ID: 970469462

View in Genome Browser
Species Human (GRCh38)
Location 4:16362237-16362259
Sequence TTATGGGTCTGGTGGCCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970469457_970469462 9 Left 970469457 4:16362205-16362227 CCTTGTCATTTCTGGCTGAGATT No data
Right 970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG No data
970469456_970469462 16 Left 970469456 4:16362198-16362220 CCACTTACCTTGTCATTTCTGGC No data
Right 970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970469462 Original CRISPR TTATGGGTCTGGTGGCCAGT AGG Intergenic
No off target data available for this crispr