ID: 970483225

View in Genome Browser
Species Human (GRCh38)
Location 4:16498756-16498778
Sequence TCAGTGCCAGTTCTAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970483220_970483225 27 Left 970483220 4:16498706-16498728 CCTGGGCTGGCTTGTGGCTGCTT No data
Right 970483225 4:16498756-16498778 TCAGTGCCAGTTCTAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970483225 Original CRISPR TCAGTGCCAGTTCTAGGCAC TGG Intergenic
No off target data available for this crispr