ID: 970475015

View in Genome Browser
Species Human (GRCh38)
Location 4:16413107-16413129
Sequence TGGACACCCCTTGCAAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970475006_970475015 24 Left 970475006 4:16413060-16413082 CCCCCACACTTGCCTGGTACTTA No data
Right 970475015 4:16413107-16413129 TGGACACCCCTTGCAAACTCAGG No data
970475007_970475015 23 Left 970475007 4:16413061-16413083 CCCCACACTTGCCTGGTACTTAC No data
Right 970475015 4:16413107-16413129 TGGACACCCCTTGCAAACTCAGG No data
970475008_970475015 22 Left 970475008 4:16413062-16413084 CCCACACTTGCCTGGTACTTACG No data
Right 970475015 4:16413107-16413129 TGGACACCCCTTGCAAACTCAGG No data
970475011_970475015 12 Left 970475011 4:16413072-16413094 CCTGGTACTTACGGTTTAGTCTT No data
Right 970475015 4:16413107-16413129 TGGACACCCCTTGCAAACTCAGG No data
970475005_970475015 29 Left 970475005 4:16413055-16413077 CCACTCCCCCACACTTGCCTGGT No data
Right 970475015 4:16413107-16413129 TGGACACCCCTTGCAAACTCAGG No data
970475009_970475015 21 Left 970475009 4:16413063-16413085 CCACACTTGCCTGGTACTTACGG No data
Right 970475015 4:16413107-16413129 TGGACACCCCTTGCAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970475015 Original CRISPR TGGACACCCCTTGCAAACTC AGG Intergenic