ID: 970469456

View in Genome Browser
Species Human (GRCh38)
Location 4:16362198-16362220
Sequence GCCAGAAATGACAAGGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970469456_970469462 16 Left 970469456 4:16362198-16362220 CCACTTACCTTGTCATTTCTGGC No data
Right 970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG No data
970469456_970469464 24 Left 970469456 4:16362198-16362220 CCACTTACCTTGTCATTTCTGGC No data
Right 970469464 4:16362245-16362267 CTGGTGGCCAGTAGGAAAGGAGG No data
970469456_970469459 0 Left 970469456 4:16362198-16362220 CCACTTACCTTGTCATTTCTGGC No data
Right 970469459 4:16362221-16362243 TGAGATTTGTCTCTACTTATGGG No data
970469456_970469461 8 Left 970469456 4:16362198-16362220 CCACTTACCTTGTCATTTCTGGC No data
Right 970469461 4:16362229-16362251 GTCTCTACTTATGGGTCTGGTGG No data
970469456_970469458 -1 Left 970469456 4:16362198-16362220 CCACTTACCTTGTCATTTCTGGC No data
Right 970469458 4:16362220-16362242 CTGAGATTTGTCTCTACTTATGG No data
970469456_970469460 5 Left 970469456 4:16362198-16362220 CCACTTACCTTGTCATTTCTGGC No data
Right 970469460 4:16362226-16362248 TTTGTCTCTACTTATGGGTCTGG No data
970469456_970469463 21 Left 970469456 4:16362198-16362220 CCACTTACCTTGTCATTTCTGGC No data
Right 970469463 4:16362242-16362264 GGTCTGGTGGCCAGTAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970469456 Original CRISPR GCCAGAAATGACAAGGTAAG TGG (reversed) Intergenic
No off target data available for this crispr