ID: 970475012

View in Genome Browser
Species Human (GRCh38)
Location 4:16413087-16413109
Sequence TTAGTCTTTGTAGACTCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970475002_970475012 24 Left 970475002 4:16413040-16413062 CCTCCTGCTGTGTGGCCACTCCC No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data
970475001_970475012 28 Left 970475001 4:16413036-16413058 CCATCCTCCTGCTGTGTGGCCAC No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data
970475009_970475012 1 Left 970475009 4:16413063-16413085 CCACACTTGCCTGGTACTTACGG No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data
970475006_970475012 4 Left 970475006 4:16413060-16413082 CCCCCACACTTGCCTGGTACTTA No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data
970475003_970475012 21 Left 970475003 4:16413043-16413065 CCTGCTGTGTGGCCACTCCCCCA No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data
970475005_970475012 9 Left 970475005 4:16413055-16413077 CCACTCCCCCACACTTGCCTGGT No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data
970475011_970475012 -8 Left 970475011 4:16413072-16413094 CCTGGTACTTACGGTTTAGTCTT No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data
970475008_970475012 2 Left 970475008 4:16413062-16413084 CCCACACTTGCCTGGTACTTACG No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data
970475000_970475012 29 Left 970475000 4:16413035-16413057 CCCATCCTCCTGCTGTGTGGCCA No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data
970475007_970475012 3 Left 970475007 4:16413061-16413083 CCCCACACTTGCCTGGTACTTAC No data
Right 970475012 4:16413087-16413109 TTAGTCTTTGTAGACTCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970475012 Original CRISPR TTAGTCTTTGTAGACTCCCG TGG Intergenic