ID: 970475011

View in Genome Browser
Species Human (GRCh38)
Location 4:16413072-16413094
Sequence AAGACTAAACCGTAAGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970475011_970475015 12 Left 970475011 4:16413072-16413094 CCTGGTACTTACGGTTTAGTCTT No data
Right 970475015 4:16413107-16413129 TGGACACCCCTTGCAAACTCAGG No data
970475011_970475012 -8 Left 970475011 4:16413072-16413094 CCTGGTACTTACGGTTTAGTCTT No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970475011 Original CRISPR AAGACTAAACCGTAAGTACC AGG (reversed) Intergenic