ID: 970469457

View in Genome Browser
Species Human (GRCh38)
Location 4:16362205-16362227
Sequence AATCTCAGCCAGAAATGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970469457_970469462 9 Left 970469457 4:16362205-16362227 CCTTGTCATTTCTGGCTGAGATT No data
Right 970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG No data
970469457_970469460 -2 Left 970469457 4:16362205-16362227 CCTTGTCATTTCTGGCTGAGATT No data
Right 970469460 4:16362226-16362248 TTTGTCTCTACTTATGGGTCTGG No data
970469457_970469458 -8 Left 970469457 4:16362205-16362227 CCTTGTCATTTCTGGCTGAGATT No data
Right 970469458 4:16362220-16362242 CTGAGATTTGTCTCTACTTATGG No data
970469457_970469464 17 Left 970469457 4:16362205-16362227 CCTTGTCATTTCTGGCTGAGATT No data
Right 970469464 4:16362245-16362267 CTGGTGGCCAGTAGGAAAGGAGG No data
970469457_970469463 14 Left 970469457 4:16362205-16362227 CCTTGTCATTTCTGGCTGAGATT No data
Right 970469463 4:16362242-16362264 GGTCTGGTGGCCAGTAGGAAAGG No data
970469457_970469461 1 Left 970469457 4:16362205-16362227 CCTTGTCATTTCTGGCTGAGATT No data
Right 970469461 4:16362229-16362251 GTCTCTACTTATGGGTCTGGTGG No data
970469457_970469459 -7 Left 970469457 4:16362205-16362227 CCTTGTCATTTCTGGCTGAGATT No data
Right 970469459 4:16362221-16362243 TGAGATTTGTCTCTACTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970469457 Original CRISPR AATCTCAGCCAGAAATGACA AGG (reversed) Intergenic
No off target data available for this crispr