ID: 970448553

View in Genome Browser
Species Human (GRCh38)
Location 4:16144640-16144662
Sequence CAAAATATCACACGTGTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970448550_970448553 19 Left 970448550 4:16144598-16144620 CCAATTGCTCTGATTTGATCATT No data
Right 970448553 4:16144640-16144662 CAAAATATCACACGTGTTGCGGG No data
970448551_970448553 -7 Left 970448551 4:16144624-16144646 CCTTTTACACATGTGTCAAAATA No data
Right 970448553 4:16144640-16144662 CAAAATATCACACGTGTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970448553 Original CRISPR CAAAATATCACACGTGTTGC GGG Intergenic
No off target data available for this crispr