ID: 970456350

View in Genome Browser
Species Human (GRCh38)
Location 4:16226993-16227015
Sequence GAGCCGGGCCCCCGCCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 2, 2: 1, 3: 42, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970456350_970456361 26 Left 970456350 4:16226993-16227015 CCGCGGCGGCGGGGGCCCGGCTC 0: 1
1: 2
2: 1
3: 42
4: 301
Right 970456361 4:16227042-16227064 GCCCTGCCTGCCCGCTATTTTGG 0: 1
1: 0
2: 1
3: 10
4: 74
970456350_970456354 4 Left 970456350 4:16226993-16227015 CCGCGGCGGCGGGGGCCCGGCTC 0: 1
1: 2
2: 1
3: 42
4: 301
Right 970456354 4:16227020-16227042 TCACCGACCCCCACGAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970456350 Original CRISPR GAGCCGGGCCCCCGCCGCCG CGG (reversed) Intronic
900136270 1:1118396-1118418 GAGCAGAGCCCCTGCCGGCGTGG + Intergenic
900180130 1:1307657-1307679 GGGCCGGGCCGCGGCCGCCGGGG - Intronic
900318470 1:2070797-2070819 CACCCCGGCCCCCGCAGCCGAGG - Intronic
901635116 1:10666914-10666936 GAGCCGAGCCCCTGCTGCTGTGG - Intronic
902916696 1:19644133-19644155 GCCCGGGGCCCCTGCCGCCGCGG + Intronic
904614959 1:31744603-31744625 CAGTCGGGCCCCCGCCGCAGAGG + Intronic
904822813 1:33256382-33256404 GAGCCGGGCGCCTGGCGCGGGGG + Intergenic
905025354 1:34845841-34845863 GAAGCGGGCCGCTGCCGCCGGGG - Intronic
905212706 1:36385649-36385671 GGGGCGGGCCCCGGCGGCCGCGG - Intronic
905580772 1:39081631-39081653 GAGCTGGGGCGCGGCCGCCGGGG - Intronic
906615824 1:47232213-47232235 GGGCCGGGCCGCCGCCGCTCAGG - Intronic
906627023 1:47333822-47333844 CCGCCGCGGCCCCGCCGCCGTGG - Exonic
906640328 1:47437635-47437657 GAGCCCAGCTCCCGCCGCGGCGG + Exonic
907069261 1:51519211-51519233 GAGCTGGGCCGCCGCAGCCATGG + Exonic
907541019 1:55215384-55215406 GAGGCGCGGCCCCGCCGCCCGGG - Intergenic
908703934 1:66930432-66930454 GAGCCGGGCGCCCCCGGCCCTGG + Intronic
910759106 1:90718023-90718045 GGCCCGCGCCCCCGCCACCGAGG + Intergenic
911027127 1:93447961-93447983 TAGCCTGGCCACCGCCGGCGGGG - Intergenic
913518331 1:119623581-119623603 GGGCCGGGCCCCCGCTGGCCCGG - Exonic
914509352 1:148317681-148317703 GACCCGGGCCCGAGCCGCCTGGG + Intergenic
914808369 1:151008401-151008423 GAGCCCCGCCTCCGCCGCTGGGG + Intronic
915167865 1:153958547-153958569 GAGCCGGGCCGAGGCCGCGGCGG - Exonic
916107204 1:161440968-161440990 GCGCCCGGCCCCTGCCGTCGGGG - Intergenic
916108791 1:161448386-161448408 GCGCCCGGCCCCTGCCGTCGGGG - Intergenic
916110379 1:161455767-161455789 GCGCCCGGCCCCTGCCGTCGGGG - Intergenic
916111964 1:161463177-161463199 GCGCCCGGCCCCTGCCGTCGGGG - Intergenic
916113551 1:161470558-161470580 GCGCCCGGCCCCTGCCGTCGGGG - Intergenic
916738726 1:167630237-167630259 GCGCAGGGCCCCCGCGGCCGGGG + Exonic
917345154 1:174022045-174022067 GAGCGGGGCTGCCGCGGCCGGGG - Intronic
919842422 1:201619075-201619097 GAGCAGGGCCCCCACTGCAGTGG + Intergenic
919929938 1:202214486-202214508 GAGGCTGGTCCCCGCCCCCGGGG + Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920528568 1:206685562-206685584 GGGACGGGCACCCGACGCCGTGG - Intronic
920805779 1:209232055-209232077 CAGCTGGGCCGGCGCCGCCGGGG + Intergenic
920957260 1:210630870-210630892 GAGCTGGCCCCCCGCCTCCACGG - Intronic
921024047 1:211260552-211260574 GAGCGCGGCCCTCGGCGCCGGGG - Intronic
921060239 1:211578923-211578945 GAGCTGGGCTCCCGGAGCCGGGG + Intergenic
921882723 1:220272525-220272547 GACCCGGGCCCCCGCGCCCTAGG - Intergenic
922648830 1:227318846-227318868 GAGCCGGGGCCACGGCGCGGCGG - Intergenic
922718358 1:227888202-227888224 TAGCCTGGCCCCCACCGCCTTGG - Intergenic
924560766 1:245155326-245155348 GAGCCAGCCCCCTGCAGCCGGGG + Exonic
1064442980 10:15370662-15370684 CAGACGAGCCCCCGCCGCAGCGG + Intronic
1064712413 10:18140680-18140702 GAGGAGGGGACCCGCCGCCGGGG + Exonic
1067066028 10:43104843-43104865 GAGCGGGGCGCACACCGCCGCGG - Intronic
1069942419 10:71964639-71964661 GCGCCGGACCCCAGCCGCGGAGG + Exonic
1070810124 10:79293423-79293445 GAGGCAGGCCCCCGCGGCCCGGG - Exonic
1071573902 10:86712158-86712180 GGGCCGGGCCACCGAGGCCGGGG + Intronic
1072905000 10:99444914-99444936 GAGCAGGGCCTCGGCTGCCGCGG - Intergenic
1073059431 10:100724549-100724571 GAGCCTGGTCGCCGCCGCCGCGG - Intergenic
1073206842 10:101774202-101774224 GAGCCCTGCCCCAGCCGCCTGGG + Intronic
1075032131 10:119030397-119030419 CAGCCGGGCGGCCGCCGCCCCGG - Exonic
1075430295 10:122374763-122374785 GAGCCGGGGCCGCGGCGGCGCGG + Exonic
1075629393 10:123991934-123991956 GCGCCGGGCCCCCGCACCCCTGG + Intergenic
1075800677 10:125151834-125151856 TAGCTGGACCCCCGCCGCCCCGG + Intronic
1076373546 10:129969187-129969209 GAGCCGGGGCCCAGCTGCTGGGG - Intergenic
1076607699 10:131700278-131700300 GAGCCGCTCCCTCGCCGCCTTGG + Intergenic
1076751897 10:132547468-132547490 GAGCCCGGGCCCAGCTGCCGTGG + Intronic
1076900820 10:133336529-133336551 GTGCCGGGGCCCCGCCGTCACGG + Intronic
1077103638 11:832856-832878 CTGCCGAGCGCCCGCCGCCGCGG + Exonic
1077386325 11:2271088-2271110 GACCCTGGCCCCCGCCTCCTCGG - Intergenic
1077478726 11:2803147-2803169 CAGCCGGGCCCCCCCCCCCACGG + Intronic
1082807725 11:57461028-57461050 GGGCCGCGCCCCCGCCGCCAGGG + Intronic
1083187018 11:61023548-61023570 GAGCCTGGCCCTTGCCGCTGGGG + Intergenic
1084069921 11:66727733-66727755 GAGCCGGGCTCCCTCCTCCCCGG - Intronic
1084112533 11:67023321-67023343 TCGCCGGGCTCCCGCCTCCGAGG - Intronic
1085622276 11:78046386-78046408 AGGCGGGGCCCCCGCCGTCGCGG - Intronic
1089243128 11:117098436-117098458 GAGCCGGCTCCCCGCGGCCCCGG - Exonic
1089622332 11:119729030-119729052 GAGCCCCGCGCCCGCCGCCTGGG - Exonic
1089700250 11:120240228-120240250 GTTCCCGGCCGCCGCCGCCGCGG - Intronic
1089864949 11:121623722-121623744 GAGCCGGGCTCCAGCCACCCAGG - Intronic
1090193965 11:124799788-124799810 CAGACCGGCCCCCGCCCCCGAGG + Intronic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1090784968 11:130040805-130040827 GAACCTGGCCCCGGCCGCGGGGG - Intergenic
1091638034 12:2213085-2213107 TAGCCGGGCCCCAGCCCCAGAGG - Intronic
1092492387 12:8957037-8957059 GAGCAGGGCCCCCCCGGCCGTGG + Intronic
1098991161 12:77065809-77065831 GACGCGGGCCCCGGCGGCCGCGG + Intergenic
1101716732 12:107318835-107318857 GAGCCGAGTCCGCGCCGCCTTGG - Exonic
1102254057 12:111406026-111406048 CCCCCGGGCCGCCGCCGCCGGGG - Exonic
1102256516 12:111418524-111418546 GAGCAGGGCCCGGGCGGCCGCGG - Exonic
1103407725 12:120687406-120687428 CAGCCCGGCCCCCGCCGCGCCGG - Exonic
1103479928 12:121244444-121244466 GAGCCGGGCCACAGCAGCCCAGG + Intronic
1103604879 12:122079017-122079039 GCGCCGCGCCACCGCCGCCTCGG + Exonic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1103779661 12:123389874-123389896 ACGCCGGGCCCTCGCCGCCTCGG - Intronic
1104759827 12:131290121-131290143 GACCTGGGCCTCTGCCGCCGAGG + Intergenic
1104919949 12:132285507-132285529 GAGCCGGGCCCTGGCCGCCACGG - Intronic
1104929197 12:132329357-132329379 GCGCCGGGCCACGGCCGCCGGGG + Intergenic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1113231564 13:108218305-108218327 GAGCCGGGCCCACGCCGCCGAGG + Intronic
1113254893 13:108495881-108495903 GAGCCGGGCGCCAGGCGACGCGG - Intergenic
1113874466 13:113585348-113585370 CAGCCGGGCGGGCGCCGCCGGGG + Intronic
1114485164 14:23057647-23057669 CAGCCGGGCCCGCGCGGCGGGGG + Intergenic
1118404932 14:65413232-65413254 GAGCCGGGCCCCGCGCGCCTCGG + Intronic
1118610150 14:67533405-67533427 GACCCGCGCTCCCGCCGCTGTGG + Intronic
1118971672 14:70642543-70642565 GCGCCGCGCCCCCCGCGCCGCGG + Intronic
1119539295 14:75428202-75428224 CAGCCGGGCCCCGGCCCCGGGGG + Intronic
1121339013 14:93094018-93094040 CAGCCAGGCCCCCACCGCCTCGG + Intronic
1121648240 14:95535475-95535497 GAGCGGGGCTCCATCCGCCGGGG + Intronic
1121690804 14:95876247-95876269 GAGCCGGGCTGCGGCAGCCGAGG - Intergenic
1122604335 14:102938274-102938296 AAGCCTGGCCCCCGCAGCCCTGG - Intronic
1122688853 14:103522268-103522290 GGGCCGGGACCCCGGCCCCGAGG + Intronic
1122917481 14:104865657-104865679 CAGGCGGGTCCCCGCCGCCGCGG + Intronic
1122951123 14:105045733-105045755 GAGCAGTGTCCCCGCCACCGCGG - Intergenic
1122975460 14:105168943-105168965 GCCCCGTGCCCCCGCCGCCCGGG - Intergenic
1123758803 15:23417037-23417059 GGGCGGGGCCCCAGCCGCCTGGG + Intergenic
1124003314 15:25777322-25777344 GAGCCAGGCCCTCGCTGCAGTGG - Intronic
1124373857 15:29118340-29118362 CAGGCGGGCACCCGCCGCTGAGG - Intergenic
1125182003 15:36888408-36888430 GGGGCGGGCCCCCTCCGTCGGGG - Intergenic
1125647378 15:41283949-41283971 AAGCCCCGCCCCCGCCGCTGGGG - Intergenic
1127166089 15:56245346-56245368 AAGCCGCCCCCCCGCCCCCGGGG + Intronic
1129082497 15:73052750-73052772 GCGCCGGGCGCCGGGCGCCGCGG + Exonic
1129541141 15:76347459-76347481 GATCGGCGCCCCCGCCACCGCGG - Intergenic
1131514197 15:93066454-93066476 GTGCCTGGCCCCCGCACCCGTGG - Intronic
1131515344 15:93073134-93073156 GCGCCGGGCGCCCGCGGCCGAGG - Intronic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132602801 16:781512-781534 GGGCCGGGCCCCAGCAGCCCAGG - Intronic
1132878053 16:2148981-2149003 GAGCCAGGCACCCGCCCCCCAGG + Intronic
1132987711 16:2776767-2776789 GTGCCGGGCCCCGGGCGCCGAGG - Intronic
1133033490 16:3022450-3022472 GAGCCTCACCCCCGCCCCCGCGG - Intergenic
1133156347 16:3879796-3879818 GCCCCGGGCCCCCGCCGCCCCGG + Intronic
1133181056 16:4055060-4055082 GAGCAGGGCCCCCGCGGAAGGGG + Intronic
1133784421 16:8963588-8963610 GGGCCCGCCTCCCGCCGCCGGGG + Intronic
1134149697 16:11796589-11796611 GGGCGGCGCCCCCGCCTCCGCGG + Intronic
1136381978 16:29900112-29900134 GGGCCGGGCCCGCCCCGGCGGGG - Intergenic
1136428309 16:30183573-30183595 CAGCCGTGCGCCCGCCTCCGGGG - Exonic
1136514799 16:30761775-30761797 GCCCCGGGCTCCCGCCGCCTAGG + Exonic
1137327990 16:47461025-47461047 GAGCCGGCCCGCCGCCGCCATGG + Exonic
1137655318 16:50153825-50153847 GGGCCGAGGCCGCGCCGCCGGGG - Exonic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1142130820 16:88430780-88430802 AAGCCGGGGCCCCGCGGCGGAGG - Exonic
1143001800 17:3799285-3799307 GAGCAGGGCCCCCGCAGCTCCGG - Intronic
1143112054 17:4558428-4558450 GAGCAGTGCCCTGGCCGCCGTGG - Exonic
1144500847 17:15786233-15786255 CCGCCGGACCCCCGCCGCCCCGG + Intergenic
1144784437 17:17823827-17823849 AACTCGAGCCCCCGCCGCCGTGG - Intronic
1144829478 17:18123283-18123305 GCGCGGGGCATCCGCCGCCGGGG - Intronic
1145163008 17:20588895-20588917 CCGCCGGACCCCCGCCGCCCCGG + Intergenic
1145306844 17:21680122-21680144 GACCCTGGATCCCGCCGCCGCGG - Intergenic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1147608171 17:41785920-41785942 GAGCCGGGCTCCCACCGGCGTGG + Intronic
1147720385 17:42536292-42536314 GAGAAGGACCCCCACCGCCGCGG - Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147742516 17:42677018-42677040 GAGCTGGGACCCCGCCCCCCCGG + Intergenic
1148081189 17:44968377-44968399 GAGCCGGGCCACCGCCCCCTCGG + Intergenic
1149997520 17:61412676-61412698 GAGCCCGGCACAGGCCGCCGAGG + Exonic
1150108225 17:62478014-62478036 AAGCCGAGCCCCCGCCCCCGCGG - Intronic
1152103020 17:78313990-78314012 AAGCCGGGGCCGCGCCGCAGCGG - Intergenic
1152125548 17:78444572-78444594 GGGCGGGGCCCCCGGCGCGGCGG + Intronic
1152225595 17:79091222-79091244 GAGCCGGGCCCCCCACGGCAAGG + Intronic
1152789916 17:82273378-82273400 GAATCGGGCCGCCGCCGCCATGG - Exonic
1152804971 17:82351387-82351409 GGGCTGGGACCCCGCGGCCGAGG + Intergenic
1152824807 17:82458308-82458330 GAGCCCGGCCGCGGCCTCCGCGG + Intronic
1203192015 17_KI270729v1_random:199244-199266 GATTTTGGCCCCCGCCGCCGCGG + Intergenic
1153955345 18:10091282-10091304 GAGCGGGGTCCCCACCCCCGGGG + Intergenic
1157464239 18:47930614-47930636 GAGCCTGGCCGCCGCCCGCGGGG + Intronic
1157580597 18:48771806-48771828 CGGCCGGCCCCCAGCCGCCGCGG + Intronic
1157610044 18:48950358-48950380 GAGCCGTGCGCCCGGCGGCGAGG - Exonic
1157794210 18:50559951-50559973 GAGCCGGGCCCTGGGCGCCCGGG - Intergenic
1160501460 18:79403146-79403168 GAGCCTGGCCCACGCCGCTGTGG + Intronic
1160718041 19:585323-585345 GCGCCGGGCACCCACCGACGGGG - Intergenic
1160718058 19:585371-585393 GCGCCGGGCACCCACCGACGGGG - Intergenic
1160718075 19:585419-585441 GCGCCGGGCACCCACCGACGGGG - Intergenic
1160765364 19:805252-805274 GGGCCGGGCCCGTGCCGCCGGGG - Intronic
1160957328 19:1699677-1699699 CAGCCTGGCCCCGGCCGCTGGGG + Intergenic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1161060683 19:2213356-2213378 GAGCTGGTCCCCTCCCGCCGTGG + Intronic
1161400880 19:4065872-4065894 GAGCCGGGCTCCCCTCGCCGGGG - Intronic
1161560290 19:4969264-4969286 GAGCGCGGACCCCGCCGCCATGG + Intronic
1161766833 19:6213008-6213030 GTGCCGGGCCCCCACCGCCGGGG - Exonic
1162013153 19:7830193-7830215 GAGCCGCTGCCCCGCCCCCGAGG - Intergenic
1162100499 19:8335751-8335773 GTGCCCGGTCCCCGCCGCCGGGG - Exonic
1163320476 19:16571904-16571926 GGGCCCGGCCGCCGCCCCCGAGG + Intronic
1163444498 19:17338697-17338719 GAGCTGGGCCACCTCTGCCGTGG + Exonic
1165065486 19:33225857-33225879 CTCCCGGGCCCCCGCCGCCCGGG - Intergenic
1165459601 19:35936686-35936708 CAGCCGGGACGCCGCCGCCCCGG + Intronic
1167570665 19:50286697-50286719 GAGCAGGGCCCCCGCTCCCCGGG + Intronic
1167738755 19:51311855-51311877 GAGCCGGGCCCCGGGCGCAGGGG - Exonic
1167797584 19:51719778-51719800 GACCTGGGCCTACGCCGCCGGGG - Exonic
1168344236 19:55642627-55642649 GGGTCGGGGCCCCGCCGCCGAGG - Exonic
925398898 2:3558041-3558063 CCGCCAGGCTCCCGCCGCCGGGG + Intronic
927932139 2:27051990-27052012 GAGACGGGCTCCCGCGGCAGGGG - Intronic
928606274 2:32947320-32947342 GAGCCAGGCCCCCGCCATCGCGG - Exonic
932699999 2:73985463-73985485 GAGGGCGGCCCGCGCCGCCGAGG - Intergenic
933876123 2:86623376-86623398 GGGCCGGACTCCCGCGGCCGCGG + Exonic
935594237 2:104867295-104867317 GCGCCGGGCCCTCTCCGCTGGGG + Intergenic
936038011 2:109128403-109128425 GAGCCGGGCGCCTGGCGCCAGGG + Intergenic
936433225 2:112482116-112482138 GAGGCGGGGCCGCGCCGGCGGGG + Intergenic
936556097 2:113499799-113499821 GAGCCTGGACCCCGCCTCCCAGG + Exonic
936608603 2:113980072-113980094 GAGCCAGGCCCTCGCTGCCAAGG + Intergenic
937907026 2:127057445-127057467 GAGCTGGGCCGCGGCGGCCGCGG + Intronic
938451422 2:131424963-131424985 CTGCCGAGCCCCCGCCGCCTGGG + Intergenic
943704462 2:191020543-191020565 GAGCAGTGCGCCCGCCGCCAGGG - Intronic
944692589 2:202171343-202171365 CTGCGGGGCCCCTGCCGCCGCGG - Intronic
946921523 2:224585493-224585515 GAGCCCGGCGGCCGCCGCGGGGG + Intergenic
947542698 2:230989929-230989951 GAGCCGGGGCCCAGCCACCCAGG + Intergenic
947765231 2:232633580-232633602 CCGCCGGGTCCCCGCCGCCTCGG + Exonic
948046893 2:234951999-234952021 GCGCTGGGCCCCCGCCTCGGCGG - Intronic
948805594 2:240452480-240452502 GAGCCGGGGCCCCTCCCCGGAGG - Intronic
949004289 2:241636826-241636848 GCGCCGGGCCTCGGCGGCCGGGG - Intronic
1170924722 20:20712492-20712514 AAGCCCGGGCCCCGCCGGCGGGG + Intergenic
1172015428 20:31870257-31870279 GCGCCGGGCCGCGGCGGCCGGGG + Intronic
1172155241 20:32819776-32819798 GGGCGGGGCCCCGACCGCCGGGG - Intergenic
1172367957 20:34363894-34363916 GAGCCGGGACCACCACGCCGGGG - Intronic
1173865217 20:46308621-46308643 GGCCCGGACCCCCGCAGCCGGGG + Intergenic
1174204315 20:48827969-48827991 GGGCCGGGCTCCCGGCGCGGCGG + Intergenic
1176229717 20:64026037-64026059 GAGCAGTGCCCCCACCGCCCGGG + Exonic
1176547444 21:8207969-8207991 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1176550033 21:8217047-8217069 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176555349 21:8252178-8252200 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1176566395 21:8391016-8391038 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1176568960 21:8400082-8400104 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176574271 21:8435203-8435225 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1176576874 21:8444317-8444339 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1178534980 21:33403619-33403641 GAGCCGGGCCTGGGCCTCCGCGG + Intronic
1180871703 22:19150292-19150314 CGGCCGGGGCGCCGCCGCCGCGG + Intergenic
1181594783 22:23907061-23907083 TAGCCAGGCCCCCGCTGCTGGGG - Intergenic
1182469998 22:30542584-30542606 GGGCCGGTCCCCGGCCGCCTCGG + Intronic
1183578226 22:38706047-38706069 GAGTCGGGCGGCGGCCGCCGCGG - Exonic
1183600280 22:38835923-38835945 GAGACGCCCCCCCGCCGCCCCGG + Intronic
1184523792 22:45009832-45009854 GCGCGGGGCTCCCGGCGCCGGGG - Intronic
1185255111 22:49827507-49827529 TTGCCGGGCTCCCGCGGCCGCGG - Intronic
1203252317 22_KI270733v1_random:124254-124276 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1203254923 22_KI270733v1_random:133373-133395 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203260374 22_KI270733v1_random:169340-169362 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1203262979 22_KI270733v1_random:178452-178474 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
950024298 3:9810046-9810068 GAGCTGGGGCCCGGGCGCCGGGG + Exonic
952287342 3:31981395-31981417 GGGCCGGGCCCTGGCCGCGGCGG - Intronic
953032674 3:39188540-39188562 GGGCCGGGCCCCCTCCTCCAGGG + Exonic
953246537 3:41199197-41199219 AGGCCGGGCCCCCGCGGCCTGGG - Intronic
954299047 3:49689578-49689600 GAGCCGGGTCGCTGCGGCCGAGG + Exonic
954304759 3:49719718-49719740 GAGCCCGGGCCCCGCCCCTGGGG - Intronic
954632860 3:52056470-52056492 GAGCTGCGCGCCCGCCGCCCCGG + Exonic
956414615 3:69013354-69013376 GGGCCGGGCGCCCGGGGCCGGGG + Intronic
960120872 3:113947885-113947907 GTGCCCCGCCCCCGGCGCCGGGG - Exonic
961081916 3:124034237-124034259 GCCCCGGGCCCCCGACGGCGAGG - Intergenic
968178205 3:196569079-196569101 CAGCCGGCCCCCGGCCCCCGCGG - Exonic
968727685 4:2255881-2255903 GAGCCTGGCTGCCGCTGCCGGGG + Intronic
968959954 4:3738379-3738401 GAGCAGGGCCCACTCCTCCGTGG - Intergenic
969682236 4:8649765-8649787 CAGCGGGGCCCCCGGCCCCGGGG - Intergenic
970456350 4:16226993-16227015 GAGCCGGGCCCCCGCCGCCGCGG - Intronic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
973894335 4:55396505-55396527 GAGCCCGGCCCCTGCTCCCGGGG + Intronic
973954520 4:56049421-56049443 GCGCCGAGCCCACGCCCCCGGGG - Intergenic
974385736 4:61200917-61200939 GAGCGGGCGCCCGGCCGCCGAGG - Intergenic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
982245314 4:153344848-153344870 GAGCCGGGCGACCGCTCCCGCGG - Intronic
982573299 4:157076493-157076515 CAGCCGGGTCCCCGCTGCGGTGG + Intronic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984206454 4:176792751-176792773 GAGCCGGGCCGCGGGCGCTGCGG + Intergenic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
984999840 4:185471797-185471819 CAGCCGAGCGCGCGCCGCCGAGG - Intronic
985498571 5:225535-225557 GGAGCAGGCCCCCGCCGCCGTGG + Exonic
985784818 5:1887978-1888000 GAGCCTGGTCCCAGCCGCCAGGG + Intergenic
986330851 5:6714717-6714739 GGGCCCCGCCCCCGCCCCCGCGG - Intronic
986608247 5:9544794-9544816 AAGCCAGGCACCGGCCGCCGCGG + Intronic
987379932 5:17275609-17275631 GAGCGCGGCCCCTGCCGCCGGGG + Exonic
987990218 5:25200111-25200133 GAGCCTTTCCCCCGCCTCCGTGG - Intergenic
989178923 5:38556825-38556847 GCGACGGGCCCCGGACGCCGAGG + Intronic
991435851 5:66596609-66596631 GCGCCGCGCCCCCGCCGCTCGGG + Exonic
995342257 5:111073033-111073055 GCTCCGGGACGCCGCCGCCGGGG + Intronic
996862783 5:128084136-128084158 CAGCCCGTCCCCGGCCGCCGCGG - Exonic
997454015 5:134004587-134004609 GGGCCTGGCCCCCGCCGTCCAGG + Intronic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
1000220184 5:159208220-159208242 CAACCGGGCCGCCGCCGCCGCGG + Intronic
1002405007 5:179023873-179023895 GAGCTGCGCGCCCCCCGCCGAGG + Exonic
1002527280 5:179821578-179821600 GAGCCGGGCGAGCGCCGGCGAGG + Intronic
1002758055 6:179867-179889 GAGCCTCCCCCCAGCCGCCGTGG + Intergenic
1003049413 6:2766045-2766067 GAGGCCGGCGGCCGCCGCCGCGG + Exonic
1003624079 6:7727017-7727039 GCTGCGGGCCCCCGCCGCTGCGG + Exonic
1004694296 6:18019763-18019785 GAGCCTCCCCCCCGCCGCCGTGG - Intergenic
1006936688 6:37723579-37723601 GAGCGGGGCCCCTGCCGGCAGGG - Intergenic
1010980582 6:82364976-82364998 CTCCCGGGGCCCCGCCGCCGGGG + Exonic
1011099838 6:83708878-83708900 GAGCGGAGCCCGGGCCGCCGAGG + Intronic
1012912910 6:105137246-105137268 GCGCCGGGCTCCGCCCGCCGGGG - Intergenic
1013117468 6:107114441-107114463 GCTCCCGGCCGCCGCCGCCGCGG + Intronic
1013556201 6:111259564-111259586 GGGCCGGGCCCCCGGCTGCGGGG + Exonic
1013556205 6:111259573-111259595 GAGCCGCTGCCCCGCAGCCGGGG - Exonic
1015935484 6:138403593-138403615 GTGCCGGGTCCCCGCCGCAGGGG + Intronic
1017913934 6:158818345-158818367 GGGCCGGGCCCCCGGCGAGGAGG + Intronic
1019111932 6:169724023-169724045 GCGCGGGCCCCCCGCCGCCCCGG + Exonic
1019343753 7:519994-520016 GGGCCCGGGCGCCGCCGCCGCGG + Intronic
1019365180 7:629432-629454 GAGCGGGGCCACGGCCTCCGAGG + Intronic
1019365249 7:629656-629678 GAGCGGGGCCACGGCCTCCGAGG + Intronic
1019365266 7:629712-629734 GAGCGGGGCCACGGCCTCCGAGG + Intronic
1019365284 7:629768-629790 GAGCGGGGCCACGGCCTCCGAGG + Intronic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1020288780 7:6706646-6706668 GAGCCGGGGCCGGGCCGTCGAGG + Exonic
1021600228 7:22356994-22357016 GAGCCCGGCCCTGGCCGCCGCGG - Intronic
1022698006 7:32728684-32728706 GGGCCGGGGGGCCGCCGCCGCGG + Intergenic
1023064845 7:36367029-36367051 CCGCCGCGCCCCCGCCACCGAGG - Intronic
1023842265 7:44104291-44104313 GAGCCGGCTCCCCACCCCCGGGG - Intergenic
1023881883 7:44325418-44325440 GAGCCCGTCCGCCGCCGCCATGG - Exonic
1025777305 7:64570408-64570430 GAGCCGGGCCCCGGGCGCAGCGG + Intergenic
1027055455 7:75046500-75046522 GAGCCGGGCCCTTGCTGCCCAGG - Intronic
1027211214 7:76150345-76150367 GAGCCAGGCCCCCGCCGCCGTGG + Intergenic
1029207558 7:98878616-98878638 GAGCCGGGCCGCCGAGGTCGGGG + Exonic
1030121216 7:106112327-106112349 GAGGCGGGCCCGGGCGGCCGTGG + Intronic
1033654302 7:143362620-143362642 GAGCCGGGCCCTCACCGACTCGG + Exonic
1034254095 7:149714966-149714988 GACCTGGGCCGCCGCCGACGAGG + Intronic
1034446088 7:151115019-151115041 GCGCCAGGCCCCGGCGGCCGAGG - Intronic
1034967463 7:155400131-155400153 GAGCCCGGCCCCGGGCACCGTGG - Intergenic
1035023067 7:155809978-155810000 TCTCCGCGCCCCCGCCGCCGGGG + Intronic
1035168168 7:157003706-157003728 GGGCCGGGCCTCCGCCGCCTGGG - Intronic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1035361018 7:158314562-158314584 GAGCTGGGCCCAAGCCGCCCTGG + Intronic
1035404269 7:158587850-158587872 GGGGCGGGGCCCTGCCGCCGGGG - Intergenic
1036930461 8:12951508-12951530 GGGCCGCGCCCGCCCCGCCGGGG - Intronic
1038311676 8:26449955-26449977 GAGCCGAGTCCCCGGCGCCCAGG + Intronic
1039996958 8:42541956-42541978 CCGCCGAGCCCCCGCCGCCCCGG - Intronic
1044822031 8:96161148-96161170 GAGCCGGGGCCGCGCTGCGGAGG - Intergenic
1047732397 8:127737776-127737798 GCGCCGGGGCCCCTCCGCTGCGG - Intronic
1048214351 8:132481160-132481182 GAGGCGGGGCGCCGCCGCCCGGG - Intergenic
1049896932 9:117564-117586 GAGCCTGGACCCCGCCTCCCAGG - Exonic
1049989395 9:977282-977304 TGCCAGGGCCCCCGCCGCCGGGG + Exonic
1053603311 9:39632097-39632119 GAGAAGGGCCCCTTCCGCCGGGG + Intergenic
1053860945 9:42385816-42385838 GAGAAGGGCCCCTTCCGCCGGGG + Intergenic
1054442997 9:65283810-65283832 GAGCCTGGACCCCGCCTCCCAGG - Exonic
1054487283 9:65737691-65737713 GAGCCTGGACCCCGCCTCCCAGG + Exonic
1054564335 9:66744856-66744878 GAGAAGGGCCCCTTCCGCCGGGG - Intergenic
1054842665 9:69760045-69760067 AGGCCGCGTCCCCGCCGCCGCGG + Intergenic
1055611691 9:78031331-78031353 CCGCCGAGCCCCCGCCGCCCGGG + Exonic
1056992343 9:91423719-91423741 GGGCCGGGCCTCCGGGGCCGCGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057490452 9:95516220-95516242 CGCCCGGGCCCCCGCCCCCGAGG - Intronic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060598440 9:124862019-124862041 GAGCCGGGGCTCCCCCGCTGCGG - Intergenic
1060811178 9:126612399-126612421 GTGTCGGGCCCCCGCCTCTGCGG - Intergenic
1060812687 9:126618955-126618977 ACGCCGCGGCCCCGCCGCCGAGG - Intronic
1060821713 9:126665210-126665232 GAGCCGGTCCCCCTCCTCCACGG + Intronic
1062119999 9:134829336-134829358 GAGCCTGGCCCCAGCCCTCGGGG - Intronic
1062120055 9:134829510-134829532 GAGCCTGGCCCCAGCCCTCGGGG - Intronic
1062120112 9:134829680-134829702 GAGCCGGGCCCCAGCCCTTGGGG - Intronic
1062314821 9:135961443-135961465 GCGCCTCGCTCCCGCCGCCGGGG + Intergenic
1062482265 9:136757993-136758015 GAGCCCGGACCCCGCCACGGAGG - Exonic
1203468722 Un_GL000220v1:107405-107427 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1203471325 Un_GL000220v1:116519-116541 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203476543 Un_GL000220v1:151377-151399 GCCCCGGGGCCCCGCCACCGGGG - Intergenic
1203479146 Un_GL000220v1:160491-160513 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1185466491 X:358143-358165 GAGCCGGGCCCCCGGCCCAGGGG - Intronic
1185508428 X:645149-645171 GAGCCCGGCCCCTGCCTCCTGGG - Exonic
1190096234 X:47483052-47483074 GCGCGGGGTCCCGGCCGCCGCGG - Intergenic
1192260774 X:69504886-69504908 GAGCCGGGCGGCCGCCGGCGCGG + Intergenic
1200129006 X:153830923-153830945 GCGCCCCTCCCCCGCCGCCGTGG - Intergenic
1200163338 X:154020015-154020037 GACCCGGGCCCTCCCCGGCGCGG - Intergenic