ID: 970483224

View in Genome Browser
Species Human (GRCh38)
Location 4:16498750-16498772
Sequence GGTGCTTCAGTGCCAGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970483218_970483224 28 Left 970483218 4:16498699-16498721 CCTTGAACCTGGGCTGGCTTGTG No data
Right 970483224 4:16498750-16498772 GGTGCTTCAGTGCCAGTTCTAGG No data
970483220_970483224 21 Left 970483220 4:16498706-16498728 CCTGGGCTGGCTTGTGGCTGCTT No data
Right 970483224 4:16498750-16498772 GGTGCTTCAGTGCCAGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970483224 Original CRISPR GGTGCTTCAGTGCCAGTTCT AGG Intergenic
No off target data available for this crispr