ID: 970453102

View in Genome Browser
Species Human (GRCh38)
Location 4:16191396-16191418
Sequence CGGACTGCCCCCTTATCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970453098_970453102 13 Left 970453098 4:16191360-16191382 CCTCCAGCATGTTGTAGATGATG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 970453102 4:16191396-16191418 CGGACTGCCCCCTTATCAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 33
970453099_970453102 10 Left 970453099 4:16191363-16191385 CCAGCATGTTGTAGATGATGTAG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 970453102 4:16191396-16191418 CGGACTGCCCCCTTATCAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 33
970453096_970453102 19 Left 970453096 4:16191354-16191376 CCCTTACCTCCAGCATGTTGTAG 0: 1
1: 0
2: 1
3: 12
4: 144
Right 970453102 4:16191396-16191418 CGGACTGCCCCCTTATCAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 33
970453097_970453102 18 Left 970453097 4:16191355-16191377 CCTTACCTCCAGCATGTTGTAGA 0: 1
1: 0
2: 0
3: 12
4: 150
Right 970453102 4:16191396-16191418 CGGACTGCCCCCTTATCAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970453102 Original CRISPR CGGACTGCCCCCTTATCAGG TGG Exonic
902722973 1:18316341-18316363 AGGACTGCTCCCTTAACAGCAGG - Intronic
903514566 1:23901939-23901961 TGGACTTCCCCCTGATCAAGAGG - Intronic
907084270 1:51655203-51655225 TGGACTGGGCCCTTATCTGGAGG + Intronic
922408003 1:225338894-225338916 CGGACTGACTCCTTACCAAGCGG + Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1103939157 12:124492615-124492637 CTGACTGTCCCCTTACCCGGGGG + Intronic
1104555931 12:129799879-129799901 CAGGCTGCCCTCTTCTCAGGAGG + Intronic
1105966424 13:25388763-25388785 TGGTCTCCTCCCTTATCAGGAGG + Intronic
1117898362 14:60509893-60509915 CGGACTGACCCCTACGCAGGTGG + Exonic
1142814004 17:2411257-2411279 CGGACTCCTCCCTTAAGAGGTGG + Intronic
1148454732 17:47804948-47804970 GGGACTGCCCCCTCATCTGCTGG + Intergenic
1148623377 17:49051354-49051376 GGGGCTGCCCCCTTAGGAGGAGG + Exonic
1150819236 17:68421728-68421750 AGGACATCCCCCCTATCAGGTGG - Exonic
1150843495 17:68631754-68631776 CGGAATGCCCACTTCTAAGGCGG - Intergenic
1155440005 18:25852194-25852216 ACCACTGCCCCCTTCTCAGGAGG - Intergenic
1157614808 18:48979979-48980001 CTGACTGCTCCCTAGTCAGGGGG - Intergenic
1162019996 19:7863976-7863998 CTGACTGCTCTCTTAACAGGAGG + Intronic
1166531456 19:43545914-43545936 CAGACTGCCCCCTGGCCAGGAGG - Exonic
938080173 2:128365750-128365772 CGGACTGCAGCCTCATCCGGAGG - Intergenic
942854173 2:180526059-180526081 TGGAATGCCCCCTTATCACAGGG - Intergenic
946194088 2:218022861-218022883 CTGACTGCCCCCTCACCAGGAGG - Intergenic
947011037 2:225567268-225567290 CTGACTGCACCCTTATTATGTGG + Intronic
1169100436 20:2943219-2943241 AGTACTACCCCCTTATCTGGGGG - Intronic
955031794 3:55229184-55229206 TGGCCTGCCCCCATGTCAGGTGG - Intergenic
967891614 3:194368041-194368063 CAAACAGCCCCCTTCTCAGGCGG + Intronic
970453102 4:16191396-16191418 CGGACTGCCCCCTTATCAGGTGG + Exonic
983513483 4:168632973-168632995 AGGACAGCCCCCTTCTCAGGGGG - Intronic
994155584 5:96500058-96500080 CAGACTGCTCCCATATGAGGCGG - Intergenic
1006472072 6:34235218-34235240 CGGCCTGCCCCTTTGTCTGGTGG - Intergenic
1007411466 6:41664514-41664536 CGGACTGCCCCCTCCTCTGCAGG - Intergenic
1011652956 6:89523909-89523931 CGGACTGCATCATTATCAGATGG - Intronic
1019359018 7:595275-595297 CTCAATGCCACCTTATCAGGGGG + Intronic
1026837806 7:73649855-73649877 CTGAATGCCCCCTTCCCAGGTGG - Intergenic
1047672294 8:127161428-127161450 CAAACTGTCCCCTTATTAGGTGG - Intergenic
1047769654 8:128020614-128020636 CGGACTGGGCTCCTATCAGGAGG - Intergenic
1062695989 9:137876901-137876923 CGGACTGCCTCCCTCTCAGAAGG + Intergenic