ID: 970469267

View in Genome Browser
Species Human (GRCh38)
Location 4:16360516-16360538
Sequence ATGTAGACAGAGTTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970469267_970469275 24 Left 970469267 4:16360516-16360538 CCCAGCTCCAACTCTGTCTACAT No data
Right 970469275 4:16360563-16360585 TGTCCCTCTCCACAGCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970469267 Original CRISPR ATGTAGACAGAGTTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr