ID: 970448044

View in Genome Browser
Species Human (GRCh38)
Location 4:16140258-16140280
Sequence CAGGGGTTTCAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970448032_970448044 12 Left 970448032 4:16140223-16140245 CCAGAAGCTGGAAAAGGCAAAAT No data
Right 970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970448044 Original CRISPR CAGGGGTTTCAGAGGGAGGC TGG Intergenic
No off target data available for this crispr