
1151328562 17:73393578-73393600 CCCCAGCCACCCTCCCATCCTGG - Exonic
1151715961 17:75831192-75831214 CCCCAGGCACCCTCCCACCAGGG + Intronic
1151946127 17:77320933-77320955 CCGCAGGCACAGACCCATCAGGG + Intronic
1152198782 17:78933308-78933330 CCGCAGACAGGCACCCCTCAGGG + Intergenic
1152337298 17:79706200-79706222 CCGCAGCGCCCCACCCCTCGGGG + Intergenic
1152644188 17:81461244-81461266 CCGCCGCCGCCCACCCTTCTCGG - Exonic
1152784384 17:82240391-82240413 CCGCTGGCACCCCCACATCAGGG + Intronic
1152789406 17:82270800-82270822 TCCCAGACAGCCACCCATCAGGG - Intronic
1152911954 17:83010094-83010116 CCGCAGCCCCCCCCACACCAGGG - Intronic
1153220398 18:2855643-2855665 CGTCAGCCACCCACCCAACCTGG - Intronic
1153776799 18:8461683-8461705 CTGCAGCTCCCCACACATCAGGG - Intergenic
1154000315 18:10477071-10477093 ACGCAGCCGCCCACCCACCCAGG - Intronic
1154513399 18:15134754-15134776 CCGGAGCCACCCAACCTTCCTGG + Intergenic
1155248359 18:23932869-23932891 AGGGAGCCTCCCACCCATCAGGG + Intronic
1155341396 18:24817923-24817945 CCGCAGACACCCACACAGCCTGG - Intergenic
1160049795 18:75422097-75422119 CCAAAGCCGCCCACCCAGCAGGG + Intronic
1160766547 19:811177-811199 CTGCAGCCACACACCCACCCGGG + Exonic
1161446897 19:4323646-4323668 CCCCAGGCACCCACCCAGCTGGG + Exonic
1161453034 19:4357300-4357322 CCACAGCCACCCACACAGCCCGG + Exonic
1164548268 19:29186739-29186761 CCGCATCCCTCCACCCCTCAGGG - Intergenic
1165618000 19:37219100-37219122 CTGCAGTCACCCAGCCACCATGG - Intronic
1166267794 19:41695800-41695822 CTGAATCCACCCACCCAGCAAGG - Intronic
1167661601 19:50798876-50798898 GCGCTGCCACCCACCCACCTGGG - Exonic
925333443 2:3076112-3076134 CCCCACCCATCCACCCATCTTGG - Intergenic
927502473 2:23591811-23591833 CCACACCCACCCGCCCCTCAGGG + Intronic
929936543 2:46297843-46297865 CCACAGCCCCCCACCCGCCAGGG + Exonic
934489015 2:94745206-94745228 CCCCAGCCAGACACCCATAAAGG - Intergenic
934962979 2:98694084-98694106 CCCCAGCCACCCACCCACCATGG + Intronic
935373480 2:102371572-102371594 CCAAAGCCACCCTCCCATCCTGG + Intronic
935503771 2:103873539-103873561 CCGCCCCCCCCCCCCCATCAAGG + Intergenic
935720214 2:105973152-105973174 CCCCAGCCACCCCTCCACCAGGG + Intergenic
937091349 2:119208527-119208549 CCACAGTCACCCACCCCTCTAGG + Intergenic
937837970 2:126493044-126493066 CCTCAGCCACCCACGCAGCTGGG - Intergenic
938513644 2:131979365-131979387 CCGGAGCCACCCAACCTTCCTGG + Intergenic
940043806 2:149388451-149388473 CTGCAGGCACCCACCCAAAAGGG - Intronic
940070222 2:149678576-149678598 CCGCTTCCACCCACCCTTCTAGG - Intergenic
945836236 2:214838805-214838827 CCGCACCTGGCCACCCATCATGG + Intergenic
945923116 2:215776489-215776511 ACTCAGCCCCCCATCCATCATGG - Intergenic
947958432 2:234214425-234214447 CCTCAGCCTCCCACCTATCTGGG - Intergenic
948506981 2:238435074-238435096 CCCCACCCACCGACCCAGCAAGG - Intronic
1170857189 20:20068164-20068186 GCGCAGCCACCATCCCCTCAGGG - Intronic
1171256815 20:23694902-23694924 CCCCAGCCCCACACCCATAAAGG - Intergenic
1171472483 20:25383199-25383221 CCTCAGCCACCCACTCTTCTGGG + Intronic
1173834063 20:46113624-46113646 CCACAGTCCACCACCCATCAGGG - Intergenic
1175144630 20:56886263-56886285 CAGCAGCTTCCCACCCCTCAGGG - Intergenic
1175890665 20:62314529-62314551 CCGCATCCACCCAGCCAGCCTGG + Intronic
1176072137 20:63232807-63232829 CCAAAGCCACCCAGCCATCCGGG - Intergenic
1176250443 20:64117853-64117875 GCCCAGACACCCCCCCATCACGG - Intergenic
1176350865 21:5795399-5795421 CCTCACCCACCCCTCCATCAGGG + Intergenic
1176357679 21:5915983-5916005 CCTCACCCACCCCTCCATCAGGG + Intergenic
1176545186 21:8193469-8193491 CCTCACCCACCCCTCCATCAGGG + Intergenic
1176564137 21:8376514-8376536 CCTCACCCACCCCTCCATCAGGG + Intergenic
1176780141 21:13183531-13183553 CCGGAGCCACCCAACCTTCCTGG - Intergenic
1177136153 21:17307122-17307144 CCACACCCAGCCAGCCATCATGG - Intergenic
1178277557 21:31252737-31252759 CCTCACCCACTCACCCAGCACGG + Intronic
1179716711 21:43292193-43292215 CCACACCCACCCACCCACAAGGG + Intergenic
1180148853 21:45937407-45937429 CAACAGTCACCCACCCACCAAGG + Intronic
1180800217 22:18628250-18628272 ACGCAGCCACCCACCCTCCCAGG - Intergenic
1180851450 22:19023814-19023836 ACGCAGCCACCCACCCTCCCAGG - Intergenic
1181221499 22:21367016-21367038 ACGCAGCCACCCACCCTCCCAGG + Intergenic
1182146368 22:27999156-27999178 CCACAGCCACCTGTCCATCACGG + Exonic
1182423960 22:30262486-30262508 CCTCAGCCACACACCCATGGGGG + Intergenic
1183676534 22:39301909-39301931 CCACGCCCACCCACCCATCCAGG + Intergenic
1184309259 22:43630709-43630731 CCGCTGCCTCCCACCCAGCTCGG + Intronic
1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG + Intergenic
1184833684 22:47007667-47007689 CCACAGGCACCCACCCAGGAAGG - Intronic
1203250056 22_KI270733v1_random:109707-109729 CCTCACCCACCCCTCCATCAGGG + Intergenic
950791961 3:15479184-15479206 CTGCAGCAGCCCAGCCATCATGG + Intronic
951425555 3:22540556-22540578 CTGCTCCAACCCACCCATCAGGG - Intergenic
951644152 3:24868571-24868593 CCACACCCACCTTCCCATCATGG - Intergenic
951915191 3:27793194-27793216 GCTCAGCCACCCTCCCACCAGGG - Intergenic
954054988 3:48015270-48015292 CCGCCCCCACCCACCCAAAAAGG - Intronic
954832357 3:53433038-53433060 CTCAAGCCACCCACCCATCTTGG - Intergenic
960952452 3:123008497-123008519 CAGATCCCACCCACCCATCAGGG - Intronic
961472549 3:127125214-127125236 CCACAGCAACCCAGCCATCATGG + Intergenic
961808114 3:129503573-129503595 ACTCACCCACCCACCCATCATGG + Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
962903702 3:139782246-139782268 CAGCAGCCAGCCAGTCATCATGG - Intergenic
968056624 3:195696871-195696893 CCTCAGCCCCCGACCCACCATGG - Intergenic
968772589 4:2517159-2517181 CCTCAGCCACCCAACCAGCTGGG + Intronic
969132584 4:5002701-5002723 CCCCAGCCACCCACCCACCTAGG + Intergenic
969487034 4:7478127-7478149 CCGCAGCAGACCACCCATAACGG + Intronic
969685924 4:8674235-8674257 CGGTGCCCACCCACCCATCAGGG - Intergenic
969723141 4:8904366-8904388 CCGCGGCCACCCCCGCAACAAGG + Intergenic
970440960 4:16080910-16080932 CCGCAGCCACCCACCCATCAGGG + Intronic
973219648 4:47710996-47711018 CAGAAGTCACCCACCCATGAAGG + Intronic
974142714 4:57908337-57908359 CCACACCCACCCTCCCATCCTGG - Intergenic
976483359 4:85570600-85570622 CCTCAGCCACCCACACTTGATGG - Exonic
980791274 4:137622531-137622553 ACCCACCCACCCACCCAACAAGG + Intergenic
981203913 4:142016188-142016210 CAGCAGACACCCACACATGAAGG - Intergenic
985446352 4:190022883-190022905 CTGCACCCACCCACCCCACAAGG - Intergenic
985528631 5:420926-420948 ACGCAGCCACCCACCCACACAGG + Intronic
988062097 5:26184832-26184854 CTGCACCCATCAACCCATCATGG + Intergenic
992668692 5:79037015-79037037 CCACACACACCCACCCACCAAGG + Intronic
996096599 5:119405763-119405785 CCTCAGCCACCCACCCTTCTGGG - Intergenic
997855516 5:137369172-137369194 AGACACCCACCCACCCATCAAGG - Intronic
998407873 5:141883967-141883989 CAGCAGCCCCCAACCCAGCAGGG - Intergenic
1000335808 5:160240534-160240556 CCCCACCCACCCATCCAGCAAGG + Intergenic
1002190677 5:177475854-177475876 CACCAGCCTCCCACCCACCAAGG - Intergenic
1002495293 5:179607516-179607538 ACGCAGCTACCCACTCATCAGGG + Intronic
1003247713 6:4398415-4398437 CTGCAGCAACCCAGGCATCATGG - Intergenic
1003322160 6:5061728-5061750 CCGCAGCCACCCAGAGCTCACGG + Intergenic
1006631993 6:35436538-35436560 CCCCAGCTCCCCAGCCATCATGG + Intergenic
1007424264 6:41736511-41736533 CGCCACCCACCCACCCATGATGG + Intergenic
1008508146 6:52251116-52251138 CCTCAGTCCCCCAACCATCAAGG + Intergenic
1011639926 6:89409308-89409330 CCTCAGCCTCCCACCCACCAGGG + Intronic
1016172912 6:141041711-141041733 CCTTAGCCACCCCCCCACCATGG - Intergenic
1018432072 6:163730452-163730474 CAGCAGCCACGAACCCAACATGG + Intergenic
1019383582 7:740838-740860 CAGCAGCCAGCCGCCCACCACGG - Exonic
1019891205 7:3948635-3948657 CCGCACACATCCATCCATCACGG - Intronic
1021026346 7:15671975-15671997 CCTCAGCCACCCACGCAGCTGGG - Intronic
1021934865 7:25620353-25620375 CCACAGCCAGCCACCCAGGAAGG - Intergenic
1023516305 7:41005362-41005384 CCCCATCCCCCCACCCATGAGGG + Intergenic
1024709225 7:51996299-51996321 CCACAGGCACCCATCCTTCAAGG - Intergenic
1025844358 7:65182877-65182899 CCCCAGCCACCTTCCCATCTGGG - Intergenic
1025894687 7:65689211-65689233 CCCCAGCCACCTTCCCATCTAGG - Intergenic
1026005492 7:66597262-66597284 CCTCAGCCAACCCCTCATCATGG + Intergenic
1031317207 7:120273080-120273102 CCCCAGCCACCCACCAACCCCGG - Intergenic
1031750422 7:125564299-125564321 CCGCTGTCACACACCCAGCAAGG + Intergenic
1032026096 7:128443906-128443928 CCACTGTGACCCACCCATCAGGG - Intergenic
1032425609 7:131820060-131820082 TGGCAGCCAAGCACCCATCAGGG - Intergenic
1033250199 7:139752204-139752226 CCTCAGCCCCCCACCCCACAGGG + Intronic
1034003556 7:147443244-147443266 CCGCTGACACCCACCCATGGAGG - Intronic
1035066135 7:156106196-156106218 CCGGAGCCACCCTCACACCAGGG - Intergenic
1035564822 8:634661-634683 CGGCAGCCCCCCACCCATCGTGG - Intronic
1038614421 8:29079341-29079363 CCGCAGACACTCACACATGACGG + Intronic
1042343332 8:67703278-67703300 CCCCAACAAGCCACCCATCAGGG - Intronic
1044244648 8:89928464-89928486 CCGCCGCCAACCACCCATGCAGG + Intergenic
1044821609 8:96159417-96159439 CCGCAGACACCCACACATGCAGG + Intronic
1044905100 8:96992054-96992076 TTGCTGCCACACACCCATCAAGG - Intronic
1047495679 8:125407022-125407044 CCACTTCCACCCACCCATCCAGG - Intergenic
1047570390 8:126092241-126092263 CTGCAGCCACCCAGGCATAAAGG + Intergenic
1049130665 8:140837611-140837633 CCTCAGCCACCCAAGTATCAGGG - Intronic
1049229496 8:141474696-141474718 CCCCAGCTACCCTCCCTTCAAGG + Intergenic
1053668772 9:40339143-40339165 CCCCAGCCAGACACCCATAAAGG + Intergenic
1053918571 9:42965416-42965438 CCCCAGCCAGACACCCATAAAGG + Intergenic
1054379908 9:64479180-64479202 CCCCAGCCAGACACCCATAAAGG + Intergenic
1054515839 9:66037151-66037173 CCCCAGCCAGACACCCATAAAGG - Intergenic
1057955942 9:99408108-99408130 CAACAGCCAGCTACCCATCAAGG - Intergenic
1060430732 9:123549414-123549436 GCGCACCCTCCCACCCATCAAGG + Intronic
1062422670 9:136490892-136490914 CCGGAGGCACCAACTCATCAGGG - Intergenic
1203466456 Un_GL000220v1:92974-92996 CCTCACCCACCCCTCCATCAGGG + Intergenic
1185455983 X:311180-311202 CCTCAGACACCCACCCAACTCGG - Intronic
1185504133 X:619484-619506 CCCCACCCACCCACCCACCGAGG + Intergenic
1188003667 X:25003388-25003410 CACCATCCACCCACCCATCCTGG + Intergenic
1188360163 X:29243323-29243345 CCGCAGCCACCCACCTTGCTTGG + Intronic
1189855812 X:45223894-45223916 CCGCAACCCCCCACCCACCGGGG - Intergenic
1191887547 X:65904150-65904172 CAGAAGCCACCTACCCATGAGGG + Intergenic
1193779295 X:85683252-85683274 CCAGAGCCACCCACCCTTCCTGG - Intergenic
1193956809 X:87873796-87873818 CCCCTGCAAACCACCCATCAGGG + Intergenic
1198433103 X:136587746-136587768 GTGCAGCCTCCCACCTATCACGG + Intergenic
1200811370 Y:7488768-7488790 CAGGTGCCACCCACCCAACATGG + Intergenic
1201493144 Y:14564666-14564688 CAGCAGCCAACCTCCCAGCATGG + Intronic