ID: 970450989

View in Genome Browser
Species Human (GRCh38)
Location 4:16166263-16166285
Sequence CAGAGAAAACAAAAGCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1559
Summary {0: 1, 1: 2, 2: 10, 3: 131, 4: 1415}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970450989 Original CRISPR CAGAGAAAACAAAAGCAGGA CGG (reversed) Intronic
900008580 1:84584-84606 TACAGAAAACAAAAGCAAAATGG + Intergenic
900036813 1:418595-418617 TACAGAAAACAAAAGCAAAATGG + Intergenic
900058439 1:654334-654356 TACAGAAAACAAAAGCAAAATGG + Intergenic
900221904 1:1513577-1513599 CACAGGAAACAAAAGCCTGATGG - Intronic
900621656 1:3590371-3590393 CAGAGAATCCATGAGCAGGAAGG + Intronic
901551023 1:9996455-9996477 CAGAGAAAAGCAAAGGAGAAGGG - Intergenic
901915225 1:12494284-12494306 CAGAGAATACAAAAGCAGAGTGG - Intronic
902039800 1:13484294-13484316 CAGAGAAAAACAAAGAGGGAAGG - Intronic
902202820 1:14846378-14846400 AAGAGAGAACAAAAAAAGGAAGG + Intronic
902269349 1:15292130-15292152 AAAAGAAAAGAAAAGAAGGAAGG - Intronic
902404775 1:16176612-16176634 TAGAGAAAACAGACACAGGAAGG - Intergenic
902618265 1:17635574-17635596 CAGATGAGACAAAAACAGGATGG - Intronic
902848825 1:19136688-19136710 AATAGAAGACAAAAGCAGGCTGG + Intronic
902927148 1:19703517-19703539 GAAAGAAAAGAAAAGAAGGAGGG - Intronic
902975534 1:20085545-20085567 CAGAGAATCTAAAAGCAGGATGG - Intronic
903076952 1:20777843-20777865 CAGAGAATTCCAAAGGAGGATGG - Intronic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903315324 1:22499283-22499305 GAGAGAAAACACAGGCAAGATGG + Intronic
903606846 1:24581114-24581136 CAAAAAAAAAAAAAGCAGAAAGG - Intronic
903679003 1:25084512-25084534 CATAGAAAACAAAAAGAAGAGGG + Intergenic
903752811 1:25638587-25638609 CTGATAAAACAAAAGCTGCAAGG - Intronic
903866224 1:26400270-26400292 CAGTTGAAACAAAAGCAGGGAGG - Intergenic
903932085 1:26868312-26868334 AAGAGAAAAGAAAAGAAGAAAGG - Intergenic
904482011 1:30799976-30799998 GAGAGAAAAAGAAAGAAGGAGGG + Intergenic
905205968 1:36343006-36343028 CTGAAAAATGAAAAGCAGGAAGG + Intronic
905316812 1:37087495-37087517 CAGAGAAGTCAAATACAGGAGGG - Intergenic
905806158 1:40879102-40879124 AAGAAAAAAGAAAAGAAGGAGGG + Intergenic
905894003 1:41533650-41533672 CAAAGGAGACACAAGCAGGAGGG - Intronic
906230673 1:44160738-44160760 TATAGAAAACAAAAGCAAAAGGG - Intergenic
906366248 1:45212502-45212524 AAGAGAAAAGAAAGGAAGGAAGG + Intronic
906991936 1:50748168-50748190 CAGACAAACCAAAATAAGGAAGG + Intronic
907078292 1:51597702-51597724 CAGAGAAAATGGAAGCAGCAAGG + Intronic
907266192 1:53262942-53262964 CTGAGGAGACAAAAGCAGGGAGG - Intronic
907590204 1:55659458-55659480 CAGAGAAAACAAAAAAAAGTAGG - Intergenic
908116998 1:60950287-60950309 CATAGAAAACCAATGCAGGAAGG - Intronic
908362374 1:63381644-63381666 AAAAGAAAAGAAAAGAAGGAAGG + Intronic
908562755 1:65323582-65323604 AAAAGAAAACAAAGGAAGGAAGG - Intronic
908606440 1:65802248-65802270 CAGTGGAGTCAAAAGCAGGAAGG - Intronic
908964751 1:69746411-69746433 CAGAGAGAACAAAACCAATAAGG - Intronic
909221668 1:72970793-72970815 GAGAGGAAAAAAAAGCATGAGGG - Intergenic
909227996 1:73050120-73050142 CAGAGCAAACAAAATCAGAGTGG + Intergenic
909502339 1:76349043-76349065 GGGAGAAAACAGAAGCAGCATGG - Intronic
909509256 1:76432751-76432773 AAGAGAATACAAAAGTAGGCTGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910054011 1:83009844-83009866 CAGAGAAAGGAAAGGAAGGATGG - Intergenic
910126527 1:83848660-83848682 TACAGAAAAAAAAAGCAAGAAGG - Intergenic
910389328 1:86722160-86722182 CAGAAAAAAAAAAAAAAGGATGG - Intronic
910706109 1:90131447-90131469 CAATGAAAACAAAGGCAGAATGG - Intergenic
910951753 1:92655645-92655667 AACAGAAACCAAAAGCAGGCAGG + Intronic
911412656 1:97529652-97529674 AAGAGAAAAGAAAAAAAGGAAGG - Intronic
911412682 1:97529900-97529922 GAAAGAAAAGAAAAGAAGGAAGG - Intronic
911681706 1:100724068-100724090 AAGAGAAAACAAAACCTGGCTGG + Intronic
911861651 1:102958432-102958454 CAGATAAAACAAAAACTGGATGG - Intronic
912307425 1:108583440-108583462 TAAAAAAAAAAAAAGCAGGAGGG - Intronic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912675080 1:111672138-111672160 AAGGGAAGACAAAACCAGGAAGG - Intronic
912745676 1:112243629-112243651 AAGAGAAAAGAAGAGCATGAAGG + Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913530167 1:119728293-119728315 CAGACAAAACAAAAGCAGGAAGG - Intronic
913940395 1:125098321-125098343 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
913995414 1:143648451-143648473 CAGCGAAAACAAAAGTGAGATGG + Intergenic
914344387 1:146785942-146785964 CAGAGAAGACTGGAGCAGGAAGG - Intergenic
914360857 1:146934741-146934763 CAGCGAAAACAAAAGTGAGATGG - Intergenic
914491728 1:148155896-148155918 CAGCGAAAACAAAAGTGAGATGG + Intergenic
915171141 1:153977896-153977918 CAGAGAAACCAGAAGCTTGACGG - Intergenic
915218855 1:154357991-154358013 GAAAGAAAAGAAAAGCAGCAGGG - Intergenic
915310115 1:155002370-155002392 CAGAGAGAAGGAAAGAAGGAGGG + Intergenic
915367053 1:155322489-155322511 CAGAGAAAACTAAAGCTGAATGG + Exonic
915588148 1:156855871-156855893 TAGAGAAAAATAAAGCAGAAGGG - Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915667347 1:157457125-157457147 CAGCCAGAATAAAAGCAGGAAGG - Intergenic
915940521 1:160115741-160115763 CAGAGAAAGCCAAAGCAACAGGG - Intronic
915968594 1:160335083-160335105 CAGAAAGAAAAAAAGCAGAAAGG + Intronic
916362614 1:163987957-163987979 CAGAAAAAAGAAAAGAGGGATGG + Intergenic
916468361 1:165094840-165094862 CAGAGAAAAAAAGAGTAGGTGGG + Intergenic
916752915 1:167739934-167739956 AATACAAAACAAAAGCAGGGAGG - Intronic
916844825 1:168639201-168639223 GAGAGAAAAAGAAAGAAGGAAGG - Intergenic
917063166 1:171063112-171063134 CAGAGATGAGAAGAGCAGGATGG - Intronic
917068791 1:171126587-171126609 AAGAGAAAACAGAAACAGGTTGG + Intergenic
917382636 1:174430407-174430429 CAGAAAAAACAAAATCATGAGGG - Intronic
917387934 1:174497698-174497720 GAGAGAAAATAAAAACAGCAAGG - Intronic
917599151 1:176557720-176557742 CAGAGAAAAGGAAACCAGGCAGG - Intronic
917605836 1:176628201-176628223 TAGAGAAAGCAAGGGCAGGAGGG + Intronic
917753514 1:178076273-178076295 CAGAAACAAATAAAGCAGGATGG - Intergenic
917816260 1:178713092-178713114 GAAAGAAAAGAAAGGCAGGAAGG + Intergenic
918216653 1:182397556-182397578 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
918362694 1:183775011-183775033 ATGAGAAAACAAAGTCAGGAGGG - Intronic
918513854 1:185340659-185340681 AAGAGAACAGAAAAGCAAGACGG - Intergenic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
919013742 1:192000744-192000766 GAAAGAAAAAAAAAGAAGGAAGG + Intergenic
919237750 1:194868216-194868238 CAGAGAAAAAAAAAAAAGGAAGG + Intergenic
919430890 1:197489835-197489857 AATAGAAACCAAAAGCAGGCAGG + Intergenic
919485581 1:198143113-198143135 CAAAAATGACAAAAGCAGGAGGG - Intergenic
919813075 1:201421152-201421174 CAAAGAACACAGAAGCAAGATGG + Intronic
919846033 1:201642746-201642768 AAAAGAAAAGAAAAGAAGGAGGG - Intronic
919942171 1:202295790-202295812 CAGAGAGAAGCAAAGCAGAAGGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920228004 1:204451819-204451841 CAGAGAAACCAAAACCAAGAGGG + Intronic
920612989 1:207459985-207460007 CAGAAATAGCAAAAGCAGAAGGG - Intronic
920911047 1:210216916-210216938 CAAAAAAAAAAAAAGAAGGAAGG + Intergenic
920948946 1:210554913-210554935 AAGAGAAAACACCAGCAGGATGG - Intronic
921285043 1:213601932-213601954 AAGAGAAAAGAAAAGAAGGAAGG - Intergenic
921394183 1:214650942-214650964 AACAAAAAACAAAAGAAGGAAGG + Intronic
921562179 1:216672012-216672034 AAAAGAAAAGAAAAGAAGGAAGG + Intronic
921679670 1:218015598-218015620 GAAAAAAAACAAAAGCATGAAGG - Intergenic
921813271 1:219538364-219538386 AAGAGAAAAAGAAAGAAGGAGGG - Intergenic
922592272 1:226786258-226786280 AAAAGAGAACAAAAGCATGAAGG - Intergenic
922693521 1:227713488-227713510 CAGAGAAAAGAAGAGCAGTGTGG + Intergenic
922789479 1:228303278-228303300 GGAAGAAAACAGAAGCAGGAAGG - Intronic
923182547 1:231533969-231533991 TAGAGAGAAAAAAAGCTGGAAGG - Intronic
923353872 1:233134552-233134574 AAGAAAAAAGGAAAGCAGGAAGG + Intronic
923922013 1:238577499-238577521 CAGAGAACACAGAAGCAGCTGGG + Intergenic
924138213 1:240993204-240993226 GAGAGAAAAGAAAGGAAGGAAGG + Intronic
924160010 1:241221145-241221167 AAAAGAAAACAAAAGAAGGAAGG + Intronic
924472370 1:244353801-244353823 CTGAGAAAACAGAAGCAACAGGG + Intronic
924637619 1:245803703-245803725 TAGAGTTAACAAAAGCTGGAAGG + Intronic
924877870 1:248125587-248125609 AAGAGAAAAGAAAGGAAGGAAGG - Intergenic
1063056864 10:2514635-2514657 CAAAGAAAACAAAAGCTGGAAGG + Intergenic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1063246475 10:4225038-4225060 AAGAGAAAATAAAAGGAAGAGGG + Intergenic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1063625142 10:7682120-7682142 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1063646622 10:7890193-7890215 CACAGAAAAGAAAGGCAGGCAGG - Intronic
1064339910 10:14476617-14476639 TAGAGAAAATAAAAGCAGTAAGG + Intergenic
1064555531 10:16543500-16543522 TGAAGAAAACAAAAGCAGGGAGG + Intergenic
1064783829 10:18872022-18872044 AAAAAAAGACAAAAGCAGGAAGG + Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1064920016 10:20505777-20505799 CATAGAAATTAAAAGGAGGATGG + Intergenic
1065163926 10:22954732-22954754 TAGAGAAAACAAATTGAGGAGGG - Intronic
1065334944 10:24647476-24647498 AAGACAAAAGAAAAGTAGGAGGG + Intronic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065667680 10:28080129-28080151 AAGAGAAAAGAAAAGAAGGAAGG + Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1065881126 10:30038743-30038765 GAGAGAAGAGAGAAGCAGGATGG + Intronic
1065933426 10:30499738-30499760 AAGAGAGAGCAAAAGAAGGAAGG + Intergenic
1066064274 10:31750737-31750759 CAGAGAAGAGAAAAGCAGATGGG - Intergenic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066279469 10:33901250-33901272 CAGAGAAACAAATTGCAGGAAGG - Intergenic
1066286459 10:33971205-33971227 GAGAGAAAACCAAAGGAGCATGG - Intergenic
1066379285 10:34887658-34887680 CAGAAATAGCAAAAGCAGGCAGG - Intergenic
1066400950 10:35075214-35075236 CTGACAAACCAATAGCAGGAAGG + Intronic
1066409216 10:35149739-35149761 AAGAGGAAAGAAAAGCAGGCTGG - Intronic
1066951464 10:42122108-42122130 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1067165203 10:43860878-43860900 CACAGAAAGCAAAAGCATAATGG - Intergenic
1067373431 10:45705717-45705739 TTGAGAAAACAGAAGCAGAAAGG + Intergenic
1067380262 10:45766497-45766519 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1067436211 10:46280642-46280664 CACAGAAAACAAAAATAGGTGGG - Intergenic
1067887963 10:50107151-50107173 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1067970735 10:50967577-50967599 CAGAGAAATCAAAGGCAGAGTGG + Intergenic
1068156962 10:53212306-53212328 CAAAGAAAAAAAAATCAAGAGGG - Intergenic
1068343261 10:55736995-55737017 CAGAGAAAGCAAGAGCAGAAGGG + Intergenic
1068421929 10:56805529-56805551 GAGAGAATCCCAAAGCAGGAGGG + Intergenic
1068422336 10:56810818-56810840 CAGAGAGAATAACAGCAGTATGG - Intergenic
1068423572 10:56825986-56826008 CATGGAAAACAAAAGCAAGCAGG + Intergenic
1068626385 10:59253050-59253072 TTGAGGAAACAAAAACAGGAAGG + Intronic
1068735358 10:60408181-60408203 CAGAGAAATCATAAGCAGTCAGG - Intronic
1068957586 10:62832988-62833010 GAGACAAAACAAAAGCAAAAAGG + Intronic
1069043194 10:63716111-63716133 TTGAGAAAACAAAAGCAGGAAGG + Intergenic
1069221276 10:65886615-65886637 CAAACAAACCAAAAGCAGGCAGG - Intergenic
1069286883 10:66725989-66726011 CAGGAAAAACAAAAGCGGTATGG + Intronic
1069327168 10:67245330-67245352 CAGAGAAAATAAAGCAAGGAAGG - Intronic
1069384270 10:67870284-67870306 CAAACAAAACAAAACCAGGCCGG + Intergenic
1070092414 10:73301050-73301072 TAGAGAAAAATAATGCAGGAAGG + Intronic
1070270359 10:74948140-74948162 CAGGGAAAACAAAAGAAGTCAGG + Intronic
1070616051 10:77969989-77970011 CTCAGAAAAGAGAAGCAGGATGG - Intronic
1071190938 10:83099866-83099888 AAAAGAAAACAAAAGCTGGCCGG + Intergenic
1071204698 10:83260556-83260578 CAGAGATAAGAAAAAAAGGAGGG - Intergenic
1071372140 10:84963009-84963031 TAGAAAAAACAAAAGGGGGAAGG - Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071492305 10:86144202-86144224 CAAAGAAAATAAATGCTGGATGG + Intronic
1071848041 10:89540021-89540043 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1072144604 10:92623346-92623368 CAGAGAAAACAAGGGGAAGAAGG + Intronic
1072197483 10:93128796-93128818 GAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1072560549 10:96569687-96569709 AAAAGAAAACCAAAGAAGGATGG + Intronic
1072828172 10:98629493-98629515 CAAAAAACACAAAAGAAGGATGG - Intronic
1072866079 10:99063330-99063352 CACAGAAAAAAAAAACAGCAAGG + Intronic
1073433083 10:103499477-103499499 AAAAGAAAAGAAAAGAAGGAAGG - Intronic
1073491732 10:103856900-103856922 CAAAGAAAAAAAAAGATGGATGG + Intergenic
1073734891 10:106334704-106334726 CAAGGAAAACAACAGCAGGAAGG + Intergenic
1073929086 10:108553883-108553905 CAATTAAACCAAAAGCAGGAAGG + Intergenic
1074099709 10:110345189-110345211 CAGGAAAAACAAAACCACGAAGG + Intergenic
1074165891 10:110872762-110872784 CAGAGAAAACAAAGCCGGGAAGG + Intronic
1074284049 10:112081148-112081170 AAGAGAAAAGGAAAGGAGGAAGG + Intergenic
1074296374 10:112193148-112193170 CAGAGAAGACAAAAGTAGAAGGG + Intronic
1074626511 10:115194507-115194529 CAAACAAAAAAAAAGCAAGAAGG - Intronic
1074731564 10:116382808-116382830 CCAAGAAAAAAAAAGCAGGCAGG - Intergenic
1074758626 10:116647182-116647204 CAAAGAAAATAAAAGCAAAAAGG - Intergenic
1074879301 10:117641206-117641228 CAAAAAAAAGAAAAGAAGGAAGG - Intergenic
1074880156 10:117650399-117650421 GAGAAAAAACAACAGCAGTAAGG - Intergenic
1075105970 10:119540253-119540275 CAAAGAAAAGGAAAGAAGGAAGG - Intronic
1075129225 10:119724752-119724774 GAGAGGGTACAAAAGCAGGAAGG - Intergenic
1075192737 10:120325891-120325913 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1075192782 10:120326326-120326348 CAGAGAGTAGAAAAGAAGGAAGG - Intergenic
1075353220 10:121745015-121745037 CAGCCAAAACAAAAGCTAGAAGG + Intronic
1075786307 10:125052511-125052533 CAGACAACACAAAGGCAGGACGG - Intronic
1075830108 10:125401866-125401888 CACAGACAACCAAAGCAGAATGG - Intergenic
1075948941 10:126460865-126460887 CAGAGAAATAAAAATTAGGAAGG - Intronic
1075969661 10:126641776-126641798 AGGAGAAAACAAATGTAGGAAGG - Intronic
1076196358 10:128521149-128521171 AAGAGAAAAGAAAGGAAGGAAGG - Intergenic
1076226773 10:128783121-128783143 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1076371096 10:129954414-129954436 CAGAGAAAAAAAAAGGGGGGGGG - Intronic
1076581882 10:131517357-131517379 CAGAGGCAACAAAGGCAGCAGGG - Intergenic
1076676053 10:132148369-132148391 AAAACAAAACAAAAGCACGACGG + Intronic
1077087056 11:758516-758538 AAGAGAAAAAAAAAGATGGAGGG + Intronic
1077182107 11:1221376-1221398 CACAGAGGACAAAGGCAGGAGGG - Intergenic
1077930365 11:6725058-6725080 CCCAAAAAACAAAAACAGGATGG + Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078732990 11:13992849-13992871 GAGAGCAAGCCAAAGCAGGATGG - Intronic
1078941419 11:16010602-16010624 AAGAGAAAAAAGAAACAGGATGG + Intronic
1078953535 11:16163544-16163566 CAGGAAAAACAAAATCTGGAGGG + Intronic
1079597493 11:22269055-22269077 GAGAGAAAAGGAAAGAAGGAGGG + Intronic
1079796055 11:24804754-24804776 AAGAGAAAGCAGAAGCAAGAGGG - Intronic
1079911364 11:26314585-26314607 CAAAGAAAGAAAAAGAAGGAGGG - Intronic
1080169609 11:29283905-29283927 CAGAGAAAACAACACCTGCATGG + Intergenic
1080257672 11:30309456-30309478 CTGAGAAAAAGAAAGAAGGAAGG - Intergenic
1080285982 11:30612738-30612760 AAGAGGAAACAAAAGAAAGAAGG - Intergenic
1080454825 11:32408550-32408572 AAGAAAAAAGAAAAGAAGGAAGG + Intronic
1081117402 11:39220861-39220883 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1081261515 11:40967146-40967168 AAGAGAAAAGGAAAGAAGGAAGG + Intronic
1081494818 11:43597935-43597957 TACAAAAAAGAAAAGCAGGAGGG - Intronic
1081947830 11:47014269-47014291 AAGAGAAAAGAAAGGAAGGAGGG + Intronic
1081996959 11:47371911-47371933 CAGAAAATGCAAAAGCAGAAAGG - Intronic
1082218855 11:49608222-49608244 GAGAGAAAACAAAAGCAATGAGG + Intergenic
1082611995 11:55311181-55311203 CAGAGAAGACTAAGGAAGGAGGG - Intergenic
1082628372 11:55511826-55511848 GAGAGAAGAAAGAAGCAGGAAGG - Intergenic
1082679213 11:56148078-56148100 CAGACAAAGCAAAAGCAGACAGG - Intergenic
1082897939 11:58213013-58213035 AAGAGAAAACACATGCAGAAGGG - Intergenic
1082906735 11:58315879-58315901 CAGATTAAACAAAGGCAGAAAGG + Intergenic
1083027421 11:59562397-59562419 CAGAGAAATCACTAGAAGGAAGG + Intergenic
1083097639 11:60267812-60267834 TACAGACAAGAAAAGCAGGAAGG + Intergenic
1083159306 11:60844990-60845012 CAAAGAAAAATAAACCAGGATGG + Intronic
1083373399 11:62200304-62200326 GAGAGAAAAGAAAAGAAGGTTGG + Intergenic
1083438297 11:62658516-62658538 CAGAGAGAACAAAACTATGAAGG + Intronic
1083576420 11:63795139-63795161 CAAAGAAAAAAAAAAAAGGAAGG - Intergenic
1084026994 11:66456859-66456881 CAAAAAAAAGAAAAGCAGAAGGG + Intronic
1084105716 11:66978968-66978990 CAGCGAAAACAGAAGCTGCAAGG - Intergenic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1084907949 11:72363164-72363186 AAGAGAAAGTAAAAGAAGGAAGG + Intronic
1085130585 11:74034740-74034762 CACAGAAAATAGAAGCAGCAAGG + Intronic
1085550679 11:77368031-77368053 AAGAGATAACAAAAGAAGCAAGG + Intronic
1085783189 11:79428034-79428056 GGGAGAAAGCAGAAGCAGGAAGG + Intronic
1085835809 11:79955454-79955476 AACAGAAAACAAATACAGGATGG - Intergenic
1086096974 11:83060206-83060228 CATAAAAAAAAAAAGCAGGGCGG + Intronic
1086307172 11:85493837-85493859 GAGAGAAAAGAAAAGAAGAAAGG + Intronic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1086381772 11:86262176-86262198 TAAAGAAAAAAAAAGCAGGCTGG - Intronic
1086493751 11:87381606-87381628 TAGATAAAACAACAGCAGTAGGG - Intergenic
1086549873 11:88043348-88043370 TGAAGAAAACAAAGGCAGGATGG + Intergenic
1086607687 11:88715996-88716018 CATAGAATTCAAAAGCTGGAAGG - Intronic
1086878130 11:92122271-92122293 CAGAGAAAGCCAAAGCACAAAGG + Intergenic
1086983561 11:93224833-93224855 AAAAGAAAAGAAAAGCAGTATGG + Intergenic
1086990271 11:93295208-93295230 CAGACAAAACAAAAACAGGCCGG - Intergenic
1087282721 11:96229848-96229870 GACAGATATCAAAAGCAGGAAGG + Intronic
1087570322 11:99919066-99919088 CACACCAAACAAAGGCAGGAAGG - Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087995571 11:104803475-104803497 CAGAGAAAATAAAAGCAAGAAGG + Intergenic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1088121021 11:106369575-106369597 AAGAGAAAAAAAAATCACGAAGG - Intergenic
1088381739 11:109200610-109200632 CATAGAAAACCAAAGCAACATGG - Intergenic
1088450333 11:109974835-109974857 CAGAGAAACAAAAAGCGGGGAGG - Intergenic
1088510199 11:110565908-110565930 CAGACAAAACAACTGCCGGATGG - Intergenic
1088604756 11:111517871-111517893 TGGGGAAAAAAAAAGCAGGAGGG - Intronic
1088668070 11:112114486-112114508 CGGAGAAAAAAAAATCAGCATGG + Intronic
1089075271 11:115733627-115733649 AAGAGAAGACAAAAGCAAGATGG - Intergenic
1089350753 11:117820373-117820395 CTGAGAAGACAAAGGCAGGATGG + Intronic
1089351960 11:117826502-117826524 CAGAAAAAACGAGGGCAGGAAGG + Intronic
1089558529 11:119330528-119330550 GAGAGAAAAAAAAAGAAAGAAGG - Intergenic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1091541068 12:1463129-1463151 CCGAGAAAACAAATGGAGAAAGG - Intronic
1091662521 12:2395185-2395207 TAGAGAAAAGAAAAGAAGGCTGG - Intronic
1091790164 12:3267639-3267661 AAAACAAAACAAATGCAGGAAGG + Intronic
1091958108 12:4665276-4665298 CATAGAAACCAAAAGCAGAATGG - Intronic
1092001466 12:5036034-5036056 AAGAAAAAAGAAAAGAAGGAGGG + Intergenic
1092062818 12:5564878-5564900 CAGGGAATACAAAAGCCTGAGGG + Intronic
1092555122 12:9550888-9550910 CAGAGAAAAACAGAGCAGAATGG - Intergenic
1092887755 12:12940194-12940216 CACAGAAACCAAAAGTAGAATGG + Intergenic
1092891424 12:12972735-12972757 CAGAGAATAAAAAAGGAAGAAGG - Intergenic
1093255899 12:16867801-16867823 CAGAGAAAACAGCACCTGGATGG - Intergenic
1093375115 12:18416257-18416279 AAAAGAAAAGAAAAGAAGGAAGG + Intronic
1093859441 12:24145296-24145318 AATAGAAAACAAATGCAAGATGG + Intergenic
1094516974 12:31139786-31139808 CAGAGAAAAAGAGAGCAGAATGG + Intergenic
1094541211 12:31364567-31364589 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1094617569 12:32049585-32049607 CAGAGAGAACAAGAACAGAAAGG + Intergenic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095177467 12:39109965-39109987 GAGAAAAATCAAAAGAAGGATGG - Intergenic
1095321746 12:40837293-40837315 CAAAAACACCAAAAGCAGGAAGG + Intronic
1095510685 12:42948765-42948787 CAGAGAAAAGACAAGCATCAAGG - Intergenic
1095877268 12:47094703-47094725 CAAAAAGAACAAAATCAGGAGGG - Intronic
1095995587 12:48081005-48081027 CAGAGGAGGCAAAAGAAGGAAGG + Intronic
1096080419 12:48828941-48828963 CAGACAGAACAGAAGCCGGAGGG - Exonic
1096213050 12:49781098-49781120 AAGAGAAAAAGAAAGAAGGAAGG - Intergenic
1096235157 12:49921404-49921426 CAGAGAAAAAGAAAGAAGAAAGG + Intergenic
1096619458 12:52853888-52853910 CACAGAAACCAAGAGGAGGAAGG + Intergenic
1096704653 12:53411529-53411551 CTGAGAAGAGAAATGCAGGAAGG - Exonic
1096736520 12:53659701-53659723 CCCCGAAAACAAAAGCAAGAGGG + Intronic
1097005390 12:55913036-55913058 CAGAGGAAGCAAAAGCAAAAAGG - Intronic
1097146947 12:56948338-56948360 CAAGGAAGAGAAAAGCAGGAAGG - Intergenic
1097576429 12:61399146-61399168 TAGTGAAAGCAAGAGCAGGAAGG + Intergenic
1097709966 12:62907464-62907486 CAGAGAACCCAAAGGCAGCATGG - Intronic
1097731923 12:63138117-63138139 GAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1097802601 12:63931266-63931288 CAGAGAAAAGAAGAACAGCAGGG - Intronic
1097866150 12:64560663-64560685 CTGAGAAAACAAGAGTAAGATGG - Intergenic
1098138451 12:67427729-67427751 TGGAGAAACCAAAAGCAGCAAGG - Intergenic
1098193824 12:67978385-67978407 AAGAGAAAACAAAAGGAGTCAGG - Intergenic
1098976870 12:76911967-76911989 CAAAGGAAACAAAAGCTGAAGGG - Intergenic
1099224169 12:79949346-79949368 TAGAGAAAATTAAAGCAGGGAGG - Intergenic
1099675833 12:85759490-85759512 AAGAGAAAAGAAAAGGAAGAGGG + Intergenic
1100081410 12:90855691-90855713 CAGACAACAAAAAAGAAGGAAGG + Intergenic
1100556145 12:95695918-95695940 AAGAGAAAAGAAAAGAGGGAGGG - Intronic
1100567439 12:95811214-95811236 AAAAGAAAAAAAAAGCTGGATGG + Intronic
1100787206 12:98090959-98090981 CAGTCAAAACAAAAGCAGACTGG - Intergenic
1101629551 12:106479791-106479813 AAAAGAAAAGAAAAGAAGGAAGG - Intronic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102382902 12:112482852-112482874 CAGACACCACAAAAGCTGGAAGG + Intronic
1102422672 12:112816334-112816356 CATAGAAAACACAGGCAGGCTGG + Intronic
1102833605 12:116031746-116031768 AAAAGAAAAGAAAAGAAGGAAGG + Intronic
1102854795 12:116284187-116284209 CAGGGAAAGCAAATGCAGGCTGG - Intergenic
1102929058 12:116848796-116848818 CAAACAAACAAAAAGCAGGAGGG - Intronic
1103007885 12:117436279-117436301 CACAGAAAACAAAAGGAGACCGG - Intronic
1103533266 12:121617332-121617354 CTGTGAAAAAAAAAGAAGGAAGG + Intergenic
1103710939 12:122912192-122912214 CAGAAAAAGGAAAAGCAAGAGGG - Intergenic
1103768382 12:123299886-123299908 CTGTGAAAAGAAAAGAAGGAGGG + Intronic
1104006147 12:124893940-124893962 AAGAAAAAGAAAAAGCAGGAAGG + Intergenic
1104051223 12:125195139-125195161 CGGAGAAGACAAAGGCAGGAAGG - Intronic
1104085917 12:125474142-125474164 AAGAGAAAAAGAAGGCAGGAAGG - Intronic
1104197522 12:126555172-126555194 CAGAGCAAACAAAGATAGGAAGG + Intergenic
1104223555 12:126809956-126809978 AAAAGAAAAGTAAAGCAGGAAGG + Intergenic
1104258804 12:127163954-127163976 CACAGAAAACCAGAGCACGAAGG + Intergenic
1104511421 12:129382911-129382933 AACAGAAAACACAAACAGGAAGG - Intronic
1104704802 12:130935032-130935054 CCTACAAAACAAAAGAAGGAAGG - Intergenic
1104873376 12:132016349-132016371 AAAAGAAAAAAAAAGCAGGAGGG - Intronic
1105298553 13:19112807-19112829 CAAAAAAAACAAAAACACGAAGG + Intergenic
1105579165 13:21677319-21677341 AAGAGCAAAGAAAAGAAGGAAGG - Intronic
1105680201 13:22718150-22718172 CAGAGAAAACGGAAGCGAGATGG + Intergenic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106778229 13:33028735-33028757 CAAAGAAAACAAAAATAAGAAGG + Intronic
1106906538 13:34415426-34415448 CAGAGAAAAGAAAGGTTGGAGGG + Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107222410 13:38000630-38000652 CAGTCAAAACAAAAGCAGACTGG + Intergenic
1107275888 13:38678746-38678768 CAGAGCAAACAAAATTATGAGGG + Intergenic
1107601560 13:42018529-42018551 CAAAGAAAACAAAAACAAAATGG + Intergenic
1108022461 13:46142131-46142153 CTGAAAAAAAAAAAGCAGAAAGG + Intronic
1108067053 13:46588897-46588919 TAGAGAAAGCAAATGCAGGCTGG - Intronic
1108979205 13:56489414-56489436 CAGAAAAAAAAAAAGGAGAAAGG - Intergenic
1109178303 13:59182448-59182470 CAGAGGAAAAAAAAGCATGAAGG - Intergenic
1109421275 13:62115607-62115629 GGGGGAAACCAAAAGCAGGATGG - Intergenic
1109588457 13:64442973-64442995 GAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1109995944 13:70126054-70126076 AAGATAAAATAAAACCAGGAAGG - Intergenic
1110011308 13:70337706-70337728 CAAAGAAAACCAAAGCTAGACGG + Intergenic
1110063114 13:71066746-71066768 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1110345743 13:74445906-74445928 CAGCCAGAACAACAGCAGGAAGG + Intergenic
1110369784 13:74727196-74727218 AAGAGAAAAGAAAAGAAAGAAGG + Intergenic
1110500305 13:76219655-76219677 CAGTTAAGACAAAAGCAGTAGGG - Intergenic
1110621157 13:77597304-77597326 CAGAAAAAACAAATGCTGCAAGG + Intronic
1110769745 13:79327763-79327785 TAAAGAAACCATAAGCAGGAAGG + Intronic
1110944015 13:81390265-81390287 CTGAGAAAACCACAGCAGCAAGG + Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1111260788 13:85737517-85737539 CTTAGAAAAGAAAAGCATGATGG - Intergenic
1111342610 13:86907463-86907485 CAGAGAAGACATCAGCAGGCAGG - Intergenic
1111373274 13:87345779-87345801 CAGAGAAAAGAAAACCAGTTTGG + Intergenic
1111592405 13:90367185-90367207 CAGAGAAAAGAAAAGAAGAGGGG + Intergenic
1111814396 13:93132448-93132470 CAGAGAAAAGCAAGGAAGGATGG - Intergenic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1111927592 13:94479696-94479718 CAGAGAGAATAAAAGCAGCACGG - Intergenic
1111931567 13:94518063-94518085 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1112019679 13:95360882-95360904 GAAAGAAAAGAAAAGCAAGATGG - Intergenic
1112157553 13:96834027-96834049 AAGAGAAAAAAATATCAGGAAGG + Exonic
1112584507 13:100706288-100706310 GAGAGGAAAGAAAAGAAGGAAGG - Intergenic
1112607186 13:100918203-100918225 CAGAGTAAACCCAAGCAGAAGGG + Intergenic
1112672170 13:101653100-101653122 CAAAGAAAGAAAAAGAAGGAAGG + Intronic
1112748550 13:102555109-102555131 GAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1113140745 13:107146527-107146549 CAGCTAAGATAAAAGCAGGAAGG + Intergenic
1113164261 13:107420238-107420260 AAGACAAAACAAAAAGAGGAAGG + Intronic
1113375185 13:109758910-109758932 GAAAGAAAAAAAAAGAAGGAGGG + Intronic
1113510313 13:110849088-110849110 CACAGAAATTAAAAGCTGGATGG + Intergenic
1114128583 14:19761190-19761212 AAAAGAAAACAAAAGAAGGAAGG - Intronic
1114151505 14:20045451-20045473 CAGAAAAAAAAAAAACTGGAGGG - Intergenic
1114263176 14:21053869-21053891 CATAGAATATCAAAGCAGGAAGG - Intronic
1114756650 14:25267538-25267560 CAGAGAAAAAAAAAGTATTAAGG - Intergenic
1115433036 14:33343283-33343305 GAGAAAAAAAGAAAGCAGGAGGG - Intronic
1115446350 14:33494848-33494870 CAGAAAAGACAAAAACAGAAGGG + Intronic
1115558911 14:34565442-34565464 CACAGACTACAAAAGCAGGTGGG + Intronic
1115650353 14:35398668-35398690 AAAAGAAAAGAAAAGCAGGGAGG + Intergenic
1116133289 14:40889145-40889167 CACAGAAAAAAGAAGAAGGAAGG + Intergenic
1116230065 14:42204658-42204680 CAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1116415995 14:44677632-44677654 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1116677162 14:47920365-47920387 GACAGCAAAGAAAAGCAGGATGG - Intergenic
1116729368 14:48602843-48602865 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1116803848 14:49471796-49471818 CAGAAAGAAAAAAAGCAGGGTGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116950748 14:50876452-50876474 CTGAGAATACAGGAGCAGGAAGG + Intronic
1117689177 14:58287771-58287793 CAGTCAAAGCAAAAGCAGGCTGG - Intronic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1118615150 14:67569928-67569950 CAGGGGAAACAAGGGCAGGAGGG - Exonic
1118680108 14:68232373-68232395 AAAAGAAAAGAAAAGCAAGATGG + Intronic
1118766813 14:68915415-68915437 TGGAGAAAACCAAAGCAGGGAGG - Intronic
1118896141 14:69947156-69947178 CAAAGAAAAGAAAAGAAAGAGGG - Intronic
1119692191 14:76683178-76683200 CAGAGGATAGAAAAGCAGCAAGG - Intergenic
1120035409 14:79691341-79691363 AAGAGAAAGAGAAAGCAGGAGGG + Intronic
1120124191 14:80720925-80720947 CAGAGAAAACCTAAGTATGAAGG + Intronic
1120282992 14:82463269-82463291 GAGAAAGAAGAAAAGCAGGAAGG + Intergenic
1120402837 14:84054414-84054436 CAGAGAAAAGCAAGGCAAGAAGG + Intergenic
1120724387 14:87921675-87921697 CAGAGAAAACAGAACCAACAGGG + Intronic
1120986736 14:90341797-90341819 GAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1121401296 14:93679949-93679971 CATAGAAAACAAAGACAGAAAGG + Intronic
1121599474 14:95192340-95192362 CCTATAAAATAAAAGCAGGAAGG - Intronic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121748044 14:96318206-96318228 CAAAGAACAGAAAAGGAGGACGG + Intronic
1122172640 14:99889509-99889531 TAGAGAAAAATAAAGCAGGAGGG + Intronic
1122319133 14:100843198-100843220 CGGAGAAATCAGAAGCAGGAAGG - Intergenic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122430829 14:101641560-101641582 CAGAGATAAAAGTAGCAGGAAGG + Intergenic
1122516167 14:102310299-102310321 GAAAGAAAACAAAAGAAGGCTGG + Intergenic
1122907600 14:104808913-104808935 TAGTGAAAACAAAACCAGGAGGG - Intergenic
1123022788 14:105409759-105409781 GAGAGAAAGAAAAAGAAGGAAGG - Intronic
1123395712 15:19933160-19933182 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1123435157 15:20248952-20248974 CAAAGAAAAAAAAAGCTTGAGGG - Intergenic
1123571523 15:21615434-21615456 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1123608142 15:22058025-22058047 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1123839727 15:24235973-24235995 CAGAGAATCCCACAGCAGGAAGG + Intergenic
1123849592 15:24341595-24341617 CAGAGAATCCCAGAGCAGGAAGG + Intergenic
1123951349 15:25279934-25279956 CATAGAATAGAAAAGCATGAAGG - Intergenic
1124186212 15:27531615-27531637 CAGATGAAACCAAAGCAGAAAGG + Intronic
1124208663 15:27744306-27744328 TAAAGCAAGCAAAAGCAGGATGG + Intergenic
1124849852 15:33325773-33325795 AAGAGAAAAGAAAAGAAAGAAGG - Intronic
1125145243 15:36459930-36459952 AAAAGAAAACAAAAGGAGGCTGG + Intergenic
1125457664 15:39877240-39877262 CAGAAAACACAAAAACAAGATGG + Intronic
1125810071 15:42531619-42531641 CAGAAAACAAAAAAGAAGGAGGG - Exonic
1125848341 15:42880015-42880037 AAAAGAAAAGAAAAACAGGATGG + Intronic
1126033550 15:44524278-44524300 CAAAGATAAGAAAAGCAAGACGG - Exonic
1126187367 15:45843372-45843394 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1126402823 15:48292117-48292139 CATAGAAAACAAGAACAGGAAGG - Intronic
1126492016 15:49247447-49247469 GAGAAAAAAGAAAAGAAGGAAGG + Intronic
1126547354 15:49887661-49887683 CAGAAAAAAAAAAAACAGGGAGG + Intronic
1126867409 15:52951343-52951365 GAGTGGAAACAAAAGCTGGATGG + Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127047921 15:55046970-55046992 AACAAAAAAGAAAAGCAGGAAGG + Intergenic
1127184413 15:56463485-56463507 CATAAAAAATAAAAGCAGGCTGG + Intronic
1127399492 15:58572313-58572335 GGGAGAAAAGAAAAGGAGGAAGG - Intergenic
1127608063 15:60609907-60609929 CAATGAAAACAGAAGCAGGGAGG + Intronic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1127704250 15:61531393-61531415 CAGAGGTAGCAAATGCAGGAAGG - Intergenic
1127976790 15:64003587-64003609 TAAAGAAAAGAAAAGAAGGAAGG - Intronic
1128090230 15:64914280-64914302 AAAAGAAAACAAAAACAGGCTGG - Intronic
1128404465 15:67321426-67321448 GAAAGAAAAGAAAAGAAGGAAGG - Intronic
1128659866 15:69490976-69490998 CGGAGAAAACAAAAGAATAAGGG + Intergenic
1128960893 15:72003398-72003420 CAAAGAACTCAAAAGCAGGCCGG + Intronic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129423346 15:75447831-75447853 TAGGGAAAACAAAAGCAAAAGGG + Intronic
1130160189 15:81390990-81391012 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1130193252 15:81756023-81756045 CAGAGAAAACAAGAGAAGAGAGG + Intergenic
1130529330 15:84734362-84734384 CAGAAAAAAAAAAAGCGGGGGGG - Intergenic
1130716192 15:86337337-86337359 AAAAGAAAAAAAAAGTAGGAAGG + Intronic
1131570124 15:93526138-93526160 CAGAGTAAACAAAAATAGAAGGG - Intergenic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1131639896 15:94281380-94281402 AATAGAAAACAAAAGAAGCAGGG - Intronic
1131664320 15:94554401-94554423 CTGATAAAACAAAATCAGGTAGG - Intergenic
1131780411 15:95850545-95850567 CAGATAAAACAAAAGCGTGGAGG + Intergenic
1131828531 15:96339636-96339658 CAGAGAAAAAGAAAGAAGGAAGG + Exonic
1131834527 15:96376902-96376924 AAGAGAAAAGAAAGGAAGGAAGG - Intergenic
1131940700 15:97561873-97561895 CAGAGACAGCAAAAGTAGCATGG - Intergenic
1131978320 15:97969097-97969119 AAAAGAAAACAAAACCAGGGAGG - Intronic
1132088374 15:98926674-98926696 TACAGACAGCAAAAGCAGGATGG + Intronic
1132323835 15:100949042-100949064 TAGAGAATATAAAAGCAGTAGGG + Intronic
1132444973 15:101907573-101907595 TACAGAAAACAAAAGCAAAATGG - Intergenic
1202980377 15_KI270727v1_random:349823-349845 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1133004696 16:2872838-2872860 CAAAAAAAAAAAAAGAAGGAAGG + Intergenic
1133686280 16:8168325-8168347 AAGAGGAACCAAAACCAGGAGGG + Intergenic
1134528079 16:14960043-14960065 GATAGAAAAGAAAATCAGGAAGG - Intergenic
1134651429 16:15912076-15912098 AAGAAAAAAAAAAAGAAGGAAGG - Intergenic
1134864221 16:17590465-17590487 GAGAGAAAACAGAAGCACCAAGG + Intergenic
1135031686 16:19043866-19043888 CAAAGAAAACAAAAGCAGGCCGG - Intronic
1135037848 16:19093147-19093169 GAGAAGAAATAAAAGCAGGAAGG - Intergenic
1135088090 16:19490763-19490785 AAGAGAAAAGAAAAAAAGGAAGG - Intronic
1135170273 16:20177737-20177759 CAGAGAAAGCAAATGCATCATGG - Intergenic
1135218507 16:20593019-20593041 AAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1135259545 16:20969066-20969088 CAGAGAAAGAAAAAGCAGATGGG - Intronic
1135458685 16:22622057-22622079 CAGAGTAAATAAAAGCGTGAGGG - Intergenic
1135788847 16:25375030-25375052 CAGAGGAATAAAATGCAGGAAGG - Intergenic
1135794842 16:25431966-25431988 TAGAGAAAAGGAAAGAAGGAAGG - Intergenic
1136698163 16:32105340-32105362 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1136769443 16:32822524-32822546 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1136798661 16:33048625-33048647 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1136849442 16:33602000-33602022 CAAAGAAAAAAAAAGCTTGAGGG + Intergenic
1136912020 16:34151554-34151576 AAGAGAAAAGAAAAGAAGAAAGG + Intergenic
1136935662 16:34461460-34461482 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1136946047 16:34652485-34652507 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1136956376 16:34791512-34791534 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1136964156 16:34887110-34887132 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1137088777 16:36162338-36162360 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1137093302 16:36221568-36221590 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137459084 16:48641846-48641868 CAGTCAAAACAAAAGCAGCCTGG + Intergenic
1137482856 16:48866817-48866839 CAGAGAAAAATATAGCAGGAAGG + Intergenic
1137880541 16:52042088-52042110 CACAGGAAACAAAAACAAGAGGG - Intronic
1137941006 16:52684601-52684623 CAGAGATAATAAAAGAAGCATGG + Intergenic
1138003688 16:53309761-53309783 AAGATAAAACAAAAACAGGCTGG - Intronic
1138222071 16:55260404-55260426 CAGAGAAAAGGAAAGAAGAATGG - Intergenic
1138243576 16:55448538-55448560 GAAAGAAAATAAAAGAAGGAAGG + Intronic
1138755818 16:59483569-59483591 AACAGAAAACAAAAGCATGCAGG - Intergenic
1138813763 16:60180622-60180644 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1139018301 16:62716888-62716910 AAGAGAAAAGAAAAGATGGAAGG - Intergenic
1139297697 16:65917579-65917601 CAGAGTAGCCAAAATCAGGATGG + Intergenic
1139989610 16:70929407-70929429 CAGAGAAGACTGGAGCAGGAAGG + Intronic
1140097835 16:71890756-71890778 AAAAAAAAAAAAAAGCAGGAAGG - Intronic
1140338074 16:74130620-74130642 AAAAGAAAAGAAAAGAAGGAGGG + Intergenic
1140339363 16:74141792-74141814 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1140602347 16:76492419-76492441 AAGAAAATACAAAAGAAGGATGG + Intronic
1140635953 16:76913868-76913890 TACATAAAACAAAAGCAAGATGG + Intergenic
1140691491 16:77488603-77488625 CAGAGGAAACAACAGATGGAAGG - Intergenic
1140709040 16:77659227-77659249 GAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1140809241 16:78561244-78561266 CAGAGAGATTCAAAGCAGGAGGG - Intronic
1140809249 16:78561334-78561356 CAGAGAGATTCAAAGCAGGAGGG - Intronic
1141083211 16:81071811-81071833 ATGAGAAAAAAAATGCAGGAAGG + Intronic
1141187065 16:81795691-81795713 GAGAAAAAAAAAAAGCAGGTGGG - Intronic
1141190882 16:81823853-81823875 AAAAGAAAAGAAAAGAAGGAAGG - Intronic
1141259863 16:82442883-82442905 CAGAAAAAAAATAAGCAGCATGG - Intergenic
1141334391 16:83141147-83141169 CAGAGAATATTAAAGCCGGAGGG + Intronic
1141697256 16:85625962-85625984 CTGAGAAAACACAAGCAGGTGGG - Intronic
1141790872 16:86233279-86233301 AAAAGAAAACAAAACAAGGAAGG + Intergenic
1141874354 16:86812369-86812391 CTGAGAAAACTAAATCAGGATGG + Intergenic
1141954482 16:87361266-87361288 CAGAGAAAACAAGTGCAGAGAGG + Intronic
1203071859 16_KI270728v1_random:1084629-1084651 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1203111150 16_KI270728v1_random:1450650-1450672 CAAAGAAAAAAAAAGCTTGAGGG + Intergenic
1142746564 17:1961983-1962005 GAAAGAAAAGAAAAGCAGGCCGG + Intronic
1142753583 17:2002643-2002665 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1142772699 17:2110812-2110834 CAGAGGAATCAATATCAGGAGGG + Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1143254016 17:5542590-5542612 TAGAGAAAAGTAAAGCAGAAAGG - Intronic
1143443525 17:6994159-6994181 AAAGGGAAACAAAAGCAGGAGGG + Intronic
1143528870 17:7488953-7488975 CAGAGAAAACAAGGGAAGGGCGG - Intronic
1143889301 17:10090169-10090191 CAAAAAAAAAAAAAGCAGCATGG + Intronic
1143978056 17:10844829-10844851 GAGAGAAAAGCAAAGCCGGAGGG - Intergenic
1144033872 17:11347684-11347706 CGAAGAAAACAAAAGCAGTGTGG + Intronic
1144046908 17:11462174-11462196 CAGAGAGGACAGAAGCAAGAGGG - Intronic
1144297195 17:13887307-13887329 CAGAGAAAAAGAAAGAAAGAAGG + Intergenic
1144339288 17:14299211-14299233 CTGAGAATATAAAAGCGGGAGGG + Intergenic
1144352926 17:14415976-14415998 CAGAGAAAAAGAAAGAAGGAAGG - Intergenic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144853457 17:18255612-18255634 CAGAGAAATCAGAATCTGGATGG + Intronic
1145134795 17:20393313-20393335 CAAAGAGAACTAAAGCAGCATGG - Intergenic
1146028576 17:29344858-29344880 AAAAGGAAAGAAAAGCAGGAGGG + Intergenic
1146391532 17:32427822-32427844 CAGAAAAAAAAAAAAAAGGAAGG + Intergenic
1146806708 17:35870768-35870790 CAAAGAAAAATAAAGCAGGTGGG - Intergenic
1147046868 17:37759133-37759155 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1147220138 17:38923828-38923850 CAAAGAAAACAAAACTAGGCCGG + Intergenic
1147302814 17:39543411-39543433 CAGAGAAAGCAAACACTGGAAGG - Intronic
1147474556 17:40698185-40698207 CAAAGAAAAAAAAATCAAGAAGG - Exonic
1147530346 17:41270634-41270656 CAGAGAGAACCAAAGCAGGTGGG - Intergenic
1147715283 17:42502741-42502763 GAAAGAAAACAAAAGAGGGAGGG - Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148459301 17:47829260-47829282 CTCAGAAAAAAAAAGAAGGAAGG + Exonic
1148580071 17:48737596-48737618 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1148725512 17:49787101-49787123 GAGAGAGAAAAAAAGTAGGATGG + Intronic
1148896586 17:50842578-50842600 CCAAGAACACAAAGGCAGGAAGG + Intergenic
1149206823 17:54257540-54257562 TAAAGAAAGTAAAAGCAGGAAGG + Intergenic
1149283062 17:55129580-55129602 GAAAGAAAAGAAAAGAAGGAGGG + Intronic
1149334710 17:55623793-55623815 AAAAGAAAACAATAGAAGGAAGG - Intergenic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150558585 17:66275825-66275847 CTGAGAAAACAAAACCAGCAAGG + Intergenic
1152246145 17:79185529-79185551 CAGAGAAGACAAAAGAGGGATGG - Intronic
1152650973 17:81492701-81492723 AAAAGAAAACAAAAGCGGGGAGG + Intergenic
1152682254 17:81674668-81674690 CAAAAAAAAAAAAAGTAGGAGGG - Intergenic
1152866444 17:82726577-82726599 CAGAGCAGACCAAAGCTGGAGGG - Exonic
1203183852 17_KI270729v1_random:93122-93144 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1153206469 18:2708609-2708631 CAAAAAAAAAAAAAGCAGGAAGG - Intronic
1153408801 18:4770373-4770395 AAGAGAACACAAAGACAGGAGGG + Intergenic
1153508797 18:5830936-5830958 CAAAGAAAATAAAAGAAAGAAGG + Intergenic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1153820675 18:8828867-8828889 GAAAGAAAAGAAAAGCAAGAAGG - Intronic
1153847807 18:9065522-9065544 AATAGAAGACAAAAGGAGGAAGG - Intergenic
1154371429 18:13766093-13766115 CAAAGAAGATAAAAGCAGGCTGG + Intergenic
1154519163 18:15208356-15208378 GAGAGAAAAAGAAAGGAGGAAGG - Intergenic
1155072847 18:22331297-22331319 AAAAGGAAACAAAAGCAGAAAGG + Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155219242 18:23669479-23669501 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1155325179 18:24657632-24657654 TGGAGGAAACAACAGCAGGAAGG - Intergenic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155413221 18:25568905-25568927 CAAAAAAAACAAAAACAGAATGG + Intergenic
1155436863 18:25821560-25821582 AAAACAAAACAAAAACAGGAGGG - Intergenic
1155486532 18:26349400-26349422 CTGAAAAAACAAAATCAAGAAGG + Intronic
1155797379 18:30057515-30057537 AAGAGAAAAGAAAAGAAAGAGGG - Intergenic
1155855622 18:30830689-30830711 CAAAGAAAAAAAAAGCGGGGGGG + Intergenic
1155865227 18:30956546-30956568 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1155889092 18:31244267-31244289 CACAGAAAACAAATGCAGGAAGG - Intergenic
1156251351 18:35355558-35355580 CAGAGAAAATAAAAGCAATGGGG + Intergenic
1156300336 18:35830921-35830943 GAAAGAGAACAAAAGAAGGAAGG + Intergenic
1156575443 18:38309855-38309877 CAGAATAAAGAAAAGCAGTAAGG + Intergenic
1156584707 18:38419278-38419300 CAGAGAAAATATAAAAAGGAAGG - Intergenic
1156765547 18:40650513-40650535 AAGAGAGAACAAAAGCACCATGG + Intergenic
1156889576 18:42175205-42175227 GAGAGAGAATAAAAGCAGAAGGG + Intergenic
1157080318 18:44517777-44517799 AAGAGAAAGCAATAGCAGGAAGG + Intergenic
1157190706 18:45579079-45579101 CAGAGAAAGCAGAAGCTGCAAGG + Intronic
1157306253 18:46519720-46519742 CAGAGAACACAAGAGTCGGACGG - Intronic
1157355529 18:46930517-46930539 TAGAAAAAAGAAAAGCAGGCCGG + Intronic
1157424784 18:47575720-47575742 GAGAGAGAACATAAGCACGAGGG - Intergenic
1157466101 18:47946932-47946954 AAAAAAAAAAAAAAGCAGGAGGG + Intergenic
1157690481 18:49677962-49677984 GAATGAAAACAGAAGCAGGAAGG - Intergenic
1157784792 18:50471941-50471963 CAGAGAAACCAAATGCAGGCTGG + Intergenic
1158371048 18:56804976-56804998 CAGGGAGAACAAATGCAGAAGGG - Intronic
1158377086 18:56883217-56883239 AAAAAAAAAAAAAAGCAGGAAGG + Intronic
1158444522 18:57507766-57507788 ATGAGACAACAAAAGCAGCAAGG + Intergenic
1158749109 18:60238356-60238378 CAGAAAGAAGAAAACCAGGAAGG + Intergenic
1158928374 18:62295419-62295441 AACAGAAAAAAAAAGCAGTAGGG - Intronic
1159609539 18:70510514-70510536 CAGATAAAACAAAATAATGAAGG - Intergenic
1159962889 18:74569002-74569024 GGGAAAAAACAAAGGCAGGAGGG + Intronic
1160200338 18:76790591-76790613 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1160269903 18:77374038-77374060 CAGAGAAAAAGAAAGAAGGAAGG + Intergenic
1160312261 18:77806673-77806695 AAGAGAAAAAAAAAGAAGGTAGG - Intergenic
1160640342 19:126144-126166 TACAGAAAACAAAAGCAAAATGG + Intergenic
1160937588 19:1604515-1604537 AAAAGAAAAAAAAAGCAGCAAGG - Intronic
1161758652 19:6153913-6153935 AAAAGAAAAGAAAAGAAGGAAGG + Intronic
1161789497 19:6350585-6350607 AAGAGAAAAGAAAGGAAGGAAGG + Intergenic
1161839706 19:6672127-6672149 CAGAGTGAGCAAAAGCACGAGGG - Intergenic
1162157942 19:8692536-8692558 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1162204607 19:9046451-9046473 AAGAAAAAAAAAAAACAGGAAGG - Intergenic
1162858878 19:13490624-13490646 AAAAGAAAAGAAAAGAAGGAAGG + Intronic
1163043098 19:14617214-14617236 AAGAGAAAAGAAAAGAAGGAAGG - Intergenic
1163381523 19:16972053-16972075 AAAAGAAAAGAAAAGAAGGAAGG + Intronic
1163504496 19:17697411-17697433 AAGAGAAGACAGAAGCAGCATGG - Intergenic
1163549431 19:17957308-17957330 GAGAGAGAAAAAAAGAAGGAAGG + Intronic
1163781162 19:19249365-19249387 CAAAAAAAACAAAACCAGGCCGG - Intronic
1164117311 19:22235028-22235050 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1164236472 19:23340797-23340819 CACAGAAAAAAAAATCAGCAGGG + Intronic
1164613230 19:29647678-29647700 CAGAAAAAACAACAGCAACAAGG - Intergenic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1164693897 19:30229173-30229195 CAACCAAAACAAGAGCAGGAAGG + Intronic
1164777411 19:30863618-30863640 CAGTGAAACCAAACACAGGATGG - Intergenic
1164787421 19:30944639-30944661 CAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1164815969 19:31203762-31203784 AAGAGAAAAGGAAAGAAGGAAGG - Intergenic
1164853596 19:31503839-31503861 CAGAGAGAGAAAAGGCAGGAGGG + Intergenic
1165294421 19:34915293-34915315 AAGAAAAAAGAAAAGAAGGAAGG + Intergenic
1165887636 19:39090131-39090153 AAAAGAAAAAAAAAGAAGGAGGG - Intronic
1166146302 19:40838637-40838659 AAGAGAAAAGAAAAGAAAGAGGG - Intronic
1166184832 19:41133218-41133240 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1166233435 19:41439416-41439438 CAGAAAACTCAAAAGCATGATGG - Intronic
1166419741 19:42627112-42627134 CAGAGAAAACACACCTAGGAGGG - Intronic
1166500875 19:43340323-43340345 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1166514458 19:43435944-43435966 CAGATAAAGAAAAAGAAGGAAGG + Intergenic
1166869033 19:45859630-45859652 GAAAGAAAACAAAAATAGGACGG + Intronic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167030162 19:46953626-46953648 CAGAGAAAGGAATAGCAGAATGG - Intronic
1167332067 19:48862180-48862202 GAGAGAAAAGAAAAGAAGTAGGG - Intronic
1167406798 19:49315332-49315354 CAGAGAATGCAACAGCAGGTGGG + Intronic
1167919908 19:52774498-52774520 AAGAGAACACAAAACCAGGAAGG + Intronic
1168387754 19:55979974-55979996 CCCAGGAAACAAAAGCAGAATGG - Intronic
1168416018 19:56169198-56169220 CAGAAAAAACAAAAGCCAGCTGG + Intergenic
1202671979 1_KI270709v1_random:63669-63691 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
925533659 2:4892657-4892679 CACAGAAAACAAAAACCGGCTGG + Intergenic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
925823155 2:7820830-7820852 CAAAGAAAATAAAGGCAGTAAGG + Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926026679 2:9551235-9551257 CAAAGAAAAAAAAAAAAGGAAGG + Intronic
926154706 2:10447669-10447691 CAGCGAAAATAAAAACTGGAAGG + Intronic
926348552 2:11973409-11973431 GAGAGAAACCAAAAGCAAGCAGG - Intergenic
926592652 2:14756477-14756499 CATAGAAACCGAAAGCTGGAGGG - Intergenic
926649754 2:15329856-15329878 CAGAGATAACATAAGCAAGGTGG - Intronic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
926867279 2:17373651-17373673 GAGAGAAAAAAAGAGGAGGATGG - Intergenic
926957831 2:18320966-18320988 GAGAGAACACAAAAGAAGCATGG - Intronic
926984510 2:18607609-18607631 CAAATAAAACAAGAGCAGCAGGG - Intergenic
927000654 2:18791149-18791171 AAGAGAGAAAAAAAGAAGGAAGG - Intergenic
927061509 2:19427161-19427183 CAGAGAGAAGAAAAGGAGGTAGG + Intergenic
927090608 2:19707990-19708012 CACAGAAAACACAATCAAGAAGG - Intergenic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
927358390 2:22202576-22202598 CTGAAAAAAAAAAAGCAAGAAGG + Intergenic
927789475 2:25999216-25999238 GAGAGAGAAAGAAAGCAGGAAGG - Intergenic
927819150 2:26247109-26247131 TAATGAAAACAAAAGCAAGATGG - Intronic
927882616 2:26699177-26699199 CAGAAAAAAAAAAAAAAGGAAGG + Intronic
927995212 2:27480367-27480389 CAGAGAAAACAAAAAGACCAGGG + Intronic
928209614 2:29313821-29313843 GAGGAAAAACAAAAGCAGAAGGG - Intronic
928242854 2:29601673-29601695 CTGAAAAAACAAAAGCAGGCAGG + Intronic
928252891 2:29697344-29697366 GAGAGAAAAGAGAGGCAGGAAGG + Intronic
929389362 2:41451401-41451423 CAGGCAAAGCAAAAGCAGGCTGG + Intergenic
929451987 2:42044088-42044110 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
929544508 2:42847013-42847035 CAGAGAAACCAAGAGCCAGATGG - Intergenic
929688394 2:44054318-44054340 CACAGAAAACAAAGGAAGGTGGG - Intergenic
929767142 2:44854624-44854646 CAGAGAAAACAAAAATAGTTGGG + Intergenic
930045022 2:47163425-47163447 AAAAAAAAACAACAGCAGGAAGG - Intronic
930197360 2:48522873-48522895 CAGAAAAAAAAAAAGAAAGAAGG + Intergenic
930240064 2:48927210-48927232 CACAGAAAACAAATGCAGAATGG - Intergenic
930309345 2:49718332-49718354 CAAAGAAAAAAAAAACAGGAGGG + Intergenic
930443082 2:51433294-51433316 CAGAGAATTCAATATCAGGATGG + Intergenic
930539760 2:52690704-52690726 GAAAGAAAAGAAAAGAAGGAAGG - Intergenic
930542837 2:52729053-52729075 CAGAAAGAACAAAAGCAGATTGG - Intergenic
930616297 2:53598224-53598246 CAGACAGTACAAAAGGAGGAAGG + Intronic
930636097 2:53807402-53807424 CAAAGAAAAAAAAGGCAGTAAGG - Intronic
931050878 2:58413130-58413152 CTGATAAAAAAATAGCAGGAAGG + Intergenic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
931169662 2:59789604-59789626 CAAAAAAAAAAAAAGAAGGAAGG + Intergenic
931288005 2:60848877-60848899 GAGAGAAGACAAATGCAGGGCGG + Intergenic
931632747 2:64316028-64316050 CTGAGAAAACAGCATCAGGATGG - Intergenic
931938807 2:67229385-67229407 CAGAGACAACTAAAGCAGGAAGG - Intergenic
932155799 2:69416020-69416042 CAGAAAAAAGGAAAGGAGGAAGG + Intronic
932360053 2:71097356-71097378 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
932684734 2:73858434-73858456 AAGAAAAAACAAAAACAGGCTGG - Intronic
933161119 2:79026213-79026235 CAGAGCCAAGAAAAGGAGGAAGG + Intronic
933174394 2:79159264-79159286 CAGAGCTAACAAGAGGAGGAAGG - Intronic
933182603 2:79244148-79244170 CAGACAATATAAAAGCAGAACGG - Intronic
933244269 2:79957595-79957617 CAGAGATTGCAACAGCAGGAAGG - Intronic
933256258 2:80084228-80084250 CACAGAACAAGAAAGCAGGAAGG + Intronic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
934260125 2:91466807-91466829 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
934303429 2:91798734-91798756 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
934329830 2:92054023-92054045 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
934468048 2:94283928-94283950 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
934510950 2:94942644-94942666 CAGAGAGAAAAAAAAGAGGAAGG + Intergenic
935061592 2:99612922-99612944 CAGAGGAAAAAAATGCTGGAAGG + Intronic
935096415 2:99948513-99948535 CAGAGAAACTCAAAGGAGGAAGG + Intronic
935271448 2:101437613-101437635 AAGAGAAAAGAAAAGAAAGAAGG + Intronic
935368734 2:102322301-102322323 CAGGCAACACAAAAGCATGAAGG - Intronic
935491769 2:103729852-103729874 AAAAGAAAACAAAAGAAAGAAGG + Intergenic
935893603 2:107708441-107708463 AGGAATAAACAAAAGCAGGATGG + Intergenic
936034715 2:109101662-109101684 TAGTGAAAACAAGAGAAGGAAGG + Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936108805 2:109648234-109648256 CAGAGAACTCAAAGGCAGGAAGG + Intergenic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936506230 2:113109667-113109689 CTGAGAAAACACTAACAGGAAGG + Intronic
936869521 2:117118353-117118375 CAAAGAAAACAAATGCTTGAGGG - Intergenic
936926563 2:117742954-117742976 CAGAGAAAAAGAAAGAAGAAAGG + Intergenic
936927200 2:117749357-117749379 CTGAGAAAACAGAAGCAGCTGGG - Intergenic
936940088 2:117875838-117875860 AAAAGAAAAGAAAGGCAGGAAGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937299986 2:120833145-120833167 CAGGGAAAGGAAATGCAGGAGGG - Intronic
937392326 2:121500425-121500447 AAGAGAAAAGAAAAGAGGGAAGG + Intronic
937397038 2:121546472-121546494 CGGAGAAAAGCAAGGCAGGACGG + Intronic
937639386 2:124194166-124194188 CAGAGAAAATAAATGGGGGAGGG - Intronic
937779049 2:125816274-125816296 CAGAACAAACAAAAGAAAGAAGG + Intergenic
937894144 2:126964616-126964638 AATAAAAAACAAAAGCAAGATGG - Intergenic
938195741 2:129326069-129326091 AAGAAAAAAGAAAAGAAGGAAGG + Intergenic
938711522 2:133979604-133979626 CAGAGAAAGTGAAAGCACGAGGG - Intergenic
938977598 2:136494706-136494728 CTGAGAAAACAAAAGAAGCTTGG + Intergenic
939422983 2:141997671-141997693 GAGAGAAAAAAAAAGCATAAAGG - Intronic
939630911 2:144524740-144524762 CAGAGGGAGGAAAAGCAGGAGGG - Intergenic
940066288 2:149633588-149633610 GAAAGAATACAAAAGCAGGAAGG + Intergenic
940085108 2:149850439-149850461 CAGAGAAAAGAAAAACAAGGAGG + Intergenic
940424964 2:153520677-153520699 AAGAGAAATGAAAAGCAGTAGGG - Intergenic
941157297 2:161995221-161995243 CTGACAAAACAAAAGCATGAGGG - Intronic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
941743540 2:169062233-169062255 CAGAGAAAACAGACTCAGAAGGG - Intergenic
941750001 2:169125268-169125290 CCGAGAAAAAAAAATCAAGAAGG + Intergenic
942011110 2:171763253-171763275 CAGAAACATCAAAAGCAGGTAGG + Intergenic
942062693 2:172242536-172242558 GACAGAGAACAAAGGCAGGAAGG + Intergenic
942076218 2:172359241-172359263 CCTAGAAAACTAATGCAGGAGGG - Intergenic
942515813 2:176751677-176751699 CATAGAAAACAGATCCAGGAGGG - Intergenic
942981696 2:182091718-182091740 CAGAGAAAAGAAAAACAAGCAGG - Intronic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943300448 2:186191294-186191316 GAGAGAAAAAGAAAGAAGGAAGG + Intergenic
943821113 2:192322172-192322194 AAGAGAAAATAGAAGCATGAAGG - Intergenic
944424988 2:199571676-199571698 GAGAGAAAACAAACCCAGGGAGG - Intergenic
944520382 2:200560079-200560101 AACAGACAACAGAAGCAGGAAGG - Intronic
944536316 2:200713803-200713825 CAGAGAGGACCAAAGGAGGAAGG - Intergenic
944911393 2:204313808-204313830 CAGAGGAAAGAATAACAGGATGG + Intergenic
945145868 2:206737288-206737310 CACAGAGAACAAGAGCTGGATGG - Intergenic
945253733 2:207786392-207786414 CAGAAAAAAAAAAAGGAGCATGG + Intergenic
945509749 2:210686589-210686611 AAGAGTAAACAAGAGCAGGAGGG + Intergenic
945723312 2:213446069-213446091 CAAAGAATATAAAAGCAGAAAGG + Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946197265 2:218041793-218041815 CTGAGAAGACAAAACCAGGCAGG - Intronic
946321522 2:218957478-218957500 GAGAGATAACCAGAGCAGGAGGG + Intergenic
946453371 2:219800124-219800146 AAGAGAAAAAAAAAACAAGAAGG - Intergenic
946566762 2:220974126-220974148 GAAAGAAAACAAAAGAAGGAGGG + Intergenic
946858316 2:223975676-223975698 GAGGGAAAAAACAAGCAGGATGG - Exonic
946872398 2:224096303-224096325 CAGTGAAAAAAAAAACAGGCAGG + Intergenic
946917377 2:224538705-224538727 CAGAGAAATTGAGAGCAGGATGG + Intronic
947460921 2:230304632-230304654 CAAAGCAAACAAAAGCATAAAGG + Intronic
947481759 2:230507137-230507159 CTCAGAAGACAGAAGCAGGAGGG + Intronic
947497458 2:230648352-230648374 CAAAGAAAAAAAAAGAGGGAGGG + Intergenic
947543473 2:230994306-230994328 TGAAGAAAACAAAGGCAGGAAGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947771653 2:232675193-232675215 GAGAGAAAAGAAAGGAAGGAAGG + Intronic
948090930 2:235294779-235294801 CTGAGCAAACAAAATCAGGTAGG - Intergenic
948611715 2:239173113-239173135 CAGAGAATACAAAAGGAGAGAGG + Intronic
948986519 2:241528167-241528189 CATAGAAACAAAAAGCAGAAAGG + Intergenic
1168945474 20:1752059-1752081 AATAGAAACCAAAAGCAGGTAGG + Intergenic
1169111771 20:3038740-3038762 CAGAGAGAACAGCAACAGGAGGG - Intronic
1169736150 20:8839689-8839711 CTGAGAAATCAAAAGCAGATAGG - Intronic
1169757760 20:9061739-9061761 GAGAGAAAGAAAAAGAAGGAAGG - Intergenic
1170051298 20:12148553-12148575 CAGAGAAAGCAAAAACAATATGG + Intergenic
1170111785 20:12812432-12812454 CAGAAAAAAAAAAATCAAGAAGG + Intergenic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170631782 20:18072409-18072431 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1170638710 20:18132509-18132531 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1170790239 20:19502357-19502379 CAGGGAAAACAACAGCTGAAAGG + Intronic
1171091223 20:22287436-22287458 CAGAGAAGCCAAAAGCCGAAAGG - Intergenic
1171259971 20:23723731-23723753 CAGAGAAACCAAAAGCTACAGGG + Intergenic
1171269041 20:23799263-23799285 CAGAGAAACCAAAAGCTACAGGG + Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171415913 20:24980261-24980283 CAGAGAATTCAAGAACAGGAAGG + Intronic
1171907336 20:30909900-30909922 AAGAGAAAAGAAAAGAAGAAAGG + Intergenic
1172076056 20:32298512-32298534 CTTAAAAAACAAAAACAGGAAGG - Intronic
1172107255 20:32524141-32524163 CAGAAATCAGAAAAGCAGGAAGG + Intronic
1173034320 20:39394232-39394254 CAGAGATGACAAATGCAGTATGG + Intergenic
1173343629 20:42177932-42177954 GAAAGAAAAGAAAAGAAGGAAGG - Intronic
1173620183 20:44430406-44430428 CCGAGAAAACAAACCCAGGTTGG + Exonic
1173633679 20:44535995-44536017 CATAGAAAACAAAAGTAGAATGG - Intronic
1173718669 20:45234241-45234263 AACAGAAACCAAAAGCAAGAAGG - Intergenic
1173849189 20:46207244-46207266 CAGTGCAGATAAAAGCAGGAGGG + Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174013428 20:47469188-47469210 CAGAGAAAACAACAGAGGGAGGG + Intergenic
1174306027 20:49614931-49614953 TAGAGAAAACAAAGGGAGAACGG + Intergenic
1174626252 20:51916876-51916898 TAAAGAAAAAAAAAGCAGGGTGG + Intergenic
1174772100 20:53309866-53309888 CCGAGGAAACAAAAGCAAGGAGG + Intronic
1174940327 20:54919512-54919534 AAAAAAAAACAAAACCAGGAGGG + Intergenic
1175344133 20:58259356-58259378 AGGAAAAAACAAAAGAAGGAAGG + Intergenic
1175351390 20:58322524-58322546 AAGAGAAAAATAAAGCAAGATGG - Intronic
1175374708 20:58516043-58516065 CAGAAAAAAGAGAACCAGGAAGG + Intergenic
1175381855 20:58569058-58569080 CAGAGAAAAAAAAAAAAGGTTGG - Intergenic
1175509917 20:59517091-59517113 GAAAGAAAACAAAGGAAGGAAGG - Intergenic
1176014054 20:62919545-62919567 AAGAAAAAAAAAAAGCAGCAAGG + Intronic
1176723315 21:10410784-10410806 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1177672825 21:24255763-24255785 CAAAGAATGCAAAAGCAGGCTGG + Intergenic
1178070343 21:28958430-28958452 CAGAGCAGACAAATGTAGGAAGG + Exonic
1178259475 21:31085600-31085622 CAGAGAAAAAGAAAGAAGGAAGG + Intergenic
1178374509 21:32055874-32055896 CTGAGAAAACCAAAGCTAGAGGG - Intergenic
1178448976 21:32674381-32674403 TAGAGAAAAATAAAGCAGGGAGG - Intronic
1178572945 21:33757824-33757846 CACAAAAAACAAAAGCAAGAAGG - Intronic
1179520141 21:41937910-41937932 CAAAGAAACCAAGAGCAGAATGG + Intronic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1179808256 21:43853751-43853773 AAGAGAAGACAAGAGCACGAGGG - Intergenic
1180223119 21:46372466-46372488 CCCAGAACACAGAAGCAGGAGGG - Intronic
1180239375 21:46490086-46490108 CAGAGAAAACAAGAGCGAGAGGG - Intronic
1180304473 22:11063521-11063543 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1180614008 22:17115986-17116008 CAAAGAAAAAGAAAGAAGGAAGG + Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181358160 22:22314316-22314338 CAGAGCACAGAAAACCAGGACGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181671925 22:24429608-24429630 CAGAGAGCACAGCAGCAGGAAGG - Intronic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181787413 22:25237198-25237220 CAGAGAACAATAAAGCAGAATGG + Intergenic
1181809091 22:25392585-25392607 CAGAGAAAAGCAAAGCAAGGAGG + Intronic
1181860871 22:25817312-25817334 AAAAGAAAAGAAAAGAAGGAGGG - Intronic
1182191171 22:28462324-28462346 CAGAGAGAAAAGAAGCATGATGG - Intronic
1182613498 22:31569551-31569573 GAAAGAGAAAAAAAGCAGGAAGG + Intronic
1183536194 22:38402799-38402821 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1183657417 22:39195755-39195777 AAGAGAAAAAGAAAGAAGGATGG + Intergenic
1183902009 22:41012964-41012986 CAAACAAAACAAAAACAGGCTGG - Intergenic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184111913 22:42400624-42400646 AAAACAAAACAAAAACAGGAGGG + Intronic
1184195529 22:42925087-42925109 GAGAGAAAAATAAAGCAGGGAGG - Intronic
1184825961 22:46951148-46951170 CAGAGAGAAGAAAAGCTGCAAGG - Intronic
1184875161 22:47269749-47269771 GGGAGATTACAAAAGCAGGAGGG - Intergenic
1184900020 22:47440254-47440276 CAGAGAAAACAAAAATAGCATGG - Intergenic
1185173809 22:49307826-49307848 AAGAGAAAACAAAACCAGACAGG + Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949102639 3:164487-164509 CAGAGAAAAAAAAAACTTGATGG + Intergenic
949499994 3:4670707-4670729 CCTAGAAAACAAGAGGAGGAGGG - Exonic
949710282 3:6863118-6863140 GAGAGAAAAAAAAAACAGCAAGG - Intronic
949810491 3:8001605-8001627 AAGAGAAACCCCAAGCAGGATGG + Intergenic
951057073 3:18159828-18159850 CAAAGAAAACAAAACCACAAAGG + Intronic
951128086 3:19007640-19007662 CTTAGAAAACAAAGGCAAGAGGG + Intergenic
951163635 3:19458093-19458115 AAGAGAAAACAAATTCAGAATGG + Intronic
951222774 3:20086272-20086294 CAAAGAAAACAAAAACAAAAAGG + Intronic
951591451 3:24269908-24269930 CAGAAAAAGCCAAAGAAGGAAGG - Intronic
952187663 3:30988144-30988166 CATAGAAAACAAAAGCATTTGGG - Intergenic
952234553 3:31465258-31465280 CAGAGAAAAGAAAAGAACAAAGG + Intergenic
952283616 3:31947018-31947040 CAGAAGAGACAAAGGCAGGAGGG + Intronic
952445142 3:33373815-33373837 CAGAGAAAACAAAAGACAGCTGG - Intronic
952655730 3:35783123-35783145 CTGAGAAAATAAAACCTGGATGG - Intronic
952770660 3:36996992-36997014 TGGAGAAAACTAAAGCAGGGAGG + Intronic
953005971 3:38979755-38979777 TAGAGAAGACAAAGGCTGGAGGG - Intergenic
953062429 3:39438510-39438532 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953186532 3:40643060-40643082 CAGGGAAAAAAAAAGCAAGTGGG - Intergenic
953717641 3:45329676-45329698 CACAGAAAACTAATACAGGAAGG + Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954403630 3:50332796-50332818 CACAAAAAACAAAAACAGGCTGG + Intronic
954487606 3:50868366-50868388 AAGAAAAAACAAAAGCAGGCCGG - Intronic
955098708 3:55825946-55825968 AAAACAAAACAAAAGAAGGAAGG + Intronic
955149425 3:56352366-56352388 CAAAGAAGACAAAAGAAGAATGG + Intronic
955538500 3:59950123-59950145 CAGAGAGAAGAAGAGAAGGATGG - Intronic
955644892 3:61126741-61126763 TAGAGAAAACAAAGCCCGGAAGG + Intronic
955704590 3:61715161-61715183 CAAAGAAAAAAAAAGCAAGCAGG - Intronic
955959016 3:64319936-64319958 AAGATAAAACAAAAGCAGAAAGG + Intronic
955975772 3:64478115-64478137 AACAGAAAACAAAAAAAGGAAGG + Intergenic
956202891 3:66725658-66725680 AAGAGAGAAAAAAAGCAGGCTGG + Intergenic
956203045 3:66727689-66727711 AAGAGAGAAAAAAAGCAGGCTGG - Intergenic
956219229 3:66884361-66884383 AGGAGGAAACAAAAGAAGGAAGG + Intergenic
956239877 3:67117679-67117701 CAGAGAAAAACAAAACAGAAAGG + Intergenic
956553304 3:70487222-70487244 TAGAGAAAATAAAGGCATGACGG - Intergenic
956590313 3:70907684-70907706 CAAAGGAAACAACACCAGGAAGG - Intergenic
956655164 3:71542862-71542884 CAGATAACACAAAAGCATGGAGG + Intronic
956858668 3:73301163-73301185 AGGAGAAAAGAAAAGGAGGAAGG - Intergenic
956971532 3:74532008-74532030 CAGAAAAAACAGGAGAAGGAGGG + Intergenic
957049772 3:75402387-75402409 CAAAAAAAAAAAAAGGAGGAAGG + Intergenic
957115478 3:76019073-76019095 CAGAGAAAACCAAACCATGTGGG - Intronic
957115512 3:76019433-76019455 CAGAGAAAACCAAAGCATGTGGG - Intronic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957396782 3:79649802-79649824 CAGAGAGAACAAAAACAGAAAGG + Intronic
957456097 3:80448563-80448585 ATGAGAAAACAAAAGCTGGGAGG - Intergenic
957511408 3:81192701-81192723 CAAAGAAAACAAAAGAATTATGG - Intergenic
957573169 3:81975052-81975074 AAGAGAAAAAAAAATAAGGATGG - Intergenic
957613722 3:82502437-82502459 AGGAGAAAACAAAAGCAGGAAGG + Intergenic
957740720 3:84264930-84264952 GAAAGAAAAGAAAAGAAGGAAGG - Intergenic
958031287 3:88114208-88114230 TAGAGAAAAATAAAGGAGGATGG + Intronic
958466024 3:94459798-94459820 CTGAGAAAACTTAAGCAGGTAGG - Intergenic
958809695 3:98846539-98846561 CAGATAAAACAAATGCTTGATGG + Intronic
958842199 3:99220213-99220235 CAAAGAAAAAACAAGCAGGAAGG + Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
959090934 3:101901980-101902002 CAGAGAAAACAGGGGCGGGAAGG - Intergenic
959283300 3:104375239-104375261 AAAACAAAACAAAAGCAGGCTGG - Intergenic
959474511 3:106792258-106792280 CAGAGGAAACAAAAGAATAAAGG + Intergenic
959629608 3:108492950-108492972 GAAAGAAAAGAAAAGAAGGAAGG + Intronic
959894475 3:111591006-111591028 CATAGGAAACAAAAGCAGTTTGG + Intronic
960043168 3:113170671-113170693 CAGCAAAAAGAAAAGCAGAATGG + Intergenic
960543484 3:118886216-118886238 CGGAGAAAAGCAAAGCAGAAAGG + Intergenic
960794808 3:121474211-121474233 CAGAAAACACTAAAGTAGGAAGG + Intronic
960916234 3:122697822-122697844 TACAGACAAGAAAAGCAGGATGG + Intronic
961549981 3:127664181-127664203 CATAGAAACCAAAAGGAGAATGG - Intronic
961700257 3:128738390-128738412 CAAAAAAAACAAAGCCAGGAAGG - Intronic
961964256 3:130886533-130886555 CAGAGAAGACAAAAGAAATAAGG - Intronic
962055817 3:131870603-131870625 GGGAGAAAAGAAAAGGAGGAAGG - Intronic
962180851 3:133205124-133205146 AAGAAAAAAAAAAAGCAGCAGGG - Intronic
962483090 3:135814768-135814790 CAAAGAAAAAGAAAGAAGGAAGG + Intergenic
962522568 3:136210796-136210818 CAGAGAAAAGAATGACAGGAAGG - Intergenic
962774476 3:138646203-138646225 CAAACAAAACAAAAGCATGCAGG - Intergenic
962928370 3:140015538-140015560 GAGAGAAGAAAAAAGCAAGAAGG + Intronic
963006071 3:140727268-140727290 CAGAGGAAAATAAAGCAGGGTGG + Intergenic
963390150 3:144651543-144651565 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
963403855 3:144837852-144837874 CAGAAAAAAAAAAGGAAGGAAGG - Intergenic
963655448 3:148043167-148043189 CAGAGAAATAAAAAGCAGTCAGG - Intergenic
963929867 3:150992292-150992314 CAAAGGAAACCAAAGCAGGGAGG - Intergenic
964041439 3:152267080-152267102 CAAAGAAAACGAAAGGAGCAGGG - Intronic
964106570 3:153046637-153046659 AAGAAAAACCAAAAGCAGGTCGG - Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964242423 3:154612368-154612390 TGGAGAAAAATAAAGCAGGAAGG + Intergenic
964486403 3:157189374-157189396 AAGAAAGAACAAAAGAAGGAAGG + Intergenic
964488835 3:157213276-157213298 GAAAGAAAACAAAAAGAGGAGGG + Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965382606 3:168008537-168008559 TACAGAAAACAGAAGCAGGTGGG + Intergenic
965391154 3:168106021-168106043 GACAGGAAACAAAAGCAGCAAGG + Intergenic
965567556 3:170136884-170136906 AAGAGAAAAGAAAAGAGGGAGGG + Intronic
965716144 3:171605259-171605281 CAGTGAAAAGAAACGGAGGAGGG + Intronic
965770318 3:172175059-172175081 GCGAGAAAGCAAAAGCAGCAGGG - Intronic
965826014 3:172730437-172730459 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
966346479 3:178986393-178986415 CAGACAAAACAGGACCAGGAAGG + Intergenic
966374936 3:179286804-179286826 AAGAGGAAACAAAGGTAGGAGGG - Intergenic
966402313 3:179561001-179561023 AAAAGAAAACAAAAGAAAGAAGG - Intergenic
966428064 3:179802236-179802258 AAGAAAAAAGAAAAGCAGGCTGG + Intronic
966543756 3:181120740-181120762 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
966615759 3:181910943-181910965 AAAAGAAAAAAAAAGAAGGAAGG - Intergenic
966945177 3:184772814-184772836 AAGAGAAGAGAAAAGAAGGAAGG + Intergenic
967004007 3:185365956-185365978 AAGAGAAAAGAAAGGAAGGAAGG - Intronic
967232366 3:187352317-187352339 CATGGAAAACCAAAGCAGGAGGG - Intergenic
967532546 3:190565894-190565916 CAAAGAAAACTAAAACAGGATGG - Intronic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
967654294 3:192027746-192027768 CAGACAAAACAAGAACAGTAGGG + Intergenic
967669207 3:192212227-192212249 CATAGACAATAAAAACAGGAAGG + Intronic
967763628 3:193252842-193252864 CAAAGGAAACAAAACCAGGCAGG - Intronic
967964317 3:194949110-194949132 CAGAAGAAACCAAAGCAGGTTGG + Intergenic
968385847 4:136631-136653 CACAGAAAACACAAGTAGAAAGG - Intronic
968821124 4:2852273-2852295 AAAAGAAAAGAAAAGAAGGAAGG - Intronic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969078934 4:4603285-4603307 CAGAGAAGACAATGGCATGAAGG + Intergenic
969202582 4:5617733-5617755 CAGAGAAAACAGAAGTTCGAAGG + Intronic
969204065 4:5629147-5629169 CAGAGGAGACAAAACCAGGATGG + Intronic
969345890 4:6569791-6569813 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
969584938 4:8086021-8086043 CTGAGAAAACTAAAGGAGGCTGG + Intronic
970125800 4:12809186-12809208 CAAAGAAAAAGAAAGAAGGAAGG + Intergenic
970156409 4:13145855-13145877 CACAGAAAAAGAAAGCAGAATGG + Intergenic
970286963 4:14528379-14528401 CAGAGAGAACAAATACAGAAAGG + Intergenic
970302514 4:14696407-14696429 CAGAGAAGACCAAAGGAGAAAGG + Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970672429 4:18412291-18412313 GAGAGAAAAGAAAGGAAGGAAGG - Intergenic
970938699 4:21605979-21606001 AAGAGAAAACAACAGAAGGAAGG - Intronic
971315714 4:25566128-25566150 CAAAAAAAAAAAAAGAAGGAAGG + Intergenic
971413656 4:26402182-26402204 ATCAGAAAACAAAAGCAGGCTGG - Intronic
971439277 4:26662414-26662436 CAAAGAAATGAAAAACAGGAGGG + Intronic
971477738 4:27088172-27088194 TAGAGGAAAATAAAGCAGGATGG - Intergenic
971915771 4:32868259-32868281 GAGAGAAAGAAAAAGAAGGAAGG + Intergenic
972026364 4:34383066-34383088 CCGAGAAAACAAAACCAGACAGG + Intergenic
972245470 4:37242779-37242801 GAGAAAAAAGAAAGGCAGGAAGG + Intergenic
972693713 4:41424031-41424053 GAGAGAAAGAAAAGGCAGGAAGG - Intronic
972700404 4:41489261-41489283 CAAAGAAACCAAAAGCTGGTGGG - Intronic
972737823 4:41862967-41862989 CAGTGAAAACAAAATCAAGCTGG + Intergenic
972737855 4:41863345-41863367 CAGTAAAAACAAAATCAGGTGGG - Intergenic
973178374 4:47236683-47236705 CAGGTAAAACAAAGGCAGAAAGG + Intronic
973610610 4:52632869-52632891 CAGAGAAAGAAAAGGAAGGAAGG + Intronic
973835567 4:54806099-54806121 AAGAGAAAAAGAAAGAAGGAAGG + Intergenic
973869117 4:55147006-55147028 AAGAGAAAAAAAAACAAGGAAGG + Intergenic
973980400 4:56303932-56303954 CAGAGAAAACAAACTCAGGCTGG - Intronic
974161168 4:58141894-58141916 AAGAGACAATAAAAGCATGAGGG - Intergenic
974204937 4:58689792-58689814 GAGAGAGAAAAAAAGAAGGAAGG - Intergenic
974406700 4:61481282-61481304 AAGAGAAAAGAAAGTCAGGATGG + Intronic
974907230 4:68073388-68073410 GAGATAAAAGAAAAGAAGGAAGG + Intronic
974925740 4:68295795-68295817 CAGAGAAAAAAAATTCAAGATGG + Intergenic
974935645 4:68406906-68406928 AAGCAAAAACAAAAGCATGAGGG - Intergenic
974941242 4:68471215-68471237 AAGAGAAAAGAAAAGAAAGAAGG - Intronic
974975847 4:68889998-68890020 CATAGAAAAAAAATTCAGGACGG - Intergenic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975493849 4:75016563-75016585 CAGAGAATACAAGAGCAGGGAGG - Intronic
975537091 4:75462304-75462326 CAAAAAAAAAAAAAGAAGGAAGG - Intergenic
975980647 4:80154852-80154874 CAGAGAAAACAAAACAAACAAGG + Intergenic
976574320 4:86651446-86651468 CAGACAAAAAAACATCAGGAAGG - Intronic
976638636 4:87313399-87313421 AGGAGAAGAAAAAAGCAGGAAGG - Intronic
976839407 4:89413839-89413861 CTAAGAAAAAAAAAGCAGGCTGG - Intergenic
977066551 4:92323700-92323722 CAGAGAAGAAGAAAGGAGGAAGG - Intronic
977156459 4:93579829-93579851 TAAAGAAAACGAAAGCAAGAGGG - Intronic
977254598 4:94726866-94726888 AAGAGAAAAGAAAAGAAGAAAGG - Intergenic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
978361337 4:107933360-107933382 AAAAGAAAAGAAAAGCAGGTAGG + Intronic
978478219 4:109156748-109156770 CACTGAAAACAAAAACTGGATGG - Intronic
978500521 4:109404256-109404278 CAGAAAAAAAAAAAGAAAGAAGG + Intergenic
978662234 4:111140722-111140744 TAGAGAACACAAAAGAAAGATGG + Intergenic
979069830 4:116187961-116187983 CAGTGAAAACAAATGCATCATGG + Intergenic
979179413 4:117707162-117707184 GAGAACAAAGAAAAGCAGGAGGG + Intergenic
979407093 4:120326483-120326505 AAGAGAAGAAAAAAGAAGGAAGG + Intergenic
979873558 4:125857629-125857651 CAAAAAAAATAAAAGCAGTATGG - Intergenic
980143524 4:128950905-128950927 CAGAGAAAACAAAGGCTGTTAGG + Intronic
980252018 4:130329334-130329356 CAGGGAAAAAGAAAGTAGGAAGG + Intergenic
980464716 4:133157827-133157849 TAGAAAAAAGAAAAGCAAGAAGG - Intronic
980512395 4:133811962-133811984 GAAAGCAAACAAAAGCAGGGTGG + Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980841715 4:138269444-138269466 CATTGAAAACAAAAGGAGAATGG + Intergenic
981206079 4:142042023-142042045 TAGAGAATACAAAAGCATCAAGG - Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981459987 4:145001996-145002018 CATGGAAAATAAAAGAAGGAAGG + Intronic
981474016 4:145169991-145170013 CAGAGAAAAATAAAGCAGAGAGG + Intronic
981576897 4:146214900-146214922 CAGTGAAACCTAAGGCAGGAGGG + Intergenic
981871743 4:149495130-149495152 CAGAGAAAGAAAAAGAATGAAGG + Intergenic
981902354 4:149881261-149881283 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
982034245 4:151330068-151330090 CAAAAAAAATAAAAGCAGGCTGG + Intergenic
982050071 4:151491821-151491843 CATAGAAACCAAAAGCAAGCAGG + Intronic
982135151 4:152268235-152268257 TAGGGAGAAAAAAAGCAGGATGG + Intergenic
982142057 4:152333476-152333498 AAGAGAAAAAAAAAGAAAGAAGG + Intronic
982312818 4:154003399-154003421 GAGAGAAAATAAAGACAGGAGGG - Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982532834 4:156568712-156568734 AAGAGAAGACAAAAGCCGGCTGG - Intergenic
983124722 4:163936637-163936659 CAGAGATACCAAAAGCAGATGGG - Intronic
983146521 4:164222608-164222630 CAGAGAGAAAAAGAGAAGGATGG + Intronic
983316139 4:166134654-166134676 CAAAGCAAAGAAAAGCAGGGTGG - Intergenic
984237524 4:177178582-177178604 CAGAGAAGAGAAAAGGAGTAAGG - Intergenic
984359740 4:178713068-178713090 GAGACAAATCAAAAGTAGGATGG + Intergenic
984375281 4:178922071-178922093 CAGAGAAAGCCAAGGCAGCAGGG - Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
984948938 4:184992289-184992311 TAGTGAAAACTAATGCAGGATGG - Intergenic
985199438 4:187469682-187469704 GAGAGAGAACAAAAGAAGAAAGG + Intergenic
985294827 4:188425512-188425534 AAGAGAAAGCAAGAGCAGGATGG - Intergenic
985340861 4:188952368-188952390 GAAAGAAAATAAAAGAAGGAAGG + Intergenic
985504422 5:271006-271028 AAAAGAAAGCAAAAGCAGGCCGG - Intergenic
985505575 5:278411-278433 TAGAGAAAAATAAAGCAGGCTGG + Intronic
985786113 5:1895925-1895947 GAGAGAAAACACCACCAGGAAGG - Intergenic
986079868 5:4379230-4379252 CAAAGAAAAGTAAGGCAGGAAGG + Intergenic
986503232 5:8423549-8423571 AAAAGAAAAAAAAAGAAGGATGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
986930536 5:12814601-12814623 CATAGAAATCGAAAGTAGGATGG - Intergenic
986967237 5:13288678-13288700 CTCAGCAAACAAATGCAGGAAGG - Intergenic
987011669 5:13772381-13772403 CAAAGAGAATAAAATCAGGATGG + Intronic
987117395 5:14736571-14736593 CAGAGAAAACTGGAGCAGAATGG - Intronic
987305174 5:16630737-16630759 CAGAGCATGCAAAAGCATGAGGG + Intergenic
987390950 5:17375163-17375185 CAGAGACTACAAAAGAAGGGTGG - Intergenic
987415641 5:17658875-17658897 CAAAGCAAACAAAAGCATAAAGG - Intergenic
987549010 5:19353805-19353827 GAAAGAAAGAAAAAGCAGGAAGG + Intergenic
987849051 5:23325242-23325264 CAGAGAAAAAAGAGACAGGAGGG + Intergenic
988110406 5:26812712-26812734 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988186493 5:27870926-27870948 GAGAGTAAGGAAAAGCAGGATGG + Intergenic
988213325 5:28237823-28237845 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
988351125 5:30108394-30108416 GAAAGAAAAGAAAAGAAGGAAGG - Intergenic
989089916 5:37719577-37719599 CAGAGAAAATCAAATCAGAATGG - Intronic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
989308787 5:39988441-39988463 CAGAGAAGAGAAAAGTAGTATGG + Intergenic
989682674 5:44047104-44047126 GAGAGCAAGGAAAAGCAGGATGG - Intergenic
989691978 5:44155208-44155230 CTGAGAAAAGAAAAACAGAAAGG - Intergenic
990063033 5:51675698-51675720 CACAGAATACAATAGCTGGAAGG - Intergenic
990136874 5:52655975-52655997 GAGAGAAAAGGAAAGAAGGAAGG + Intergenic
990152437 5:52834475-52834497 CAGAGAGAGAAAAAGAAGGAAGG + Intronic
990429559 5:55720998-55721020 AAGAGTAAGCAAAAGCAGGAGGG + Intronic
990430735 5:55733075-55733097 GAAAGAAAAGAAAAGAAGGAAGG - Intronic
990627669 5:57632714-57632736 CAGAGAAAACAAAAAAAGTCTGG + Intergenic
991037455 5:62142272-62142294 CAGAGAAAAGAAAACAAGGCAGG + Intergenic
991074683 5:62521725-62521747 GAGGAAAAAAAAAAGCAGGAAGG - Intronic
991365780 5:65866561-65866583 CAGCCAAAACAGAAACAGGAGGG + Intronic
991719648 5:69483377-69483399 AAGAAAAAACAAAGGCATGATGG + Intergenic
991778213 5:70106303-70106325 CAATGAAAACAAAAACAGGTCGG + Intergenic
991857503 5:70981769-70981791 CAATGAAAACAAAAACAGGTCGG + Intronic
991870661 5:71106648-71106670 CAATGAAAACAAAAACAGGTCGG + Intergenic
992167460 5:74068807-74068829 CAGAGAAACCAAACACAGAAGGG - Intergenic
992279048 5:75154580-75154602 AAGAGAAAAAGAAAGAAGGAGGG + Intronic
992297032 5:75336184-75336206 CAAAGAGAACATAAGCAGGGAGG + Intergenic
992570320 5:78048738-78048760 CAGAGAAAACAACTTCAGCAAGG - Intronic
992624461 5:78624785-78624807 AAAAGAAAAGAAAACCAGGATGG - Intronic
992971098 5:82058921-82058943 AAGAGAAACCAAAAGTATGACGG - Intronic
993186413 5:84627331-84627353 CAGATAAAAGAACAGCAGAATGG - Intergenic
993277640 5:85881349-85881371 CAAAGAAAAAAAAATCATGAAGG - Intergenic
993765362 5:91849596-91849618 CAGAAAAAGGAAAAGCAAGATGG - Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994135223 5:96278670-96278692 GATAGAAAACAAAAGCAAAATGG + Intergenic
994177195 5:96723838-96723860 GACAGAAAACAAAAGTAGGTTGG - Intronic
994204359 5:97017416-97017438 GAGAGTAAAAAAAAGCAAGATGG - Intronic
994608451 5:102002996-102003018 CAGAGATAAAATAAGTAGGATGG - Intergenic
994640387 5:102401294-102401316 AAGAGAAAATAAAATCAGGGTGG + Intronic
994679956 5:102873880-102873902 CAGAGAAAATAAAACTAGCATGG + Intronic
995052131 5:107719115-107719137 GAGAGTAAGGAAAAGCAGGATGG + Intergenic
995092117 5:108190108-108190130 AGTAGAAAACAAATGCAGGAGGG + Intronic
995314617 5:110754304-110754326 AAGAGAAAAAAAAAACAGAAAGG - Intronic
995429516 5:112058633-112058655 CAGACAAAAAAAAATCAGGAAGG + Intergenic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995547578 5:113248261-113248283 CACATAAAAGAAAGGCAGGAGGG + Intronic
995656838 5:114435155-114435177 GAGAGAAAACAAACTCAGGAAGG - Intronic
995818917 5:116204423-116204445 AAAAGAAAAAAAAAGGAGGATGG - Intronic
996148071 5:119999491-119999513 CAGATAAAAAAAAAGCAACATGG - Intergenic
996219034 5:120906257-120906279 CATAGAAAACAAAAGCAAGAAGG - Intergenic
996295113 5:121904310-121904332 GAGAGAAAAAAGAAACAGGAAGG - Intergenic
996354494 5:122580914-122580936 AAGAGAAAAGAAAAGAGGGAAGG - Intergenic
996460772 5:123739679-123739701 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
996644970 5:125802989-125803011 CAGAAAAAACAAAAGCATAGTGG - Intergenic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
996847928 5:127921165-127921187 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
996941626 5:129013252-129013274 CAAAGAAACAAAAAGCAGGAAGG - Intronic
997247041 5:132358493-132358515 CAGAGAAGACAACTGCAGGAGGG - Intergenic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
997771130 5:136555667-136555689 CAGGGAAAACAAGAATAGGAGGG - Intergenic
998254843 5:140576986-140577008 AAAAGAAAACAAAGGAAGGAAGG - Intronic
998328704 5:141304628-141304650 GAGAGAAAAGAAAAGAAGCAGGG - Intergenic
998502909 5:142648945-142648967 CCAGGAAAACAATAGCAGGACGG + Intronic
998632298 5:143912600-143912622 AAAAGAAAACAAAAGCAGCTAGG + Intergenic
998708679 5:144795514-144795536 TAAAGAAAACAAAAGAATGAAGG - Intergenic
998812311 5:145978621-145978643 TGTAGAAAACAAAACCAGGAAGG - Intronic
999741985 5:154562672-154562694 CTGGGAAAACAACAGCTGGAAGG - Intergenic
999961304 5:156758783-156758805 TAGAAAAAAAAAAAGCAGAAAGG + Intronic
1000009443 5:157217747-157217769 CAGGGAAAACAACAGAAGAAAGG - Intronic
1000130363 5:158291273-158291295 CAGAGAAAAAAGAGGCAGCAAGG + Intergenic
1000327615 5:160184240-160184262 AAAAGAAAAGAAAAGAAGGAGGG - Intergenic
1000332556 5:160217387-160217409 CAGAGAAAAGACAAGAAGAAGGG + Intronic
1000524696 5:162342413-162342435 AAGAGAAAATAAAAGCTGTAAGG - Intergenic
1000603557 5:163303212-163303234 CAAATAAAACAAAACAAGGATGG + Intergenic
1000675162 5:164112908-164112930 AAGAGAAAAGAAAATCAGCAAGG + Intergenic
1000801641 5:165734987-165735009 AACAGAAACCAAAAGCAGGAAGG - Intergenic
1000940889 5:167358461-167358483 CAGAAAAAAAAAAAGAAGAAAGG - Intronic
1000946199 5:167426387-167426409 TAGAGAAAACAAACCCAAGAGGG - Intronic
1001096668 5:168780703-168780725 TAGAGAAATAAAAAGAAGGAAGG - Intronic
1001425030 5:171617350-171617372 CAAAGAAAACCAGAGCTGGACGG - Intergenic
1001503369 5:172256101-172256123 GAGAGAAAAAAAAAGAAAGATGG + Intronic
1001820759 5:174708417-174708439 TAGAAAAAACAAAAGCAGGTTGG - Intergenic
1001968258 5:175930565-175930587 GAGAGAAATCAAAATAAGGATGG + Intronic
1002249184 5:177913225-177913247 GAGAGAAATCAAAATAAGGATGG - Intergenic
1002331580 5:178444849-178444871 CGGGGAAAACTAAAGCAGAAAGG - Intronic
1002353842 5:178607123-178607145 TAAAAAAAAAAAAAGCAGGAGGG + Intronic
1002610334 5:180413606-180413628 CACAGAAAACAAAAGCTGTGGGG - Intergenic
1002723284 5:181278849-181278871 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1002737008 5:181400271-181400293 TACAGAAAACAAAAGCAAAATGG - Intergenic
1002747691 6:74547-74569 TACAGAAAACAAAAGCAAAATGG + Intergenic
1002801086 6:522131-522153 GAGAGGAGACACAAGCAGGAGGG + Intronic
1002963708 6:1941836-1941858 GGGAGAACACAAACGCAGGAAGG + Intronic
1003024059 6:2537753-2537775 TTGAGAAAACAGAAGCAGAAAGG - Intergenic
1003310644 6:4966963-4966985 AAGAAAAAATAAAAGCAGGAAGG + Intergenic
1003711583 6:8598219-8598241 CAAAGCAAACAAAAACATGAAGG - Intergenic
1003866338 6:10366259-10366281 CAAAAAAAAAAAAAGAAGGAAGG + Intergenic
1004036235 6:11926766-11926788 GAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004150059 6:13109229-13109251 CATAAAAATAAAAAGCAGGATGG - Intronic
1004315841 6:14586885-14586907 GAGAGAGAAAAAAATCAGGATGG + Intergenic
1004482655 6:16035651-16035673 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1004700931 6:18078873-18078895 TGGAGAAAACAGAAACAGGAAGG + Intergenic
1004740291 6:18453432-18453454 CAAACAAAAAAAAAGCAGGCTGG - Intronic
1004874075 6:19937614-19937636 GAAAGAAAACAAAGGAAGGAAGG - Intergenic
1005203469 6:23373902-23373924 AAGAGAAAATAAAAGCAGAGGGG + Intergenic
1005269761 6:24151009-24151031 AAGAGAAAAGAAAGGAAGGAAGG + Intronic
1005368739 6:25107471-25107493 CTAAGAAACAAAAAGCAGGATGG + Intergenic
1005649132 6:27870409-27870431 GAAAGAAAACAAAGGAAGGAAGG - Intergenic
1006081394 6:31569430-31569452 CAGAGAAAAAGAAAGGAGCAGGG + Intergenic
1006200891 6:32289401-32289423 CATAGGAAAGAAAAGCAGAAAGG - Intronic
1006216643 6:32449331-32449353 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1006244026 6:32714177-32714199 CAGAGAAAACAAAAAGATAATGG - Intergenic
1006564425 6:34942840-34942862 AAAAGAAAAGAAAAGAAGGATGG - Intronic
1006755250 6:36409864-36409886 GAAAGAAAAGAAAAGAAGGAAGG + Intronic
1006972869 6:38065016-38065038 GAGAGCAAAGAAAAGCAGGGAGG + Intronic
1007805610 6:44443105-44443127 AAAAGAAAAGAAAAGAAGGAAGG - Intronic
1007955296 6:45912493-45912515 AAGAGAAAAGGAAAGAAGGAGGG + Intronic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008175263 6:48260977-48260999 TAGAAAAAAGAAAAGCAGCAAGG + Intergenic
1008311362 6:49978788-49978810 CAGAGAAAAAAAAATCAAGTAGG + Intergenic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1008752115 6:54747504-54747526 AAGAGAAAAAAAAAGGATGAAGG - Intergenic
1008988793 6:57578656-57578678 AACAAAAAACAAAAGAAGGAAGG - Intronic
1009044049 6:58216356-58216378 CAGATAGAACAAAAACAGCAGGG + Intergenic
1009219877 6:60970624-60970646 CAGACAGAACAAAAACAGCAGGG + Intergenic
1009443691 6:63713456-63713478 CAGAGACAGAAAAAGCAGGGAGG + Exonic
1009492629 6:64311716-64311738 CACAGCAAGCCAAAGCAGGATGG + Intronic
1009509647 6:64533439-64533461 CAGAAAAAATAAAAGCAGCAGGG + Intronic
1009839053 6:69043213-69043235 AAGAGACAAGAAAAGAAGGAAGG + Intronic
1009866148 6:69399998-69400020 CAGAGAAAAAAAAAGAAGAATGG + Intergenic
1009954264 6:70433421-70433443 CAGACAAATGAAAACCAGGATGG + Intronic
1010345889 6:74810508-74810530 AAGAGAAAAGAAAAGAAAGAAGG + Intergenic
1010381077 6:75225468-75225490 CAGAAAATCAAAAAGCAGGAAGG + Intergenic
1010738709 6:79472797-79472819 CAGAGAAAACAAGGAAAGGAGGG - Intergenic
1010839877 6:80636330-80636352 CACAGAAAACAAAAAGAGAAGGG + Intergenic
1011010727 6:82701231-82701253 AAAAGAAAAAAGAAGCAGGAAGG - Intergenic
1011193885 6:84763382-84763404 CAGAGAAATCAAGAGGAGAAGGG + Intronic
1011383870 6:86772433-86772455 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1011754142 6:90482194-90482216 TTAAGAAAACAGAAGCAGGAAGG - Intergenic
1012047635 6:94298668-94298690 AAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1012055589 6:94404861-94404883 GAGAGAAAAATAAAGCATGAAGG + Intergenic
1012074869 6:94670863-94670885 AAGAACAAACAAATGCAGGAAGG + Intergenic
1012100028 6:95071884-95071906 CAAAGAAAATAAAAGGAAGAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012231718 6:96768259-96768281 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1012917570 6:105187012-105187034 CACTGAAAACAAAAGCAAAAGGG - Intergenic
1013480376 6:110547821-110547843 CAAAGAAATTAGAAGCAGGAAGG - Intergenic
1013669904 6:112389490-112389512 CAGAGAACAAAAAAGCATGTGGG - Intergenic
1013718317 6:112990661-112990683 CAGAGAAAACAAACGGAAAATGG - Intergenic
1013924148 6:115447918-115447940 ATTAGAAAATAAAAGCAGGACGG - Intergenic
1014041295 6:116829488-116829510 CAGGAAAAATAAAAGCAGGATGG - Intergenic
1014300566 6:119676517-119676539 AATAGAAACCTAAAGCAGGAAGG + Intergenic
1014312231 6:119818428-119818450 CAGATAAAAGAAAAGAAGGGTGG + Intergenic
1014489491 6:122044679-122044701 CAGAGGAAAAAAAAGGGGGAGGG - Intergenic
1014499425 6:122166645-122166667 CAGATAAATCAAAAGAAAGATGG + Intergenic
1014666559 6:124244718-124244740 AACAGAAAACAAAAGTAAGAAGG - Intronic
1014853905 6:126375744-126375766 GAGAAAAAAGAAAAGCAGAAAGG - Intergenic
1014870475 6:126589656-126589678 CACAGAAACCAAAAGCAGGCAGG - Intergenic
1016384466 6:143516895-143516917 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1016834134 6:148460054-148460076 CAGACAGAACAAAAGGAGGCAGG + Intronic
1017138765 6:151171610-151171632 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1017200951 6:151754660-151754682 CAGAGAAAGAAAAACCAGGAGGG - Intronic
1017726480 6:157279598-157279620 GAGAAAAAAGAAAAGAAGGAGGG + Intergenic
1018177176 6:161187065-161187087 CAGATAAAACAAAGTCAGCAAGG - Intronic
1018477271 6:164156019-164156041 CAGAGACTCCAAAAGCTGGAAGG + Intergenic
1018723255 6:166589954-166589976 CACAGAAAACAAGAACAGGAAGG + Intronic
1018943454 6:168327373-168327395 CAGAAAAAATAAAATCAGAAAGG - Intergenic
1019027748 6:168985362-168985384 CAAAGAAAACAAAGTCAAGATGG + Intergenic
1019104405 6:169656771-169656793 CAGAGAAGACAACAGCAAGTGGG - Intronic
1019242105 6:170675805-170675827 TACAGAAAACAAAAGCAAAATGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019377520 7:701187-701209 AAAAGAAAAGAAAAGAAGGAAGG + Intronic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1019797571 7:3063157-3063179 CAGAGCAAACACAAGCTAGAAGG + Intergenic
1019952238 7:4383071-4383093 CAGGGAAAACTAATGCGGGAGGG - Intergenic
1020202779 7:6093267-6093289 GAGAGAGAAGAAAAGAAGGAAGG - Intergenic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1020835693 7:13147776-13147798 TAGAGAAAAAAAAAAAAGGAGGG - Intergenic
1020865799 7:13560712-13560734 CAGACAAAGGAAAAGAAGGAAGG + Intergenic
1020918338 7:14227582-14227604 CACAGAAAATAGAAGAAGGAAGG + Intronic
1020936984 7:14478238-14478260 AATAGAAAACAAAAACAGGATGG + Intronic
1021105654 7:16636664-16636686 CAGTGAAAATAAAAACAAGATGG - Intronic
1021127729 7:16872639-16872661 CAAAGGAAACAAAAGCATAAGGG + Intronic
1021145665 7:17085630-17085652 CAAAAAAAAAAAAAGAAGGAAGG - Intergenic
1021265929 7:18522565-18522587 CTGAAAAAAAAAAAGCAGGGTGG + Intronic
1021296022 7:18906984-18907006 AAGAGAAAACACAAGATGGAAGG + Intronic
1021401267 7:20212434-20212456 AAGAGAAAACAAAACCTGGGAGG + Intronic
1021731739 7:23601980-23602002 CAGAGAAAAGTAAAACAGGCTGG - Intronic
1021893102 7:25206580-25206602 AAGAGAAAAAAAAAGCAGACAGG + Intergenic
1022076785 7:26979153-26979175 AAGAAATAACAAAAGCAGGCTGG - Intronic
1022109260 7:27218278-27218300 CATAGAACACAAATGAAGGATGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022303293 7:29121837-29121859 CAACAAAAACAAAAACAGGAAGG + Intronic
1022312528 7:29210677-29210699 TGGAGAAAAATAAAGCAGGAAGG + Intronic
1022420459 7:30216160-30216182 GAGAGGAAAGAAAAGAAGGAAGG + Intergenic
1023155582 7:37248420-37248442 CAGAGAAAGCAAAAGGAGTGAGG + Intronic
1023222906 7:37938608-37938630 CAGTTAAAGCAAAAGCAGGCTGG - Intronic
1023260382 7:38352980-38353002 AAGAGAAAAGCAAAGAAGGAAGG + Intergenic
1023261354 7:38362129-38362151 AAGAGAAAAGCAAAGAAGGAAGG + Intergenic
1023363650 7:39441425-39441447 CAGAGAAAGCAAGAGGAGCAAGG + Intronic
1023370014 7:39503754-39503776 AAGAGAAAAGAAAGGAAGGAAGG + Intergenic
1023884081 7:44339452-44339474 AAGAGAAAAGAAAGGAAGGAAGG - Intergenic
1023963306 7:44946109-44946131 CCCAGAAAACAAAAGCAAGATGG + Intergenic
1024355656 7:48411286-48411308 AAAAGAAAAGAAAAGAAGGAAGG - Intronic
1024378744 7:48669780-48669802 CAGATCAAACATGAGCAGGAAGG + Intergenic
1024528634 7:50371874-50371896 CAGAAAAAAGAAAAACAGAAGGG - Intronic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024859893 7:53826275-53826297 AAGAGAAAAGAAAAGAAGGAGGG + Intergenic
1024985656 7:55191377-55191399 CAGATAAACCACATGCAGGAAGG + Intronic
1025015330 7:55434829-55434851 TAGTGAACAGAAAAGCAGGACGG + Intergenic
1025321594 7:58100196-58100218 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1025474739 7:60905453-60905475 CAAAGAAATAAAAAGAAGGAAGG + Intergenic
1025512264 7:61584421-61584443 CAAAGAAATAAAAAGAAGGAAGG - Intergenic
1025551202 7:62252021-62252043 CAAAGAAATAAAAAGAAGGAAGG - Intergenic
1025565822 7:62432932-62432954 CAAAGAAAGAAAAAGAAGGAAGG + Intergenic
1026178614 7:68019247-68019269 CAGAGAAGACATAAGTAGCATGG + Intergenic
1026192237 7:68140087-68140109 GAGAGAAAGCAAAAGAGGGAGGG + Intergenic
1026255631 7:68708860-68708882 CAGAGAAAAAATAAGCAAGCAGG - Intergenic
1026265008 7:68788564-68788586 AAAAGAAAACAAAATCAGGCCGG + Intergenic
1026812236 7:73477993-73478015 CAAAGAAAACAAAGACAGGGAGG - Exonic
1026967460 7:74449313-74449335 GAGAGAAAAAGAAAGAAGGAAGG - Intergenic
1027234565 7:76290476-76290498 AAGAAAAGAAAAAAGCAGGAGGG - Intergenic
1027438830 7:78196503-78196525 GTGTGAAAACTAAAGCAGGACGG - Intronic
1027583646 7:80028933-80028955 AAGAGAAAACAAAGAAAGGAAGG - Intergenic
1028522893 7:91752221-91752243 CAGAAATAGAAAAAGCAGGAAGG + Intronic
1028523158 7:91753987-91754009 CAGGGAAAACAAAACCAAGATGG + Intronic
1028889147 7:95967448-95967470 CAAAGGAAACAAAAGCACAAGGG - Intronic
1028930119 7:96403726-96403748 AAACAAAAACAAAAGCAGGAAGG + Intergenic
1029006768 7:97219071-97219093 CAGAGAAACCTAAAGCACGATGG + Intergenic
1029191553 7:98775787-98775809 GAAAGAAAAGAAAAGCAAGAAGG + Intergenic
1029290386 7:99497982-99498004 CGCAGAAAGCAAAACCAGGAAGG + Intronic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1030011572 7:105173728-105173750 CAGAGAACAGAAAAGGAGTATGG + Intronic
1030023272 7:105296854-105296876 AAGAGAAAACTAAAGCAGAGAGG + Intronic
1030185241 7:106755269-106755291 CATAGCAAACTAATGCAGGAAGG + Intergenic
1030300955 7:107974285-107974307 CAAGGAAAACAAAATCTGGAAGG - Intronic
1030580322 7:111347120-111347142 CAGAGAGAACAGAGGCAGAAAGG + Intronic
1030605118 7:111632529-111632551 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
1030722179 7:112883297-112883319 CAGACAAAAGGAAAGAAGGATGG - Intronic
1030737131 7:113062563-113062585 CAGGCAAAGCAAAAGCAGGCTGG + Intergenic
1030962646 7:115946663-115946685 AAAAGAAAAGAAAAGAAGGAAGG - Intronic
1031415504 7:121491541-121491563 GAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1031469150 7:122148182-122148204 GAGAGAAAACCAAAGTAGGTGGG - Intergenic
1031526877 7:122833101-122833123 CAGACAGAACAAAGGCTGGAAGG - Intronic
1032496699 7:132368313-132368335 GAGAGAAAAGAAAAGCAACAAGG + Intronic
1032759053 7:134920928-134920950 CAGAGAAAACAAAAGGCTCAAGG - Intronic
1032820165 7:135517155-135517177 CAGAGAACACAAAGGCAGAGTGG + Intergenic
1033127332 7:138717609-138717631 CAGAGATAACAAAACAAGGCCGG + Intronic
1033166236 7:139040887-139040909 CAGAGAGCTCAAAAGCAGGCTGG + Intergenic
1033184850 7:139218106-139218128 CAGAAAAAAACAATGCAGGATGG - Intergenic
1033196835 7:139334896-139334918 CACAGACAGCAAAAGCAAGATGG + Intergenic
1033444754 7:141410540-141410562 AAAAGAAAAGAAAAGAAGGAAGG - Intronic
1033526185 7:142216129-142216151 CAGAGAGGCCAAATGCAGGATGG - Intronic
1033993864 7:147321168-147321190 CAGAGAGAAGAAAAGGAGGGAGG - Intronic
1034031094 7:147764430-147764452 CAGAGAAGATAAAATCAGGGAGG - Intronic
1034212521 7:149376606-149376628 CTAAGAAAAGAAAAGAAGGAAGG - Intergenic
1034242106 7:149618505-149618527 AAGGGAAAACCAAAGCAGGTGGG + Intergenic
1034380292 7:150686440-150686462 CAGGCAAAACAAAAACAGAAGGG + Intronic
1034400765 7:150860188-150860210 AAAAGAAAAGAAAAGAAGGAAGG + Intronic
1034920709 7:155078944-155078966 GAAAGAAAAGAAAAGAAGGAAGG - Intronic
1035088693 7:156285649-156285671 CAAACAAAACAAAACCAAGATGG + Intergenic
1035506013 8:132295-132317 TACAGAAAACAAAAGCAAAATGG + Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036511328 8:9403089-9403111 CACAAAAAAGAAAAGCAGGCAGG + Intergenic
1036565043 8:9931283-9931305 CAGAGACCACAAAGCCAGGAAGG - Intergenic
1036574454 8:10013236-10013258 CAGAGTGCACAAAAGCAGGCAGG - Intergenic
1036731969 8:11273770-11273792 AAAACAAAACAAAAGCAAGAAGG - Intergenic
1036771575 8:11582044-11582066 CAAACAAAACAAAAGAAGGAAGG + Intergenic
1037011212 8:13845120-13845142 CAGAGAAAAAAAAACCATCATGG - Intergenic
1037279452 8:17220702-17220724 CAGAGGAAAAAAAAGAAGTATGG - Exonic
1037344466 8:17884096-17884118 GAAAGAAAAGAAAAGAAGGAAGG - Intronic
1037480220 8:19298170-19298192 TAGAGGACACAAAAGCAGAAAGG + Intergenic
1037481049 8:19306029-19306051 AAGAGAAAATAAAAATAGGACGG + Intergenic
1037530439 8:19767549-19767571 AAAAGAAAAAAAAAGTAGGAAGG - Intergenic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037656152 8:20885953-20885975 CAGAGAGAAGAAAAGAAGGATGG + Intergenic
1037726200 8:21484432-21484454 CAGGGAAAATCAAAGCAAGAGGG + Intergenic
1038432141 8:27508938-27508960 AAAAAAAAAAAAAAGCAGGATGG - Intronic
1038534712 8:28345755-28345777 CAAAAAAAAAAAAAGCAAGAGGG - Exonic
1038590403 8:28832200-28832222 GAGAGAAAAGAAAAGAAGGGAGG + Intronic
1038831051 8:31061049-31061071 AAGAGAAAAGAATAACAGGATGG - Intronic
1038865994 8:31439473-31439495 AAGAGAAGACAAAGGCATGAGGG + Intergenic
1039011582 8:33099357-33099379 TGGAGAATACAAGAGCAGGAGGG + Intergenic
1039041320 8:33411229-33411251 CAAATAACACAAAATCAGGATGG + Intronic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039272765 8:35900825-35900847 CAGACAGAAGAAAAGAAGGAAGG - Intergenic
1039320155 8:36420744-36420766 CAGATAACACAAAAAAAGGAAGG - Intergenic
1039376471 8:37039429-37039451 GAGAAATAACCAAAGCAGGAAGG + Intergenic
1039459434 8:37731102-37731124 TAGAGAAAAGAAGAGCAGTAGGG + Intergenic
1039588022 8:38723023-38723045 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1039593079 8:38767180-38767202 TTGAGAAAACAAAACTAGGAAGG + Intronic
1039865289 8:41495577-41495599 CAGAAAAAAAAAAATCAGGCTGG - Intronic
1039946095 8:42129770-42129792 AAGAGAAGAGAAAAGAAGGAAGG - Intergenic
1040108048 8:43551077-43551099 CCAAGAAAAAAAAAGCAGGCAGG - Intergenic
1040441736 8:47450285-47450307 AAGAGAGCACAAAAGCAAGAGGG + Intronic
1040444360 8:47478422-47478444 CAGAGACAGAAGAAGCAGGAAGG + Intronic
1040506516 8:48053800-48053822 CAAAAAAAAAAAAAACAGGAAGG - Intronic
1041195077 8:55393548-55393570 CAAACCAAACAAAAGCAGAAAGG - Intronic
1041503213 8:58562086-58562108 CAGTGAAACAAAAAGCATGATGG + Intronic
1041744038 8:61186647-61186669 AAGAGAAGACAAAAGAAGGGAGG + Intronic
1041915819 8:63137836-63137858 CAAAGACAACAAAAGCAAAATGG - Intergenic
1042165103 8:65937728-65937750 GAGAGAAAAGAAAGGAAGGAAGG - Intergenic
1042420613 8:68584295-68584317 CTGAGAAAAAAAAAGTTGGATGG + Intronic
1042420991 8:68589420-68589442 GAGAGAAAATAAAAGAAGGAAGG + Intronic
1042584377 8:70318763-70318785 AAAAGAAAAAAAAAGAAGGAGGG + Intronic
1042732696 8:71954859-71954881 CTGAGGAAGCTAAAGCAGGAGGG - Intronic
1043081935 8:75776859-75776881 CAGAGATACCAAAAGAAAGAAGG - Intergenic
1043454172 8:80397223-80397245 CAGAGCAAACAAAAGCCTCATGG - Intergenic
1043572816 8:81624452-81624474 CAGTGAAACTAAAAGCAAGAAGG + Intergenic
1043722282 8:83559762-83559784 GAGAGAAAAGAAAAAAAGGAAGG - Intergenic
1044083994 8:87921155-87921177 CAGATAGAACAAAAAGAGGAAGG + Intergenic
1044295613 8:90523727-90523749 CAGAGAAAAATAAAGCAAGAGGG + Intergenic
1044422929 8:92019400-92019422 CAGAGAAAGGAAGAGCAGGAGGG + Intronic
1044947497 8:97403633-97403655 CAAAGCAAACAAAAACATGAAGG - Intergenic
1045087416 8:98701231-98701253 AAGAGAAAAGAAAAGAAAGAGGG + Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045582374 8:103496157-103496179 CAGATAAAAAACAAACAGGATGG - Intergenic
1045615656 8:103907515-103907537 CAGAGAAAAAAAAGGAAGGAAGG - Intronic
1045638255 8:104218287-104218309 AAAAGAAAAAAAAAGCAGTAAGG - Intronic
1045850605 8:106693334-106693356 CAGGGAAAAACAAAACAGGAAGG + Intronic
1046186522 8:110728440-110728462 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1046236292 8:111428006-111428028 GAAAGAAAATAAAAGAAGGAAGG - Intergenic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1046860279 8:119083672-119083694 GATAGGAAACTAAAGCAGGAAGG + Intronic
1046959999 8:120101563-120101585 AAGAGAAAAAGAAAGAAGGAAGG - Intronic
1047354887 8:124111179-124111201 AAGAGAAAAGAAAAGGGGGAAGG + Intronic
1047388225 8:124429175-124429197 GAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1047556971 8:125942120-125942142 CAGAAAAACCAGAAACAGGAAGG - Intergenic
1047621907 8:126616533-126616555 CAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048391561 8:133970583-133970605 GAGAGAAAATAAAGGAAGGAAGG + Intergenic
1048391589 8:133970851-133970873 GAAAGAAAAGAAAAGAAGGACGG + Intergenic
1048525472 8:135198384-135198406 GAGGGAAAAGAAAAGAAGGAAGG + Intergenic
1048719199 8:137303627-137303649 CAAAGAAGAGAAAAGCATGAAGG - Intergenic
1049103933 8:140599465-140599487 CTGAAAGAAGAAAAGCAGGAGGG + Intronic
1049133897 8:140876098-140876120 CACATAAAACATAAGCAGAAAGG - Intronic
1049582155 8:143417679-143417701 GAAAGAAAAGGAAAGCAGGATGG - Intergenic
1050242793 9:3656128-3656150 CACAGAAACCAAAAGCAAGCAGG - Intergenic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1050846977 9:10233336-10233358 CAGAGAACACAAAACAATGAAGG - Intronic
1051251435 9:15162651-15162673 CAAAGGAAAGACAAGCAGGAAGG + Intergenic
1051328556 9:15999313-15999335 GAAAGAAAAGAAAAGAAGGAGGG + Intronic
1051580669 9:18670373-18670395 CAGAGGTAACCTAAGCAGGATGG + Intronic
1051647696 9:19286027-19286049 AAGAAAAAACAAAAGCAGCTGGG + Intronic
1051796145 9:20872600-20872622 AAGAGAAAAGAAAGGAAGGAAGG - Intronic
1051813479 9:21076849-21076871 AAGAGAAAAGGAAAGCTGGAGGG - Intergenic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1052256209 9:26459848-26459870 AAGAGAAAAAAACAGCAGAAAGG + Intergenic
1052767869 9:32660086-32660108 CTGTGAAATCAAAAGCAGGTTGG + Intergenic
1052790940 9:32875084-32875106 CAGAAAAAAAAAAAGGGGGATGG + Intergenic
1053025271 9:34724066-34724088 CAGAGGAAACCAAAGCAGCCAGG - Exonic
1053036799 9:34833128-34833150 CAGAGGAAACCAAAGCAGCCAGG - Intergenic
1053039795 9:34860560-34860582 GAGAGAAAAAAATAGAAGGAAGG - Intergenic
1053466817 9:38314628-38314650 GGGAGAGAACAAAAGAAGGAGGG - Intergenic
1053508815 9:38669558-38669580 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1053616135 9:39768348-39768370 ACCAGAAAACAAAAGCAGCAGGG + Intergenic
1053874306 9:42527649-42527671 ACCAGAAAACAAAAGCAGCAGGG + Intergenic
1053885465 9:42642248-42642270 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1053898309 9:42766933-42766955 ACCAGAAAACAAAAGCAGCAGGG - Intergenic
1053944465 9:43292208-43292230 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1054224484 9:62449697-62449719 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1054237382 9:62574042-62574064 ACCAGAAAACAAAAGCAGCAGGG - Intergenic
1054268028 9:62939105-62939127 ACTAGAAAACAAAAGCAGCAGGG - Intergenic
1054408543 9:64785528-64785550 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1054551517 9:66608553-66608575 ACCAGAAAACAAAAGCAGCAGGG - Intergenic
1054771594 9:69088868-69088890 CTCAGAAAACAAGAGGAGGAAGG + Intronic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1055343447 9:75309351-75309373 GAGAGCAAAGAAAAGCAGGATGG - Intergenic
1055513790 9:77018366-77018388 CAGAGAGAAGAGAAGCAAGAAGG + Intergenic
1055542433 9:77325548-77325570 AAGAGAAAACAAAGGGAAGATGG - Intronic
1055650031 9:78398122-78398144 AAGAGAATACAAAATCAGAATGG - Intergenic
1055684656 9:78758432-78758454 GAAAGAAAAAAAAAGCAGGCTGG + Intergenic
1055756140 9:79559669-79559691 GGGAGAAAAAAAATGCAGGATGG + Intergenic
1055966416 9:81869314-81869336 CAAAAAAAAGAAAAGAAGGAAGG - Intergenic
1056164135 9:83925316-83925338 CTGAGAAAAAAAAAGGGGGAGGG + Intergenic
1056617942 9:88184439-88184461 CAAAGAAAACAAAACTAGTAAGG + Intergenic
1056645642 9:88409289-88409311 AAGAAAAAAGAAAAGCAGGCCGG - Intronic
1056694424 9:88834048-88834070 CACAGAAAAAAAAATAAGGAAGG + Intergenic
1056755616 9:89380327-89380349 AAAAGAAAACAAAAGCTGGCCGG - Intronic
1056882616 9:90412381-90412403 CAGAAAAGACTAATGCAGGAAGG - Intergenic
1057229487 9:93311093-93311115 CAGAGAGACCAGAAGCAGAATGG - Intronic
1057368102 9:94442913-94442935 AAGAAAAAACAAAAACAAGAAGG + Intronic
1057465472 9:95310365-95310387 AAGAGAAAAAAAAAAAAGGAGGG + Intronic
1057470999 9:95356144-95356166 CAGAGAAAGCAACAGCAGAGAGG - Intergenic
1058130354 9:101245669-101245691 CAGAGAAAACAAAAGAACCTGGG - Intronic
1058297198 9:103324045-103324067 GAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1058475888 9:105332616-105332638 CAAAGAAAACAAGAACAGGAGGG - Intronic
1058670663 9:107358182-107358204 CACAGAAAACACAGGAAGGAAGG - Intergenic
1058832095 9:108827712-108827734 CAGAGCAAACAAAAACAAAATGG + Intergenic
1058925111 9:109655620-109655642 CACAGAAACCAAAAGTAGAATGG - Intronic
1058984722 9:110200113-110200135 GAGAGAAAAGATAGGCAGGAAGG + Exonic
1059316925 9:113433815-113433837 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1059552663 9:115245096-115245118 CACAGAGAAAAAAAGGAGGAAGG - Intronic
1059602613 9:115796588-115796610 GAAAGAAAACAAAAAAAGGAAGG + Intergenic
1059796687 9:117705132-117705154 GAGAGAAGAAAAAAGCAAGAGGG + Intronic
1059828634 9:118065116-118065138 CAAAGCAAACAAAAACATGAAGG - Intergenic
1059976684 9:119725189-119725211 CAGACAAAACAAAAGCTTGGAGG - Intergenic
1060030941 9:120214274-120214296 AAGAGAAAAGAAGAGAAGGAGGG + Intergenic
1060476377 9:123989861-123989883 AAGAGGAAAAAAAAGAAGGAAGG + Intergenic
1060809305 9:126601652-126601674 CAGAGACAGAAAAAGCAGAACGG + Intergenic
1060970811 9:127736661-127736683 AAGAGAAAAGAAAGGAAGGAGGG + Intergenic
1061286051 9:129623332-129623354 CAAAAAAAAAAAAAGAAGGAAGG + Intronic
1061364822 9:130167023-130167045 CAGAAAAAACAAAACCAGGCCGG - Intergenic
1061368279 9:130183794-130183816 GAAAGAAAAGAAAAGAAGGAGGG - Intronic
1061500612 9:130999502-130999524 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1061551149 9:131335338-131335360 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1061818963 9:133212927-133212949 CAAAAAAAACAAAAACAGGCTGG + Intergenic
1062517007 9:136941863-136941885 CAGTGAAAACAAACGCAGGCAGG - Intronic
1203587601 Un_KI270747v1:20786-20808 CAAAGAAAGAAAAAGAAGGAAGG - Intergenic
1203602296 Un_KI270748v1:25039-25061 TACAGAAAACAAAAGCAAAATGG - Intergenic
1185578543 X:1192811-1192833 AAGAAAAAAAAAAAGAAGGAAGG - Intronic
1185680039 X:1881038-1881060 AAGAGAAAAGGAAAGAAGGAAGG + Intergenic
1185686720 X:1934884-1934906 AAAAGAAAAGAAAAGGAGGAGGG + Intergenic
1185855246 X:3528268-3528290 AAGAGAAAAAAAAAAAAGGACGG + Intergenic
1186039949 X:5464658-5464680 CAAAGAAAAGAAAGGAAGGAAGG + Intergenic
1186383460 X:9085587-9085609 CCCAGAAAACAAAAGAAGGGAGG - Intronic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186679728 X:11859711-11859733 AACAAAAAACAGAAGCAGGATGG - Intergenic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187478389 X:19632200-19632222 CAGAGAAAAGCAAAGCAGTCAGG - Intronic
1187571636 X:20509619-20509641 AGAAGAAAACAAAGGCAGGAGGG + Intergenic
1187777853 X:22783948-22783970 AAGAGAAAAGAAAAGCTGGGAGG - Intergenic
1187909662 X:24099520-24099542 CATAGAAATAAAAAGCAGAATGG - Intergenic
1187979198 X:24736835-24736857 CATAGAAACAAAAAGCAGAATGG - Intronic
1188338974 X:28975763-28975785 TAGAGAAAGATAAAGCAGGAAGG + Intronic
1189000294 X:36937089-36937111 AAGAGAAAAGAAAGGAAGGAAGG + Intergenic
1189206503 X:39243892-39243914 TAGAAAAACCAAAAGCAGTATGG - Intergenic
1189252248 X:39610375-39610397 CAGGGACAACAAAAGAAGTAGGG - Intergenic
1189253307 X:39618256-39618278 TAAAGAAAACAAAAGTAGGGAGG + Intergenic
1189577786 X:42373755-42373777 AAGAAAAAAAAAAAGCAGGATGG + Intergenic
1189888477 X:45574807-45574829 AACAAAAAACAAAAGCATGAAGG - Intergenic
1189961192 X:46326420-46326442 AAGAGAAAACACTAGGAGGATGG - Intergenic
1190068374 X:47259166-47259188 AAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1190121155 X:47660118-47660140 GAGAGAAAAGAAAGGAAGGAAGG - Intergenic
1190165500 X:48070242-48070264 AAGAGAAGCCAAAAGCTGGAAGG + Intronic
1190241948 X:48663786-48663808 AAGAAAAAAAAAAAGAAGGAAGG - Intergenic
1190783129 X:53618175-53618197 CAGTGAAAACGAAAGCAAAAAGG + Intronic
1190914421 X:54799989-54800011 TAGAGAAAACAAAACAATGAAGG + Intergenic
1190994980 X:55598064-55598086 CAGAGAAAAAATAAGAAGAATGG - Intergenic
1191857166 X:65636438-65636460 TAGAGAAATGAAAAGCAGGCTGG + Intronic
1192240298 X:69323064-69323086 CAGAGCAAGGAAAGGCAGGAGGG + Intergenic
1192524446 X:71829658-71829680 AAAAGAAAAGAAAAGCAGGATGG + Intergenic
1192545041 X:72006167-72006189 CAGAGAGACCAAAAGCAGAAAGG - Intergenic
1192595467 X:72403182-72403204 TATAGAAAACAAAAGCAAAATGG - Intronic
1192718821 X:73670204-73670226 CACAGAGAACAAAAGCAGGGTGG - Intronic
1192833826 X:74778428-74778450 AAGAAAAAAGAAAAGAAGGAAGG - Intronic
1193190456 X:78564041-78564063 TAGAGCAAGGAAAAGCAGGATGG - Intergenic
1193410505 X:81157189-81157211 TAGATAAAGCTAAAGCAGGAGGG + Intronic
1193515527 X:82457379-82457401 CAGAGAAACCAAAGTGAGGAGGG - Intergenic
1194078784 X:89432194-89432216 CAGAAAGAAAGAAAGCAGGAAGG - Intergenic
1194177145 X:90664990-90665012 GAGAGCAAGGAAAAGCAGGATGG + Intergenic
1194215502 X:91126128-91126150 CAAAGCAGAAAAAAGCAGGAAGG - Intergenic
1194905687 X:99574378-99574400 AAGAAAAAACAAAAACAGGGAGG - Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195536821 X:106017764-106017786 CAGAGAAAAAAAAAACCTGAGGG - Intergenic
1195793764 X:108621149-108621171 CAAAAAAAAAAAAAGAAGGAAGG - Intronic
1195828649 X:109031351-109031373 AAGAGAAAACAAATGAAGAACGG - Intergenic
1195878990 X:109573134-109573156 CAGACAAAATAATACCAGGAAGG + Intergenic
1196367986 X:114944513-114944535 TTGAGAAAACTGAAGCAGGAAGG - Intergenic
1196402752 X:115333186-115333208 CAGAGAAATGAAAAGTAGAATGG - Intergenic
1196638073 X:118027023-118027045 CAGTCAAAACAAAAGCAGACTGG + Intronic
1196939433 X:120760979-120761001 CAGAGAAAAGGAAGGAAGGAAGG - Intergenic
1197011340 X:121568094-121568116 CTGACAAAACAAACCCAGGAAGG - Intergenic
1197317046 X:124979770-124979792 AAGAAAAAATAAAAGAAGGAAGG + Intergenic
1197402044 X:126005065-126005087 CGGAGAAAAGCAAGGCAGGAAGG + Intergenic
1197419159 X:126216680-126216702 AAGAAAAAACAAAAGTAGCATGG - Intergenic
1197521297 X:127500665-127500687 GAGAGAAAATAGAAGCCGGAAGG + Intergenic
1198082413 X:133252344-133252366 AAGAGAAAAGAAAAGAAAGAAGG + Intergenic
1198092873 X:133349265-133349287 CGGAGAAAGCAAAAGGAAGAAGG + Intronic
1198257611 X:134938250-134938272 CAGAGCAAACCAAACCAGAATGG + Intergenic
1199223225 X:145340936-145340958 GAGAAAAAACAAAAGCCTGACGG + Intergenic
1199317544 X:146398610-146398632 AAGAGAAACCAAAAGCAAGCAGG - Intergenic
1199717731 X:150518260-150518282 CAGAGAGAAAGAAAGCAAGAAGG + Intergenic
1200158469 X:153991380-153991402 GAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1200431406 Y:3087526-3087548 CAGAAAGAAAGAAAGCAGGAAGG - Intergenic
1200725187 Y:6661221-6661243 GAGAGAAAAAAAAAACAGGATGG - Intergenic
1201254391 Y:12092614-12092636 AAGAGAAAAGAAAAGAAGGAAGG + Intergenic
1201387729 Y:13461135-13461157 CAAAGAACAAAAAAGAAGGAAGG + Intronic
1201482266 Y:14452317-14452339 CAGAGAAACCAAAAGCTGAGGGG + Intergenic
1202193521 Y:22270832-22270854 AAAAGAAAAAAAAAGCAGAAAGG + Intergenic
1202597827 Y:26561646-26561668 CAAAAAAAACAAAAACAGGCTGG - Intergenic