ID: 970459525

View in Genome Browser
Species Human (GRCh38)
Location 4:16258911-16258933
Sequence CAGGGCAAGGACTCTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970459525_970459530 2 Left 970459525 4:16258911-16258933 CCTGGATCAGAGTCCTTGCCCTG No data
Right 970459530 4:16258936-16258958 CCTACAGCTCTTTAGCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970459525 Original CRISPR CAGGGCAAGGACTCTGATCC AGG (reversed) Intergenic
No off target data available for this crispr