ID: 970445653

View in Genome Browser
Species Human (GRCh38)
Location 4:16121345-16121367
Sequence GTCCCCACCCTGAGTTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970445653_970445659 11 Left 970445653 4:16121345-16121367 CCTGCTCAACTCAGGGTGGGGAC No data
Right 970445659 4:16121379-16121401 TACCCATCGGGATCTGGCTGAGG No data
970445653_970445657 5 Left 970445653 4:16121345-16121367 CCTGCTCAACTCAGGGTGGGGAC No data
Right 970445657 4:16121373-16121395 TCCTTTTACCCATCGGGATCTGG No data
970445653_970445655 -2 Left 970445653 4:16121345-16121367 CCTGCTCAACTCAGGGTGGGGAC No data
Right 970445655 4:16121366-16121388 ACATGGTTCCTTTTACCCATCGG No data
970445653_970445656 -1 Left 970445653 4:16121345-16121367 CCTGCTCAACTCAGGGTGGGGAC No data
Right 970445656 4:16121367-16121389 CATGGTTCCTTTTACCCATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970445653 Original CRISPR GTCCCCACCCTGAGTTGAGC AGG (reversed) Intergenic
No off target data available for this crispr