ID: 970453105

View in Genome Browser
Species Human (GRCh38)
Location 4:16191405-16191427
Sequence CATGATGTACCACCTGATAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970453105 Original CRISPR CATGATGTACCACCTGATAA GGG (reversed) Exonic
917113426 1:171576428-171576450 GATGATGTTCCACCTGAGAGTGG - Intronic
918593567 1:186267025-186267047 CATGATTTAACACATGAAAAAGG - Intergenic
918791473 1:188836132-188836154 CATGATGTACTCCCAGACAATGG - Intergenic
922717006 1:227883039-227883061 CATGAAGTTCCACCTGAGAAAGG - Intergenic
1070654081 10:78259118-78259140 CATGACTTACCACCTTCTAAAGG - Intergenic
1071104601 10:82079823-82079845 CTGGATGTACCACCAGATATAGG + Intronic
1078600949 11:12730084-12730106 TATGATGAACCTCCTGATACAGG - Intronic
1087725899 11:101716283-101716305 CATTATTTACAACCTCATAATGG + Intronic
1088102190 11:106167782-106167804 CATGATTTACCACCTGGTTTTGG - Intergenic
1096329749 12:50700587-50700609 CATGATGTGGTACCTGAAAAGGG + Intronic
1099432136 12:82600016-82600038 CATAATTTATCACCTGCTAATGG - Intergenic
1099570722 12:84314407-84314429 CATGATCTACCAACTTATGATGG - Intergenic
1099703513 12:86119959-86119981 CATGATATGCCACCAAATAAAGG - Intronic
1104407816 12:128533096-128533118 CAGGATGTACCACTTGCAAAGGG + Intronic
1105225131 13:18424911-18424933 CCTGATCTGCCACCTCATAAGGG - Intergenic
1106711032 13:32333261-32333283 CATGATGAAACATCTTATAAAGG + Exonic
1114369638 14:22071645-22071667 CATTATGTACCAACAGACAAGGG + Intergenic
1202834796 14_GL000009v2_random:69841-69863 CTTGATGTTTCCCCTGATAATGG + Intergenic
1124359192 15:29022586-29022608 AATGATTTACCATATGATAAAGG - Intronic
1137817025 16:51408069-51408091 CTTGATGTCTCACCTCATAAGGG - Intergenic
1139233653 16:65311676-65311698 CAGGACGTTCCACCTGTTAAGGG - Intergenic
1154528235 18:15314611-15314633 CCTGATCTGCCACCTCATAAGGG + Intergenic
1164675592 19:30098288-30098310 ACTGATGGACCACCTGATATGGG + Intergenic
1164927545 19:32142055-32142077 CACGATGTACCACCTCCCAAGGG - Intergenic
1202637908 1_KI270706v1_random:57852-57874 CTTGATGTTTCCCCTGATAATGG - Intergenic
925800570 2:7595557-7595579 CTTGATGTAGCATCTGCTAATGG + Intergenic
927383491 2:22506365-22506387 ATTGATGTACCACTTGAAAAGGG + Intergenic
931276121 2:60745392-60745414 CTTGATGGACCACTTGACAATGG - Intergenic
931837981 2:66119383-66119405 CTTGAAGTACCAGCTGAAAAAGG - Intergenic
936825326 2:116575642-116575664 CATGATGAAATACCTGAGAATGG + Intergenic
942696496 2:178652652-178652674 CCTGAAGTCCCACCTGTTAAAGG - Exonic
942696538 2:178653040-178653062 CCTGAAGTCCCACCTGTTAAAGG - Exonic
942696559 2:178653237-178653259 CCTGAAGTCCCACCTGTTAAAGG - Exonic
942696998 2:178657497-178657519 CCTGAAGTCCCACCTGTTAAAGG - Exonic
942697437 2:178661758-178661780 CCTGAAGTCCCACCTGTTAAAGG - Exonic
942697634 2:178663626-178663648 CCTGAAGTCCCACCTGTTAAAGG - Exonic
942697653 2:178663818-178663840 CCTGAAGTCCCACCTGTTAAAGG - Exonic
942697671 2:178664014-178664036 CCTGAAGTCCCACCTGTTAAAGG - Exonic
943369950 2:187003356-187003378 CATGACGGACTACCTGATCAGGG - Intergenic
944332030 2:198480887-198480909 CATGATGTCACCCTTGATAACGG + Intronic
1169767330 20:9161183-9161205 CATTATGTACCAGCTGTTTATGG - Intronic
1176769183 21:13053929-13053951 CCTGATCTGCCACCTCATAAGGG - Intergenic
1180516296 22:16147998-16148020 CCTGATTTGCCACCTCATAAGGG - Intergenic
956959607 3:74383399-74383421 CCTGATGTACCACATGTCAAAGG + Intronic
957058979 3:75466239-75466261 CATGATGGGCCACCAGAAAAGGG + Intergenic
963712820 3:148767086-148767108 CAGGATCTGCCACCAGATAAGGG - Intergenic
966499800 3:180626469-180626491 CATGCTGTTCCACCTGAGAAAGG - Intronic
969342654 4:6551913-6551935 CATGATGTGCCAGCTGAGAATGG - Intronic
970453105 4:16191405-16191427 CATGATGTACCACCTGATAAGGG - Exonic
970582980 4:17490349-17490371 CATGATGGACCTCATGATACAGG + Intronic
973368130 4:49224217-49224239 CTTGATGTTTCCCCTGATAATGG - Intergenic
974943569 4:68498214-68498236 CATGATGTACGGCATGTTAATGG + Intergenic
984415609 4:179454822-179454844 CATGAGGCCCCACCTGATATAGG + Intergenic
984615324 4:181890304-181890326 CATGTGGTACTACCTGATACAGG + Intergenic
986415493 5:7524119-7524141 CATGATGTATCACCTAATTAAGG + Intronic
987396204 5:17426571-17426593 TATGATGTGCCACCAGATACAGG + Intergenic
987447045 5:18033199-18033221 GATTGTGTACCTCCTGATAAGGG - Intergenic
989976508 5:50593848-50593870 CATGATGTACGGGCTGACAATGG + Intergenic
990147217 5:52775887-52775909 CATGTTGTAGCCCCAGATAAAGG + Intergenic
990344125 5:54854666-54854688 CATGATCTACAAGCTGAGAATGG - Intergenic
993704810 5:91157859-91157881 CATCATGTACCACAAGTTAAAGG + Intronic
1005593785 6:27357533-27357555 CATCATGTTCCAGCTGAGAAGGG - Intergenic
1006561380 6:34915776-34915798 CATGATGGTCCACCTCAAAATGG - Intronic
1008727679 6:54441793-54441815 CATGTTGTTCCACCTGTCAATGG + Intergenic
1014028067 6:116671717-116671739 CATGATTTGACCCCTGATAATGG - Intergenic
1022898239 7:34774522-34774544 CAAGATGGAACAGCTGATAATGG - Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1025908454 7:65808323-65808345 AATAATGTACCAGCTGATAGAGG - Intergenic
1028823298 7:95238399-95238421 CCTGATGTACCTCCAGATACAGG + Intronic
1031270510 7:119643745-119643767 CACGATGGCCCAACTGATAAGGG + Intergenic
1032960454 7:137027442-137027464 CATCATGCACCCCCTGCTAAAGG + Intergenic
1043572972 8:81626183-81626205 CATCATGAACCACCTAAAAAGGG + Intergenic
1043763660 8:84101692-84101714 ACTGATTTACCACTTGATAATGG + Intergenic
1053706026 9:40753363-40753385 CCTGATTTGCCACCTCATAAGGG + Intergenic
1054416104 9:64876967-64876989 CCTGATTTGCCACCTCATAAGGG + Intergenic
1054751293 9:68909762-68909784 CATGATGTGCCTCCTGATGAGGG - Intronic
1056802776 9:89705029-89705051 AATGATGCACCAACTGAGAAAGG + Intergenic
1057449665 9:95145827-95145849 CATGCTTTACCACCGGAGAACGG + Intronic
1059304876 9:113346381-113346403 CTTGATATGCCACCTAATAAAGG + Intergenic
1187273554 X:17800089-17800111 GATGATGTAATACCTAATAAAGG - Exonic
1189439378 X:41020716-41020738 TATCATGTACCTCCTGATAGAGG - Intergenic
1192734793 X:73840176-73840198 CATGATGAAACACCTTCTAAAGG - Intergenic
1192948519 X:75991243-75991265 CATGGTGTATGACCTTATAAAGG + Intergenic