ID: 970467889

View in Genome Browser
Species Human (GRCh38)
Location 4:16345969-16345991
Sequence CTGTCTTTGAAGATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970467889_970467894 28 Left 970467889 4:16345969-16345991 CCTTCTTCCATCTTCAAAGACAG No data
Right 970467894 4:16346020-16346042 GCCTCCTTCTTCCACAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970467889 Original CRISPR CTGTCTTTGAAGATGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr