ID: 970483220

View in Genome Browser
Species Human (GRCh38)
Location 4:16498706-16498728
Sequence AAGCAGCCACAAGCCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970483220_970483223 0 Left 970483220 4:16498706-16498728 CCTGGGCTGGCTTGTGGCTGCTT No data
Right 970483223 4:16498729-16498751 TGGTGGATAGCATACAGAAGAGG No data
970483220_970483224 21 Left 970483220 4:16498706-16498728 CCTGGGCTGGCTTGTGGCTGCTT No data
Right 970483224 4:16498750-16498772 GGTGCTTCAGTGCCAGTTCTAGG No data
970483220_970483225 27 Left 970483220 4:16498706-16498728 CCTGGGCTGGCTTGTGGCTGCTT No data
Right 970483225 4:16498756-16498778 TCAGTGCCAGTTCTAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970483220 Original CRISPR AAGCAGCCACAAGCCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr