ID: 970451616

View in Genome Browser
Species Human (GRCh38)
Location 4:16172506-16172528
Sequence CTCCTAGAATTTTGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970451616 Original CRISPR CTCCTAGAATTTTGGAAAAA TGG (reversed) Intronic
902061958 1:13652151-13652173 ATCATAGATTTTTAGAAAAAAGG - Intergenic
902319041 1:15646730-15646752 CTCCTAAAACATTGCAAAAAAGG - Intronic
902586493 1:17442045-17442067 CACCCAGAATTTTGGAAATGTGG + Intergenic
905616143 1:39400905-39400927 CTTCTTGAAAATTGGAAAAATGG + Intronic
906051640 1:42879534-42879556 TTTCTAGAATTTTGTATAAATGG + Intergenic
906143758 1:43548277-43548299 CTCCTAGGATTCTGGGTAAATGG - Intronic
906389603 1:45402829-45402851 CTCTCATAATTTTGGAAGAAAGG + Intronic
906549089 1:46646913-46646935 TTTGTAGAATTTTGTAAAAACGG + Intronic
907343674 1:53756305-53756327 CTCATAGACCTTTGGAAAAGAGG + Intergenic
908914480 1:69110012-69110034 TTCCTTAAATTTTGGAAGAATGG + Intergenic
909022756 1:70450247-70450269 CTCCTTGAATTTAGGAAATCTGG - Intergenic
909665922 1:78133407-78133429 CACCTAGGATCTTGGCAAAATGG - Intronic
910426270 1:87122559-87122581 ATCCCACAATTTTGGAAACATGG + Intronic
910706046 1:90130802-90130824 CACCTAGAGTTTAGGAAAAGAGG - Intergenic
910958580 1:92735318-92735340 TTTCTAGAATTTTGTAGAAATGG - Intronic
911168544 1:94746395-94746417 CTCCAAGAATTCTGGTTAAAAGG - Intergenic
911677514 1:100676163-100676185 CTCCTGGAATTTTGGAAGAAAGG - Intergenic
912030317 1:105233456-105233478 TTTCTAGATTTTTGGGAAAATGG - Intergenic
912653063 1:111458329-111458351 CTCCTGCAATTTTGTAGAAAGGG - Intronic
913269868 1:117082631-117082653 CTTCTAGAATTTCAGAAACATGG - Intronic
913312581 1:117516325-117516347 TTCCTAGAATTTTGTGAAAATGG - Intronic
914954744 1:152151435-152151457 CTGCTAGAATCATGGAAAGAAGG + Intergenic
915203933 1:154255132-154255154 CACCTAGAAATTTAGAAGAAAGG - Exonic
916919671 1:169450924-169450946 TTCCTAGCATTTTGGATAAGAGG - Intronic
917548692 1:176000665-176000687 TTCTCAGCATTTTGGAAAAAGGG + Intronic
917833253 1:178915769-178915791 CTCCCAGTATTTTGGAAAACTGG + Intronic
918479856 1:184966823-184966845 CTCAAGGAATTTTGGAAGAAGGG - Intronic
918508955 1:185289298-185289320 TTCCTAGAATTCTGGAATTAGGG + Intronic
919455182 1:197812758-197812780 CTGCTAGTGTTTTGGGAAAAAGG - Intergenic
919561058 1:199119158-199119180 CTGCTAAAATTTTGCAAGAAGGG + Intergenic
919574286 1:199287515-199287537 CTTCTAAAATTTAGAAAAAAAGG + Intergenic
919635619 1:200000434-200000456 ACCCTAGCATTTTAGAAAAATGG - Intergenic
920220491 1:204396176-204396198 CTTCTAGAATTTCAGAAAAATGG - Intergenic
921368044 1:214393398-214393420 CTGCTAGAAGTTTGGAGAAGCGG - Intronic
922321169 1:224488718-224488740 ATCCAAGCATTTTGGAAAGACGG - Intronic
922367919 1:224883305-224883327 CTCCTATATTTTTGGAAAACTGG + Intergenic
922593133 1:226793878-226793900 CTGGAAGATTTTTGGAAAAAAGG - Intergenic
922599815 1:226841450-226841472 CAGCTAGAAATTTGGGAAAAAGG - Intergenic
922778550 1:228230319-228230341 CTTTTCAAATTTTGGAAAAAAGG + Intronic
923387964 1:233484249-233484271 TTCCAAGAAGTTTGGAAAATTGG - Intergenic
923549876 1:234955087-234955109 TTGCTAGAATTTTTAAAAAAAGG - Intergenic
923887072 1:238169725-238169747 CCCCAAGCATTTTGGATAAAGGG + Intergenic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1064341663 10:14491218-14491240 CTGCCAGAAATTTGGAAGAAAGG - Intergenic
1065569852 10:27059393-27059415 GTCCTAGAATTTTATATAAATGG - Intronic
1067733043 10:48827126-48827148 ATCCTAGAATTGTGGAAATAGGG - Intronic
1067983126 10:51110459-51110481 TTTCTAGAATTTTGTATAAATGG - Intronic
1070070999 10:73089742-73089764 TTTCTAGAATTTTATAAAAATGG - Intronic
1072955331 10:99883165-99883187 CTTTTTGGATTTTGGAAAAAGGG + Intronic
1073566833 10:104542338-104542360 CTCCTGGAGTTGTGGAAAAGGGG - Intergenic
1073861233 10:107743960-107743982 CTCTTACATTTGTGGAAAAATGG + Intergenic
1074470218 10:113720067-113720089 CTGCTAGACTTTTGGCAAACTGG + Intronic
1076414245 10:130273892-130273914 CTCCAAGGATTTAGGGAAAAAGG - Intergenic
1077787587 11:5401425-5401447 CTCCTAGAATTTTCAAAACATGG + Intronic
1077792388 11:5455212-5455234 CTCATAGAATTTTGGGGGAAAGG + Intronic
1078058293 11:8025546-8025568 TTCCTAGAGTTTTGTATAAATGG + Intronic
1078641142 11:13098022-13098044 CTCCTAGAAATATGAAAAACAGG + Intergenic
1079941773 11:26689435-26689457 CTTCTAGAATTTTATATAAATGG - Intronic
1080296328 11:30733202-30733224 CTCTTAGAATATTTGCAAAAGGG + Intergenic
1080694728 11:34593110-34593132 CTCCTAAAAATATGGAAAAAAGG - Intergenic
1083755059 11:64787888-64787910 CTCCGAGAAATCTGGAAAATTGG + Intergenic
1086888582 11:92229533-92229555 TTCTTAGAAATTTGGAGAAAGGG - Intergenic
1087316418 11:96608691-96608713 CTTGAAGAATTTTGGAAAGAAGG - Intergenic
1087399702 11:97650184-97650206 CTTCTAGAATTTCAGATAAAAGG + Intergenic
1088001541 11:104887750-104887772 CTCCTATAATTTAGAAAAAAAGG + Intergenic
1088909392 11:114179578-114179600 CTCAAGGAATTTTGAAAAAAAGG + Intronic
1089810358 11:121126382-121126404 CTCCTAATATTTAAGAAAAAGGG - Intronic
1090984607 11:131754962-131754984 TTCCTAGAATTTCATAAAAATGG - Intronic
1091179732 11:133593097-133593119 TTCCTAGAATTTTATATAAATGG + Intergenic
1091247447 11:134110565-134110587 TTCCTAGAATTTTAAATAAATGG - Intronic
1091931271 12:4397444-4397466 CCCAAATAATTTTGGAAAAATGG - Intergenic
1093058563 12:14579428-14579450 ATCATATAATTTTGGAAAATTGG - Intergenic
1093397130 12:18696161-18696183 CCCCAAGAATTTTGGAATATAGG - Exonic
1094308799 12:29053938-29053960 CTTCTAGAATTTTACATAAATGG - Intergenic
1097700242 12:62812758-62812780 ATACTAGATTTTTTGAAAAATGG - Intronic
1098940866 12:76533689-76533711 AGCTTAGAATTTTGGAAAACCGG - Intronic
1099444361 12:82734574-82734596 CTCCTATGATTATGGCAAAAGGG - Intronic
1099445409 12:82745862-82745884 CTTCTTGAATTTAAGAAAAAGGG - Intronic
1099791128 12:87335273-87335295 TTCCTAAAATTCAGGAAAAATGG + Intergenic
1100113688 12:91276680-91276702 TTCCTGGAATTTAGGAAAACTGG + Intergenic
1100614432 12:96220139-96220161 CTCCCAGATTTCTGGAATAAAGG - Intronic
1100912669 12:99383237-99383259 CTGTGAGAATTTTGAAAAAAAGG + Intronic
1101051894 12:100872684-100872706 CAGCTATAATTTTGTAAAAATGG + Intronic
1101058331 12:100943586-100943608 CTCCAAGAGAATTGGAAAAATGG + Intronic
1105792920 13:23820389-23820411 CTCAAATAATTTTGGAAAATGGG - Intronic
1105985816 13:25566023-25566045 CTCTTAAAATTTTGGAAATTTGG - Intronic
1107632660 13:42357716-42357738 CTCCTAGAAGTTTGCAGGAAAGG + Intergenic
1109260964 13:60144582-60144604 ATTCTAGAATTCTGGGAAAATGG - Intronic
1110254695 13:73419865-73419887 CCCCCAGAATTTTGAAAATAAGG + Intergenic
1111229960 13:85331803-85331825 CTCCTAGAATGTAGAGAAAATGG + Intergenic
1111413919 13:87913593-87913615 CTCCCAGAAATTGAGAAAAACGG - Intergenic
1112921381 13:104616804-104616826 CTCCTGCAATTTAGGAAAGAAGG + Intergenic
1113151847 13:107272510-107272532 GGCCTAGAATTTTTTAAAAAGGG + Intronic
1115207836 14:30931318-30931340 CCCCTAGATTTTTTAAAAAAAGG - Intronic
1115819962 14:37203565-37203587 CTACTAGAATATGGCAAAAATGG + Intronic
1115975823 14:38995841-38995863 CTCCTAGAACTTTGGGAAAGAGG - Intergenic
1116051824 14:39813472-39813494 CTCCCTGAATTTTGCAAATAAGG - Intergenic
1116228716 14:42187218-42187240 ATCCTAGAATTTTGGACCTATGG + Intergenic
1116328992 14:43572185-43572207 CTAACAGAATTTTGGAAAAATGG - Intergenic
1117210578 14:53494308-53494330 CTTCAAGACTTTTGGAAAGAAGG + Intergenic
1117594246 14:57310229-57310251 CCCCTAAGATTCTGGAAAAATGG - Intergenic
1119448240 14:74684753-74684775 CTCCTTTAATTTTTGAGAAATGG - Intronic
1119843538 14:77811120-77811142 CACCTAGAATGTTGGAAGTAGGG + Intronic
1120605060 14:86564589-86564611 CCCTTGGAATTTTGGAAATATGG + Intergenic
1121306036 14:92907582-92907604 GTCCTAGAATTTTATATAAATGG + Intergenic
1127402693 15:58605729-58605751 CTTCTTGAGTTTTTGAAAAATGG - Intronic
1127594027 15:60460044-60460066 CACCTAGATTTTTGTAGAAATGG + Intronic
1127718953 15:61681035-61681057 CTCCTAGAATTTGGAAATACTGG - Intergenic
1128821528 15:70660214-70660236 ATCCTAGAAATGTGGAAAGATGG + Exonic
1129004011 15:72357221-72357243 CTCCTAGGCTTTTGCAAAACTGG - Intronic
1129143483 15:73624913-73624935 CTTTTAGAACTTTAGAAAAAGGG - Intronic
1135466200 16:22687069-22687091 TTCCTACAATTTTATAAAAATGG + Intergenic
1135521365 16:23181174-23181196 CTCCTAGGAATTTGGAAATTCGG + Intergenic
1137354692 16:47749635-47749657 TTTCTAGAATTTTGTATAAATGG - Intergenic
1137376597 16:47956934-47956956 CACCCAGAGTTTTGGAAGAAAGG + Intergenic
1137936228 16:52637878-52637900 CTCCATGAATTATGGAAGAAAGG + Intergenic
1139223767 16:65213930-65213952 CTCCTACGGTTTAGGAAAAAAGG - Intergenic
1139577628 16:67852046-67852068 ATCCTAGAATTTTTGATATAAGG - Intronic
1142224581 16:88871377-88871399 TTCCTAGAACTTCGGGAAAATGG + Intergenic
1142944052 17:3410079-3410101 CTCCCAGAATTGTGTAAAGATGG + Intergenic
1143315481 17:6028937-6028959 CTCCTAGAATTTAGTGGAAAAGG + Intronic
1144349464 17:14380843-14380865 CTCATAGCATTTTTGTAAAATGG - Intergenic
1145858954 17:28190769-28190791 TTCTTAGAATTTTAGAAGAAAGG + Intronic
1147207587 17:38848930-38848952 CACCCAGCGTTTTGGAAAAATGG - Exonic
1147610508 17:41799321-41799343 GTCCTAGAATCTTGGAATAATGG - Intergenic
1147802688 17:43104232-43104254 CAGCTATAATTTTGCAAAAAAGG - Exonic
1148822708 17:50369370-50369392 CTACTAAAATTATCGAAAAAGGG + Intronic
1149070257 17:52533110-52533132 CACCTATAATTTTAGAAAATGGG + Intergenic
1149666100 17:58365617-58365639 TTCCTAGAATTCTGGACACAGGG - Intronic
1150018264 17:61582268-61582290 GTCCTGGAATGTTAGAAAAATGG - Intergenic
1150364902 17:64573597-64573619 CTCCTCAAATTTTAAAAAAAAGG + Intronic
1150925649 17:69529007-69529029 CACCCAGAATCTTGGGAAAAGGG - Intronic
1153084174 18:1263844-1263866 CTTCTAGAATTTTATATAAAGGG + Intergenic
1154324802 18:13382175-13382197 CTACTTTGATTTTGGAAAAAAGG + Intronic
1155827615 18:30467778-30467800 CTCCTAGAATTCTGGAAACTAGG + Intergenic
1155916206 18:31559885-31559907 CTCCTAGAACTTTATATAAATGG + Intergenic
1156805246 18:41170875-41170897 CTGTTAGAATTTTCAAAAAAAGG - Intergenic
1158547529 18:58408837-58408859 CTCCCAGAGATTTGGAAATACGG - Intergenic
1159236314 18:65678726-65678748 CTATTATAAATTTGGAAAAATGG + Intergenic
1159268004 18:66110042-66110064 CTCCTAGAATTTAGTAACAGTGG + Intergenic
1160596618 18:79979825-79979847 TTCCTAAAATTCTGGAACAAAGG + Intronic
1163203701 19:15787198-15787220 TTCCAAGCATTTTGGAAAAATGG - Intergenic
1166013966 19:39966131-39966153 TTCTTAGAAATTTGAAAAAAAGG - Intergenic
925685145 2:6463481-6463503 CTGCAAGAGTTTTGGAGAAAAGG - Intergenic
925721432 2:6831957-6831979 TTTCTAGAATTTTAGATAAATGG - Intergenic
925767318 2:7249105-7249127 CTCGTATAACTGTGGAAAAAAGG + Intergenic
925875209 2:8305529-8305551 TTCCTAGAAGTTTGTAAAGAAGG - Intergenic
926545922 2:14239895-14239917 TTTCTAGAATTTTATAAAAATGG - Intergenic
926944550 2:18172567-18172589 ATCTAAGAATTTTAGAAAAATGG + Intronic
928294504 2:30071000-30071022 TTTCTAGAACTTTAGAAAAATGG - Intergenic
928947110 2:36781474-36781496 CACCAAGAATCTTGGAATAATGG - Intronic
929016252 2:37499208-37499230 GTCGTAGAGTCTTGGAAAAAAGG + Intergenic
929480158 2:42298706-42298728 CTCCCAGAATGATGGAAAACTGG - Intronic
930060554 2:47284685-47284707 CTCCTATAATTAGGGAAAATGGG + Intergenic
930284560 2:49411581-49411603 TTTCTAGAATTTTATAAAAATGG + Intergenic
931584919 2:63815260-63815282 TTCCTAGAATTTTGAACAAAGGG + Intronic
933458977 2:82554772-82554794 ATCCTGCAATTTTGGAAATAAGG - Intergenic
933486960 2:82936223-82936245 GTCCTATAATTTTATAAAAATGG - Intergenic
933590015 2:84222140-84222162 ATCCCAGAATTTTGGGAAAATGG - Intergenic
936999025 2:118446234-118446256 CTTCTAGAATTTTATATAAATGG - Intergenic
939860009 2:147408110-147408132 CTCTGAGATCTTTGGAAAAATGG + Intergenic
940089614 2:149900917-149900939 CTCCTAGAAGTTTGGAGGAAGGG - Intergenic
940590174 2:155713911-155713933 CTCATAGAATTTTAGAAATTCGG + Intergenic
940836929 2:158532526-158532548 TTCCTACAGTTTTGGAAAATAGG - Intronic
941151142 2:161917100-161917122 TTCCTAGAATTTTACATAAATGG + Intronic
941866114 2:170336473-170336495 CTCTTTGGATTTTGGAAATACGG - Intronic
942902103 2:181133076-181133098 ATTCTAGAATTTTATAAAAATGG + Intergenic
943271699 2:185813192-185813214 TACCTAGGATTTTGGAAAATAGG + Intronic
943520919 2:188948426-188948448 CTATTAGAATTTTGAGAAAAAGG + Intergenic
944680046 2:202069078-202069100 CTCCAAGCACTTTGGAACAAGGG + Intergenic
944680204 2:202070357-202070379 CTCCAAGCATTTTGGAACAAGGG + Intergenic
945837415 2:214849362-214849384 CTCCTTGAAGTCTGGAAATAAGG - Intergenic
945858779 2:215096919-215096941 CTAATGGAATTTAGGAAAAAGGG + Intronic
946124531 2:217550833-217550855 TTCCTAGAATTTTGTATAAATGG - Intronic
946144792 2:217722313-217722335 TTCCTAGAATTTTATATAAATGG - Intronic
946607737 2:221424217-221424239 CTCCTAGACTTCTGCAAAAGTGG + Intronic
948216332 2:236236298-236236320 TTTCTAGAATTTTGTATAAATGG - Intronic
948531328 2:238607736-238607758 CTCCAAGAAGTTTGGGAATATGG + Intergenic
1169248622 20:4043740-4043762 CTCCTAGAACTTTGGCAAATGGG - Intergenic
1169791932 20:9420133-9420155 TTTCTAGAATTTTGTATAAATGG - Intronic
1170709483 20:18777460-18777482 CACCTAGATTTCTGGAAAGAGGG - Intergenic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1172440722 20:34964574-34964596 CTCCTTGAATTTTCCAAGAAGGG + Intergenic
1175637969 20:60601385-60601407 CTACTAGGATTCTGTAAAAAAGG + Intergenic
1176410511 21:6447270-6447292 CTCCTTGCATTTTGGGGAAACGG + Intergenic
1177015853 21:15786033-15786055 ATTCTAGAATATAGGAAAAATGG + Intronic
1177396452 21:20541673-20541695 CCACTATAATTTTGGATAAAAGG - Intergenic
1177799683 21:25816157-25816179 GTTCTAGAATTTTGTATAAATGG - Intergenic
1179686004 21:43055592-43055614 CTCCTTGCATTTTGGGGAAACGG + Intronic
1183545098 22:38451197-38451219 CTCCTAGGATTTTGGAAGTGGGG + Intronic
1184704895 22:46204079-46204101 TTCCTAGAATTTTATATAAATGG + Intronic
949091656 3:36452-36474 TTCCTAGAATTTTGCAGTAAGGG + Intergenic
949718220 3:6958209-6958231 TTCCTAGAATTTTATAAAAATGG + Intronic
950359409 3:12439940-12439962 CTTCCAGTATTGTGGAAAAATGG - Intergenic
951179553 3:19643392-19643414 CTCCTAAATTTTTGGAAAGTTGG - Intergenic
952396715 3:32927464-32927486 CTCCTCGAATTTTGGTAACAAGG - Intergenic
952672815 3:35991790-35991812 TTTCTAGAATTTTACAAAAATGG + Intergenic
953138738 3:40207382-40207404 CTCCTAGCATGTTTGAGAAAGGG - Intronic
954003497 3:47575889-47575911 CTTTAAGAGTTTTGGAAAAAGGG - Intronic
954854400 3:53630715-53630737 CTTCTAGAGTGTTGGAAAAGAGG + Intronic
956100067 3:65758867-65758889 CTCCAAGAATTCTGAAAAATAGG + Intronic
956261460 3:67347798-67347820 CTTCTAGAATTTCGTATAAATGG - Intergenic
956758983 3:72420817-72420839 ATCTTAGAATTTTGTATAAATGG - Intronic
957037103 3:75303676-75303698 TTCCTGGAATTTTATAAAAATGG + Intergenic
957586173 3:82135379-82135401 CACCCAGAATTGTGGAAGAATGG - Intergenic
957828283 3:85479796-85479818 CTCCTAAACTTTGGGAGAAAAGG + Intronic
957981057 3:87511137-87511159 CTCCAAGAATGTTGGAAATGTGG + Intergenic
958647798 3:96894908-96894930 TTCCTAAAAATTTGGAAACATGG + Intronic
958764136 3:98344304-98344326 TTTCTAGAATTTTATAAAAATGG - Intergenic
958967986 3:100580092-100580114 ATCCTAGGTTTTTGGAAGAATGG - Intergenic
959038978 3:101398636-101398658 ATACTTGTATTTTGGAAAAATGG - Intronic
959604827 3:108230991-108231013 CTCATAGAGTTGTGCAAAAATGG + Intergenic
959635623 3:108564581-108564603 CTCCTGGTTTTTTGGAAAACTGG - Intronic
959896735 3:111614797-111614819 GTCCTGGAATTTAGGACAAAGGG - Intronic
960501287 3:118442241-118442263 CTCCCAAAATGTTGGAATAAAGG - Intergenic
961080881 3:124026462-124026484 TTCCTAGAATTTTATAAAAATGG + Intergenic
962577272 3:136766413-136766435 CTTCTAGAATTTTATATAAAGGG + Intergenic
962868096 3:139464487-139464509 CTCCTTGATTTTGGGGAAAAGGG - Intronic
963931983 3:151012891-151012913 CTCCTAGGATATAGGAAACAGGG - Intergenic
964022210 3:152026207-152026229 CTCCTCAAATATTTGAAAAACGG + Intergenic
964144245 3:153439994-153440016 TTTCCAGTATTTTGGAAAAAGGG + Intergenic
964665544 3:159168031-159168053 GTCCTAGAATTGGGGGAAAAAGG - Intronic
965314065 3:167168419-167168441 CCACGAGAATTATGGAAAAAAGG - Intergenic
965689629 3:171341878-171341900 TTGCTAGAAGTTTGCAAAAATGG + Intronic
965832238 3:172805383-172805405 CTCCTAGAATTCAGGAGAAGAGG - Intronic
966130460 3:176632341-176632363 CTCCAAAAATTATGGAATAATGG + Intergenic
966224656 3:177585042-177585064 CTTCTGGAATTTTGTATAAATGG - Intergenic
967335921 3:188344614-188344636 GTCCTATGATTTTGGAAACATGG - Intronic
970451616 4:16172506-16172528 CTCCTAGAATTTTGGAAAAATGG - Intronic
970625693 4:17876948-17876970 CTTTTAGAATTTTGTAAAGAAGG + Intronic
970792723 4:19878133-19878155 CTCCTACAATTTTGGATGAAGGG + Intergenic
971595916 4:28528383-28528405 CTGTTATAATTTTGGAAATAAGG + Intergenic
972038986 4:34566394-34566416 CTTCTGGAATTTTGCAAGAAAGG - Intergenic
972523519 4:39884962-39884984 GGCCTAGAATTTTGAAAGAAAGG - Intronic
972666814 4:41172721-41172743 CTACTAAAATTATGTAAAAATGG + Intronic
972911735 4:43824669-43824691 CAACTAGAATTTTGGTAAATTGG + Intergenic
973234794 4:47888378-47888400 ATTCTAGAATGATGGAAAAATGG + Intronic
973266529 4:48216623-48216645 TTCCTAGAATATTTGGAAAATGG - Intronic
973677644 4:53282360-53282382 CTCCTAAAATGTAGGAACAAAGG - Intronic
973791400 4:54381219-54381241 TTCCTGGTATTTTGGAAAGATGG + Intergenic
974446156 4:61984786-61984808 CTTCTAGTACTTTGCAAAAATGG - Intronic
974895577 4:67934113-67934135 GTCCTAGAATTTTATAAAGAAGG - Intronic
975131660 4:70838403-70838425 CTTATGGAATTATGGAAAAATGG - Intronic
975192162 4:71477695-71477717 ATACTAGAATTTTGGAAATAGGG + Intronic
975972550 4:80059102-80059124 GTGCTAAAATTTTGGAAAAGGGG - Intronic
977909634 4:102518053-102518075 CTCCTAGGATGTTGGAAAGAAGG + Intronic
978558160 4:110003298-110003320 CTCATGAAATTTTGGAGAAAAGG - Intronic
979459574 4:120966281-120966303 CTCCTATATTTTTTGAAAACTGG + Intergenic
980393555 4:132177689-132177711 CTCCTAAAATTTAAAAAAAATGG + Intergenic
981590739 4:146357744-146357766 CCCCTGGAATTTGGGGAAAAAGG + Intronic
982847764 4:160274243-160274265 CCCCTAGGATTTTGGAGCAAGGG + Intergenic
983226644 4:165091657-165091679 CTCCTAAATTTTGGGGAAAATGG + Intronic
984228973 4:177070619-177070641 TTCCAAGGATTTTGGAATAAGGG + Intergenic
984357037 4:178674624-178674646 CTCCTGGGATTTTGGGACAATGG - Intergenic
984659058 4:182353083-182353105 CTCCTAGATCTTTGGAGGAAGGG + Intronic
987664199 5:20915717-20915739 TTTCTAGAATTTTATAAAAATGG - Intergenic
988596374 5:32595401-32595423 CTTCTAGAACTTTGTATAAATGG + Intronic
988758484 5:34286482-34286504 TTTCTAGAATTTTATAAAAATGG + Intergenic
988893439 5:35645696-35645718 CTCCAAGAATGTTGAGAAAAAGG + Intronic
989022975 5:37031869-37031891 CTCCTAGAATTTTGTATAAATGG - Intronic
989257985 5:39386667-39386689 CTTCTAGAATGTTCTAAAAAAGG - Intronic
989324437 5:40174344-40174366 CTTCTTGAATTTTGGAAATCAGG - Intergenic
990539960 5:56762737-56762759 TTCCTTAATTTTTGGAAAAATGG - Intergenic
990628110 5:57636868-57636890 ATTCTAGCATTTTAGAAAAACGG - Intergenic
990864586 5:60366930-60366952 ATTCTAGAACTTTTGAAAAAGGG + Intronic
992544494 5:77798522-77798544 CTCCTAGAATTGGGGAACAAAGG + Intronic
992588451 5:78267480-78267502 TTACTTCAATTTTGGAAAAATGG - Intronic
995977573 5:118058911-118058933 CTCCAAAAATTTTCAAAAAAAGG - Intergenic
996167912 5:120248373-120248395 CTTGTTTAATTTTGGAAAAATGG - Intergenic
996870812 5:128191172-128191194 ATCCTAGAATCGTGGAACAAAGG - Intergenic
997193153 5:131958934-131958956 CTCTTTGAATTTTTGACAAAAGG + Intronic
997269416 5:132524287-132524309 TTTCTAGAATTTTATAAAAATGG - Intergenic
999857353 5:155609094-155609116 CTTTGAGAAGTTTGGAAAAATGG + Intergenic
1000604266 5:163311643-163311665 CTGCTACAGTTTTGGAAAGAGGG - Intergenic
1000721460 5:164713286-164713308 TTCCTAGAATTTCATAAAAAAGG - Intergenic
1002994141 6:2267285-2267307 TTCCTTGAACTTTAGAAAAAAGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1006617854 6:35342130-35342152 CGCCTATAATTTTCAAAAAAGGG - Intergenic
1007046539 6:38780994-38781016 CTCCTTGAAATTTGGGATAAGGG + Intronic
1008412356 6:51194411-51194433 CTGCTGGAATTTTGAAAAAAAGG + Intergenic
1009302999 6:62051029-62051051 CTGCTAGAATTTTGTAATAGTGG - Intronic
1011007157 6:82658857-82658879 CTCCAACGATTCTGGAAAAATGG - Intergenic
1011963396 6:93120722-93120744 CTCTTAGAAATATGGAAAGAAGG - Intergenic
1012349846 6:98236433-98236455 CTCCTGGAATATTAGAATAAAGG + Intergenic
1012456038 6:99406514-99406536 CTTATAGAACTTTGGATAAATGG + Intronic
1014685599 6:124496059-124496081 CTCAGAGAACATTGGAAAAAAGG - Intronic
1015418587 6:132980181-132980203 TTTAAAGAATTTTGGAAAAAAGG + Intergenic
1015487878 6:133791975-133791997 CTAATAGAATTTTGAAAAACTGG - Intergenic
1015625666 6:135179480-135179502 CTCCTAAAATCTTGAAAAAGAGG + Intergenic
1015744815 6:136498637-136498659 CACCTAAGAGTTTGGAAAAATGG + Intronic
1015771953 6:136777514-136777536 CTCCTAGATTTTTAGGAAATTGG - Intronic
1018643047 6:165922540-165922562 GTCCCAGATTTTTTGAAAAAAGG - Intronic
1023472513 7:40539680-40539702 TTCCTAGAATATTGAATAAAAGG + Intronic
1027426633 7:78068049-78068071 CTCCAACAATTTTGGCAACAGGG + Intronic
1027570077 7:79854741-79854763 CTACTAGAAGTTAGGAAAGAGGG + Intergenic
1027834400 7:83221792-83221814 CTCCTAGAATCTTGGAAATTAGG - Intergenic
1028093467 7:86731649-86731671 CTCCTAGGATTTTTGAAAATAGG + Intronic
1028163128 7:87508540-87508562 CTCCTAGGAAGTTGGATAAATGG - Intronic
1028512627 7:91641966-91641988 CTGCTAGTATTTTATAAAAATGG - Intergenic
1028754704 7:94421836-94421858 CTCCAAGAATTTGGGTAAGATGG - Intronic
1029498415 7:100911383-100911405 CTTCTAGAATTTTATATAAATGG + Intergenic
1030769915 7:113461954-113461976 GTCCTAGAATGTTGGAAAGCTGG + Intergenic
1031161164 7:118170361-118170383 CTCCTAGAATTTTGAACAAATGG + Intergenic
1033131573 7:138749827-138749849 TTCCTAGAATCTTGGAATCATGG + Intronic
1034103825 7:148473675-148473697 ATCCTAGTAATTTGGACAAATGG + Intergenic
1034629344 7:152518845-152518867 CTCCTAGAAGTTCCTAAAAAAGG - Intergenic
1036922153 8:12867235-12867257 TTACTAGAATTTTTAAAAAACGG - Intergenic
1037263360 8:17032804-17032826 CGCGTATAATGTTGGAAAAATGG - Intronic
1038457156 8:27683205-27683227 CTTCTAGAATTTTACATAAATGG - Intergenic
1038488789 8:27954884-27954906 CTGCCAGAGCTTTGGAAAAATGG - Intronic
1040397520 8:47013747-47013769 CTCCTAGAAAATTACAAAAACGG + Intergenic
1042302814 8:67303776-67303798 CTGCCTGAAATTTGGAAAAAAGG + Intronic
1043063602 8:75537938-75537960 GTCCTAGAATTTAAGAAAAGAGG + Intronic
1043604570 8:81984823-81984845 ATTCTAGAATCTTGGAGAAATGG - Intergenic
1044534180 8:93340585-93340607 CTCATAGAAGTTTAGAAAGAGGG + Intergenic
1044616338 8:94146233-94146255 CTCCTTGAATTTTAAAGAAAGGG - Intronic
1045784818 8:105908692-105908714 ATCATAGAAACTTGGAAAAACGG - Intergenic
1046069852 8:109237442-109237464 TTCTTAGAATTTTGGATAATGGG - Intergenic
1046764512 8:118055208-118055230 CTCCTAGAAGTCTGTATAAATGG + Intronic
1047119471 8:121884678-121884700 CTCTTAGAATGTTGAAACAAAGG + Intergenic
1048301430 8:133254112-133254134 TTCCTAGAATTTTATATAAATGG - Intronic
1048482649 8:134814112-134814134 CTACTATAATTAGGGAAAAATGG - Intergenic
1051803646 9:20965693-20965715 TTGCTAGGATCTTGGAAAAATGG - Intronic
1052557895 9:30042680-30042702 TTCCTAGAGTTTGGGAAATAAGG - Intergenic
1053039685 9:34859312-34859334 CCCCTAGAATGTTGCAAATAAGG + Intergenic
1054865946 9:70001167-70001189 TTTCTAGAATTTTGTAAAAATGG + Intergenic
1055131234 9:72777567-72777589 CTCCAAGCATTTTTGAAATAAGG - Intronic
1056849342 9:90069037-90069059 TTCCTAGAATTTTACATAAATGG + Intergenic
1057912917 9:99034120-99034142 CCCCTAGACTTTTGGATATATGG - Intronic
1057967526 9:99518566-99518588 CTCATAGATTTTTGGTAAATTGG + Intergenic
1058694447 9:107547624-107547646 TTCCTGGAATTTTGGAAAATAGG + Intergenic
1058773978 9:108266105-108266127 GATCTAGAATTTAGGAAAAAGGG - Intergenic
1058781464 9:108340479-108340501 TTCATAGAATCTTGGAAAGAAGG - Intergenic
1059219617 9:112602071-112602093 CTCCTAGAACTTTAAAACAAAGG - Intronic
1061243847 9:129391137-129391159 GCCCCAGAATATTGGAAAAAAGG - Intergenic
1061372797 9:130207228-130207250 CTGCTAGAGCTTTGGAAAATGGG + Intronic
1186061760 X:5715974-5715996 TTCCTATAATTTTGTATAAATGG - Intergenic
1187499655 X:19829317-19829339 GTACTAGAATTTTGTATAAATGG - Intronic
1188082143 X:25856580-25856602 CTCACAGAAATTTGGGAAAAAGG - Intergenic
1189900972 X:45705921-45705943 CTCCTAGAATTTTCCCAAGAGGG - Intergenic
1190363349 X:49669175-49669197 GGCCTAGAATTTTATAAAAATGG + Intergenic
1192031867 X:67522601-67522623 CTCCTAAAATGTTGGAAATATGG + Intergenic
1193980069 X:88171237-88171259 CAGCTAGCATTTTGGAAAATTGG + Intergenic
1195438313 X:104871542-104871564 TTCTTAGAATTTTAGAACAATGG - Intronic
1196554059 X:117065984-117066006 CTCCTGGAATTTGAGAAAATGGG - Intergenic
1196651179 X:118169853-118169875 CTCCCAGAAGCTTGGTAAAAAGG + Intergenic
1196969144 X:121089839-121089861 TTCCTAGAATTTTTGGACAAGGG + Intergenic
1197271913 X:124433948-124433970 GTCTTAGAATTTAGGAAATATGG + Intronic
1197866108 X:131018926-131018948 TTCCTAGAATTTTATATAAATGG + Intergenic
1198224628 X:134633858-134633880 CTCCTAGATTTTAGCAAGAAGGG + Intronic
1199930736 X:152517804-152517826 CTCCTATAATTTTTTAAAAGAGG - Intergenic
1200202945 X:154295209-154295231 CTCATAGAATGTTTTAAAAAAGG + Exonic
1202162358 Y:21948540-21948562 GTCCTGGAATTGTGCAAAAACGG - Intergenic
1202228998 Y:22637833-22637855 GTCCTGGAATTGTGCAAAAACGG + Intergenic
1202314156 Y:23558332-23558354 GTCCTGGAATTGTGCAAAAACGG - Intergenic
1202556646 Y:26112263-26112285 GTCCTGGAATTGTGCAAAAACGG + Intergenic