ID: 970486133

View in Genome Browser
Species Human (GRCh38)
Location 4:16526444-16526466
Sequence ATCTTCAGCCCCAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 302}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970486133 Original CRISPR ATCTTCAGCCCCAGGGAAGC TGG (reversed) Intronic
900180542 1:1309131-1309153 ATCTCCAGCCGCACGGACGCCGG + Exonic
900547299 1:3236104-3236126 AACTGCAGCCCCAGGGCAGGTGG + Intronic
900865877 1:5268316-5268338 TTCTCCAGCCCCGGGGAAGGTGG - Intergenic
904253711 1:29241317-29241339 ACCTCCAGCCCCAGGGATGCTGG - Intronic
904577041 1:31511543-31511565 CTCTTCAGCTCCAGGGACTCTGG - Intergenic
907299647 1:53478582-53478604 AAATTCATCCCCAGGGAATCTGG - Intergenic
909756450 1:79231633-79231655 AACTTCAGCCCCAGGGAATTAGG - Intergenic
910025525 1:82646571-82646593 ATCTTCAGCAGCAGGGGAGCAGG - Intergenic
910225722 1:84934102-84934124 ATCATAAGCCCCTGGAAAGCAGG + Intronic
912020182 1:105098293-105098315 AACTTCAGCCCAAAGGAAGATGG - Intergenic
912412068 1:109486468-109486490 ATCTTCAGCCCCAGTGACATGGG + Intronic
912452043 1:109773265-109773287 CTCTCCAGCCCCAGGGCAGCTGG + Intronic
912489080 1:110051547-110051569 CTCTTCAGTCCAAGGGAAACTGG + Intronic
912688650 1:111786918-111786940 AGCCTCAGACGCAGGGAAGCGGG - Intronic
913117438 1:115710522-115710544 AGCTTCAACATCAGGGAAGCAGG + Intronic
916449840 1:164910005-164910027 AGGTTCAGGCCCAGGAAAGCTGG + Intergenic
917862380 1:179159066-179159088 GTATTCAGACCCAGGGAATCTGG - Intronic
917960075 1:180135278-180135300 ATCTTCAGTCCCAGGTATTCAGG + Intergenic
918067395 1:181110494-181110516 CTCTTCAGCCCCAGAGGAACTGG + Intergenic
918484614 1:185016184-185016206 ATCTTCAGACACCAGGAAGCTGG - Intergenic
918641593 1:186847744-186847766 ATCTCCACCCCAAGGGAAGAGGG - Intronic
920685779 1:208108076-208108098 ATCTTCAGCCCCGCTGAATCAGG - Intronic
921031162 1:211336295-211336317 AGCTTTAGCCCAAGGGTAGCAGG - Intronic
923211799 1:231810252-231810274 GTCTGCAGCTGCAGGGAAGCAGG + Intronic
1062819612 10:524160-524182 AGCTTCTACCCCAGGGAGGCTGG + Intronic
1063614297 10:7588983-7589005 ATCTGCAGCCCCAGGACGGCTGG + Intronic
1063647464 10:7899284-7899306 GTCTTCTGCCCAAGGGAAGAAGG + Intronic
1063897757 10:10700250-10700272 ATGAGCAGCCCCAGGGAAGAGGG + Intergenic
1065819365 10:29510995-29511017 GTCTCCAGCCAAAGGGAAGCAGG + Intronic
1065953482 10:30673419-30673441 GTCTCCAGCCAAAGGGAAGCAGG - Intergenic
1067277685 10:44849609-44849631 AGCTGGAGGCCCAGGGAAGCTGG - Intergenic
1067561693 10:47309005-47309027 GCCGGCAGCCCCAGGGAAGCCGG + Intronic
1067796469 10:49325509-49325531 TTCTGCAGACTCAGGGAAGCTGG + Exonic
1068288052 10:54964727-54964749 ATTTTAAGCCCCAGGGAAAATGG - Intronic
1068983651 10:63087420-63087442 ATATTCAGGCTCAGGGAAGAAGG - Intergenic
1069530943 10:69218988-69219010 ATCTCAATCCCCAGGGTAGCTGG - Intergenic
1070625835 10:78050339-78050361 CTCCTCAGCCCCAGGTAAGTGGG - Intronic
1071601703 10:86961708-86961730 ATCATCAGCCTTAGGGCAGCAGG + Intronic
1072500166 10:96007412-96007434 ATCCTAAGTCCCAGGGATGCTGG - Intronic
1073150521 10:101308331-101308353 ACCTTTAGTCCCAGAGAAGCTGG - Intergenic
1074654637 10:115571016-115571038 TTCTCCATCCCCAGTGAAGCTGG - Intronic
1075999855 10:126905754-126905776 AGCTCCAGCCCCGGGGATGCGGG + Intronic
1076630072 10:131847031-131847053 ATCGCCAGCCCCAGGACAGCAGG + Intergenic
1077120996 11:908472-908494 AGCAACAGCCCCAGGGAAGGTGG + Intronic
1077138548 11:1013422-1013444 TCCTTCAGCCCCAGGAGAGCAGG + Exonic
1077233250 11:1468113-1468135 CCCTTCAGCCCCAGTGGAGCTGG + Intergenic
1077331497 11:1985805-1985827 ATCTTCAGACCCAGGGCAGGTGG + Intergenic
1077510553 11:2958983-2959005 CACTCCAGCCCCAGGGATGCTGG + Intronic
1077862975 11:6199463-6199485 ATCTATAGCCCCAGGGTTGCTGG + Exonic
1080388338 11:31823408-31823430 ATCTTCACCCCAAAGGAGGCTGG + Intronic
1081145276 11:39555917-39555939 TGCTTCAGCCTCAGGGTAGCTGG - Intergenic
1081578731 11:44336771-44336793 ATGAACAGCCCCAGGGAAACTGG + Intergenic
1081688533 11:45059272-45059294 TCCTTCAGCCCCATGGAAGCAGG - Intergenic
1083485386 11:62980280-62980302 ATCTTCAGGGCCAAGGCAGCTGG + Intronic
1083798310 11:65031498-65031520 ATCTTCTCCCGCAGGGAAGGAGG + Intronic
1084119746 11:67062197-67062219 ATGCTCACCACCAGGGAAGCTGG - Intronic
1087301119 11:96437074-96437096 ATTTTCTGCCACAAGGAAGCAGG + Intronic
1087773669 11:102238389-102238411 ATTTTGAGCCCCAGGGAATACGG - Intergenic
1089149391 11:116353100-116353122 CTCCTCAGCCACAGGTAAGCTGG + Intergenic
1089375287 11:117989600-117989622 ACCTTCATCCACAGAGAAGCGGG - Exonic
1090455532 11:126845440-126845462 ATCTTAAGCTGCAGGGAATCTGG + Intronic
1090575438 11:128096945-128096967 ATCTTGAGGCCCAAGAAAGCTGG - Intergenic
1091048167 11:132343983-132344005 ACCTCCAGCCACGGGGAAGCTGG - Intergenic
1202814478 11_KI270721v1_random:40981-41003 ATCTTCAGACCCAGGGCAGGTGG + Intergenic
1091385634 12:92805-92827 GTGTGCAGCCCCTGGGAAGCAGG + Intronic
1091726974 12:2853190-2853212 ATCTTCAGGGCAAGGGTAGCAGG + Intronic
1092773229 12:11917576-11917598 ATCTTAAGCTCCAGGAAGGCAGG + Intergenic
1093009255 12:14087517-14087539 TGCTTCAGCCCCAGAGTAGCTGG + Intergenic
1094727226 12:33132656-33132678 TTCTTCAGTCACAGGCAAGCAGG + Intergenic
1097746964 12:63313185-63313207 ACCTTCCTCCCCAAGGAAGCAGG - Intergenic
1099043800 12:77690173-77690195 ATATTCAGCCCCAGTTAATCAGG - Intergenic
1099056380 12:77846509-77846531 TTCTTCAGTCCCAGGCAAACTGG + Intronic
1101756795 12:107627399-107627421 CTCATCAGCTCCTGGGAAGCAGG + Intronic
1101922890 12:108947218-108947240 ATCTTCTGCCAAAGGGAACCAGG - Intronic
1102027768 12:109723315-109723337 TTCCTCATCCCCAGGGAAACTGG - Intronic
1102201577 12:111061058-111061080 ATGAACAGCCCCAAGGAAGCGGG - Intronic
1102965459 12:117121805-117121827 GTCATCAGACCCAGGGAATCTGG + Intergenic
1104233696 12:126910762-126910784 ACCCTGAGCCCCGGGGAAGCAGG + Intergenic
1104289285 12:127454239-127454261 ATCTCCAGCCCCAGGGAGCTGGG + Intergenic
1105634151 13:22201209-22201231 ATCTTTAGCCACAGGGGACCAGG + Intergenic
1106044541 13:26126440-26126462 GTCATCTGCCCCAGGGAGGCAGG + Intergenic
1109297098 13:60547397-60547419 TGCTTCAGCTCCAGGGGAGCTGG + Intronic
1109759115 13:66803593-66803615 GTCTTCAGTACCAGGGCAGCAGG + Intronic
1110281523 13:73699258-73699280 ATCTGCAGCCCCAGCGATTCGGG + Intronic
1113707829 13:112445686-112445708 GCCTTCACCCTCAGGGAAGCGGG + Intergenic
1113911579 13:113843772-113843794 AAATTCAGCCCCAGACAAGCAGG - Intronic
1114463560 14:22904006-22904028 AGTTGCAGCACCAGGGAAGCTGG + Intronic
1119406470 14:74402509-74402531 TTCCCCAGCCCCAGGGAAGAAGG - Intergenic
1119752341 14:77088512-77088534 CTCTCCAGCCCCAGGGAGTCTGG - Intergenic
1120523823 14:85554858-85554880 ACCTTCAGCCACAGGGAAAAGGG - Intronic
1121571778 14:94951719-94951741 ACCTTCAGTCCCAGGCAAACTGG - Intergenic
1121958678 14:98238518-98238540 ATCTTCATCCCCACAAAAGCTGG + Intergenic
1122126008 14:99579211-99579233 AACTTCAGCCCCAGGACAGGGGG - Intronic
1122273157 14:100577463-100577485 AGCTGCAGCCCCAGGGGAGAAGG - Intronic
1122816639 14:104317194-104317216 AGCTTCAGCCCCCGGCTAGCCGG + Intergenic
1123429359 15:20201882-20201904 ACCTTCAGCTCCAAGGAAGAGGG - Intergenic
1124128968 15:26968158-26968180 ATTTTCAGCCCTGGAGAAGCGGG - Intergenic
1124343191 15:28903112-28903134 ATCATCAGACCCATGGAACCTGG - Intronic
1124945589 15:34262612-34262634 ATCTGCAGCCCCATGGATGGCGG - Intronic
1125159038 15:36622554-36622576 ATCTTCATACACAGAGAAGCTGG + Intronic
1125255640 15:37759772-37759794 TTCTCCAGCCCCAGGGGAGTAGG + Intergenic
1126466409 15:48964966-48964988 CTCCTCAGCCCCAGGGATGTGGG - Intergenic
1127293153 15:57588128-57588150 AGCTTCAACCCCAGGCAAGATGG - Intergenic
1130859035 15:87869613-87869635 ATTGTCAGTCCCATGGAAGCAGG + Intronic
1130939183 15:88493801-88493823 ATCTCCATCCCCACGGCAGCGGG - Intergenic
1131094453 15:89646851-89646873 AACTTCATCTCCAGGGAGGCAGG + Exonic
1131213793 15:90520326-90520348 ATCCTCAGCCCCCGAGTAGCTGG + Intergenic
1132116045 15:99137219-99137241 GTCTTCAGCCCCCTGGAAGGAGG - Exonic
1132200709 15:99952874-99952896 TTCTTCAGCTCCAGGGACGCTGG + Intergenic
1134776948 16:16861750-16861772 ATCTTCAGCCCTAGGCCAGAGGG - Intergenic
1134832130 16:17332143-17332165 ACAGTCAGCCCCAGGGAAGCAGG - Intronic
1134837571 16:17374952-17374974 ATCCTCAGTCCCAGGCAAGCTGG - Intronic
1135498531 16:22973760-22973782 CTCTTCAGCCAGAGGGAGGCTGG - Intergenic
1135707635 16:24688442-24688464 ACCCTCACCTCCAGGGAAGCAGG + Intergenic
1135752740 16:25069878-25069900 ATCTGGAACCCCAGGGAAGACGG - Intergenic
1135941498 16:26826073-26826095 ATCTGCAGCCACAGGTAAACTGG - Intergenic
1136229508 16:28878279-28878301 AGCCCCAGCCCCAGGGAAGTGGG - Intergenic
1137444898 16:48525697-48525719 CTCATCAGCACTAGGGAAGCAGG + Intergenic
1137702309 16:50506156-50506178 ATCTTCAGCCCCAGAGGTCCAGG - Intergenic
1137936558 16:52640436-52640458 AGCTTCACCCCCAGGGGAGGCGG + Intergenic
1138576984 16:57914292-57914314 CTCTGCAGCCCCTGGGAGGCTGG + Intronic
1138605726 16:58086949-58086971 CACATCAGCCCTAGGGAAGCAGG + Intergenic
1138978917 16:62242596-62242618 AGCTGAAGCCCCAGGAAAGCTGG + Intergenic
1140069623 16:71637940-71637962 ATCTTCACCCACAGGGATGTGGG - Intronic
1140916226 16:79495715-79495737 TTCATCAGCACAAGGGAAGCTGG - Intergenic
1141832341 16:86516814-86516836 CTCCTCAGCCCCAGGCAAGGGGG + Intergenic
1142003106 16:87675299-87675321 AGCATCAGCCCAAAGGAAGCAGG - Intronic
1145255435 17:21319720-21319742 ATCTTCACGCCCAGGGCAGCCGG + Intergenic
1145321175 17:21768232-21768254 ATCTTCACGCCCACGGCAGCTGG - Intergenic
1146502748 17:33378443-33378465 GTCTGCAGGCCCAGGGAAGTGGG + Intronic
1147119378 17:38326934-38326956 AAAGTCAGCCCCAAGGAAGCAGG - Exonic
1147467289 17:40620029-40620051 TTCCTCAGTCCCAGGTAAGCGGG + Intergenic
1147909562 17:43847365-43847387 CTCCTCAGCCCTAGGGGAGCGGG + Intronic
1149112172 17:53046816-53046838 CTCCTCAGCCCCAGGGAAGCTGG - Intergenic
1149446529 17:56717625-56717647 ATCTGCAACCCCAGGGAAAAGGG - Intergenic
1150465139 17:65386367-65386389 ACCTCTAGCCCCAGGAAAGCAGG - Intergenic
1151815270 17:76468618-76468640 ATCCTCATCTCCAGGGAGGCAGG - Intronic
1152595735 17:81236791-81236813 ATCTTCAGCACCTGGGGAGTGGG + Exonic
1152946414 17:83200046-83200068 ATCCTCAGTTCCAGGGAAGTGGG + Intergenic
1153060661 18:991580-991602 ATCTGCAGTTCCAGGGAAGGAGG - Intergenic
1153144933 18:2020354-2020376 AGCTCCTGCCCAAGGGAAGCAGG + Intergenic
1153539584 18:6139713-6139735 GTCTTCAGCCCCATGAAACCAGG - Intronic
1153614519 18:6921849-6921871 ATCAGGAGCTCCAGGGAAGCTGG + Intergenic
1154997775 18:21657451-21657473 CACTTCAGCCCCAGAGTAGCTGG + Intronic
1155580492 18:27299726-27299748 AGCTAGAGACCCAGGGAAGCTGG - Intergenic
1155770356 18:29690321-29690343 ATCTTCAGCCAGACGGAAGCAGG + Intergenic
1159022168 18:63152295-63152317 AACACCAGCCCCAAGGAAGCAGG - Intronic
1159598004 18:70401829-70401851 AGCTGCAGAACCAGGGAAGCAGG - Intergenic
1160541829 18:79628129-79628151 CACTTCAGGCCCAGGGAACCTGG + Intergenic
1160843999 19:1158743-1158765 ATCTTCAGGTCCTGGGACGCAGG - Intronic
1161506708 19:4648129-4648151 AGCTTCTGCCCCAGGACAGCTGG + Intronic
1164876512 19:31694338-31694360 AACTTCAGCAGGAGGGAAGCAGG + Intergenic
1165144489 19:33722618-33722640 ATGCCCAGCCCCAGGGAAGAGGG - Intronic
1166826763 19:45614692-45614714 ATTTTCTGCCCCAGGGGACCCGG - Exonic
925134003 2:1514094-1514116 AACTGGAGCCCCAGGGGAGCTGG + Intronic
925258422 2:2509192-2509214 AGCTGCAACCCCAGGGAAGCTGG + Intergenic
925833135 2:7915939-7915961 ATCTTAAGTCCCTGGGAACCTGG + Intergenic
927075982 2:19578071-19578093 ATCATGAGACCCAGGGAGGCAGG + Intergenic
928364641 2:30691696-30691718 AGCTTCAGCCCAAGGGAAACAGG + Intergenic
930257340 2:49107448-49107470 ATAATTAGCCCCAGGAAAGCAGG + Intronic
930324446 2:49897705-49897727 ATCTGGAGACCCAGGAAAGCTGG + Intergenic
932199426 2:69812519-69812541 AGCTTCAGACCCAGGGAGGGAGG - Intronic
933560780 2:83883446-83883468 AGCTGGAGACCCAGGGAAGCTGG + Intergenic
936280525 2:111136003-111136025 ATCCCCAGCCCAGGGGAAGCAGG - Intronic
936462799 2:112724645-112724667 CTCTTCAGCCCCTGGGAACCCGG - Intronic
937097106 2:119242523-119242545 CCCTTCAGCCCCGGGGAAGGAGG - Intronic
937440499 2:121911251-121911273 ATCTTCCAGCCCAAGGAAGCAGG - Intergenic
938554989 2:132416352-132416374 AGGTGCAGCCCCGGGGAAGCTGG - Intergenic
938703400 2:133898929-133898951 ATCTGCAACCCCTGGGAAGTGGG + Intergenic
938937326 2:136138396-136138418 AAATTCAGCCCCAGGCAAGTTGG + Intergenic
939029480 2:137054512-137054534 ATATACATCCCCAGAGAAGCAGG - Intronic
940017408 2:149121706-149121728 AGCTGCAGCCACAGAGAAGCAGG + Intronic
940289871 2:152068022-152068044 ATTTTCAGCCCCATGGCTGCAGG - Intronic
942417114 2:175771148-175771170 ATCAGCACCCCCAAGGAAGCCGG + Intergenic
944441869 2:199751324-199751346 ATCTTCAGAACCAGGGACACGGG + Intergenic
945563801 2:211370999-211371021 ATCTGCAGACCCAAGGAAGAAGG - Intergenic
945681152 2:212916117-212916139 GTGTTCAGCAGCAGGGAAGCAGG - Intergenic
947028195 2:225762699-225762721 AGCTGGAGCACCAGGGAAGCTGG - Intergenic
948702317 2:239768127-239768149 ACCCTCAGCCCCAGGCACGCTGG + Intronic
1168760201 20:345492-345514 AGCTTCAGCCCAAGGGTAGTGGG - Intergenic
1172808161 20:37628067-37628089 TTCCTGAGCCCCAGGAAAGCTGG + Intergenic
1174419042 20:50387509-50387531 AGCTTCAGACCCAGGAAAGCAGG + Intergenic
1175248419 20:57595084-57595106 AGCTTCAGACACAGGGAGGCGGG - Intergenic
1175323177 20:58103710-58103732 AACCTCAGCCCCAGGGCAGAAGG - Intergenic
1175634925 20:60573483-60573505 ATTTTCATCTCCATGGAAGCAGG - Intergenic
1175749532 20:61485623-61485645 TTCTGCAGCCTCAGTGAAGCTGG + Intronic
1178110954 21:29369843-29369865 AGCTGCAGACCCAGGAAAGCTGG - Intronic
1178751257 21:35305641-35305663 AGCTTTAGCCACAGGGACGCTGG + Intronic
1178876784 21:36420140-36420162 ACCTTCAGGCCTAAGGAAGCAGG - Intergenic
1181054700 22:20255388-20255410 ACATACAGCCCCAGGGCAGCTGG + Intronic
1181407029 22:22692360-22692382 GGCTCCAGCCCCAGGTAAGCAGG + Intergenic
1181415014 22:22753125-22753147 GGCTTCAGCCCCAGGCAAACAGG + Intronic
1181423320 22:22817082-22817104 GGCTTCAGCCCTAGGTAAGCAGG + Intronic
1182555136 22:31125142-31125164 ATCACCAGCCCCAGGGACGTCGG - Exonic
1183410145 22:37650235-37650257 AGCTTCACCTCCAGGGAAGAGGG - Exonic
1183526836 22:38328065-38328087 ATCGTCAGCTCCTGGCAAGCTGG - Intronic
1183592587 22:38788894-38788916 TTCCTCAGCCCCAGGGAATCTGG - Intronic
1183989065 22:41585983-41586005 TTCTTCTGCCCCACAGAAGCAGG + Intronic
1185347967 22:50318814-50318836 ATGTCCAGCCCCAGGAAAGGTGG + Intronic
949963691 3:9336691-9336713 ATCTTCTGCCCCAGCTAAGATGG - Intronic
950653436 3:14422161-14422183 GTCTGCAGCCCCAGGGATCCTGG - Intronic
951040577 3:17984592-17984614 AAACTGAGCCCCAGGGAAGCAGG - Intronic
951157090 3:19368771-19368793 ATGATCAGCCCAAGGGAATCAGG - Intronic
952060549 3:29503753-29503775 ATCTTCAGCTTCAAAGAAGCAGG - Intronic
952336871 3:32411134-32411156 ATTTTCAGCGACAGGGAAGCCGG - Intronic
952846439 3:37691441-37691463 AGCTTCACCCACAGGGCAGCAGG + Intronic
953259074 3:41320466-41320488 TTCCTCAGCCCCATGGAAACTGG - Intronic
953717047 3:45324553-45324575 ATCCTGAGCCCCAGGGAGGTTGG - Intergenic
953983704 3:47425914-47425936 ACCTCCAGAGCCAGGGAAGCAGG + Intronic
954173951 3:48828311-48828333 TGCTTCAGCCTCAGGGTAGCTGG + Intronic
954461054 3:50627279-50627301 ATCGGCAGTGCCAGGGAAGCAGG + Intronic
955858718 3:63303445-63303467 ATTTTCAAAACCAGGGAAGCAGG - Intronic
956846670 3:73189880-73189902 ATCTTCAGGCAAAGGGAAGGTGG + Intergenic
960596859 3:119414886-119414908 CTCTTCAGCCCCAGGCACCCAGG + Exonic
961049658 3:123735526-123735548 ACGTTCAGCACCAGGGAAGCTGG - Intronic
962282371 3:134061557-134061579 ATCTCCAGGACCAGGGAGGCAGG + Intergenic
963017857 3:140842640-140842662 AGCTGAAGCACCAGGGAAGCTGG - Intergenic
964662983 3:159141274-159141296 ATCTTGAGGTCCAGGGAGGCTGG + Intronic
965842522 3:172923109-172923131 ATCATCAGGCCCATGCAAGCAGG - Intronic
966943043 3:184758965-184758987 ATCTTTAGGCCTTGGGAAGCTGG + Intergenic
966943199 3:184759864-184759886 ATCAACAGCTCCTGGGAAGCAGG - Intergenic
967460930 3:189744719-189744741 TTCTTGAGCCCCTGGGCAGCTGG - Intronic
969490740 4:7497999-7498021 ATCTCCAAGCCCAGGGAAACAGG - Intronic
970486133 4:16526444-16526466 ATCTTCAGCCCCAGGGAAGCTGG - Intronic
971249633 4:24963129-24963151 ATCTTCCACCTCAGAGAAGCAGG + Intronic
973920185 4:55676101-55676123 ATCCCCATCCCTAGGGAAGCGGG + Intergenic
976398095 4:84579557-84579579 TTCTTCCGCCCCTGGCAAGCTGG + Intergenic
979761533 4:124411403-124411425 ATCTTTAGTCCCTGGGATGCTGG - Intergenic
979800419 4:124901602-124901624 ATCTTCAGAACCTAGGAAGCAGG + Intergenic
980887206 4:138776080-138776102 ATCTCCAGATTCAGGGAAGCCGG + Intergenic
981626499 4:146762240-146762262 ATATTCAGGCCCTGGGAATCAGG - Intronic
981737841 4:147971490-147971512 ATGTTCAGCTGCAGGGAATCTGG + Intronic
983216521 4:165007537-165007559 ATCATCTGCTCCAGGTAAGCCGG + Intergenic
984620209 4:181944200-181944222 AGCTGGAGCCCCAGGAAAGCTGG + Intergenic
985576585 5:676009-676031 AGCCTCAGTCCCAGAGAAGCTGG - Intronic
985643860 5:1075986-1076008 GTCTTCAGGCCCAGAGCAGCTGG + Intronic
985719430 5:1481482-1481504 ATCTTCAGCCTCAGTGCCGCCGG + Intronic
985952954 5:3237303-3237325 AAGTGCAGCCCCATGGAAGCAGG + Intergenic
986826994 5:11532566-11532588 ATTTTCAGCCCCTGGCAAGGTGG - Intronic
987397589 5:17439395-17439417 AGCTTCAGCCCCTGAGTAGCTGG - Intergenic
988687453 5:33538820-33538842 AAATTCAGTGCCAGGGAAGCAGG - Intronic
991262336 5:64680536-64680558 ACCTGGAGGCCCAGGGAAGCGGG + Intergenic
991977721 5:72199399-72199421 ACCTTCAGACTCAGGGAAACTGG - Exonic
992467193 5:77018310-77018332 CACTTCATCCCCAGTGAAGCTGG - Intergenic
993593963 5:89829410-89829432 ATCAACAGACCCATGGAAGCTGG + Intergenic
993635047 5:90332810-90332832 AGCTGAAGACCCAGGGAAGCTGG - Intergenic
998752698 5:145340384-145340406 TTCTTCAGCCACTGGGCAGCTGG - Intergenic
999736075 5:154514330-154514352 CTCTTCAGCCAGAGGGACGCAGG + Intergenic
1001225585 5:169941834-169941856 ATTGGCAGCCCCAGGGAAGTGGG - Intronic
1002088879 5:176793000-176793022 AGCTTCAAACCCAGGGCAGCTGG + Intergenic
1002543211 5:179919966-179919988 CTGTTCTGCACCAGGGAAGCTGG - Intronic
1002881321 6:1255002-1255024 AGCTGCAGCTCCAGGAAAGCAGG - Intergenic
1002957004 6:1875908-1875930 TTCTTCTGCCCCAGAGTAGCTGG - Intronic
1004751758 6:18568970-18568992 CTCCTCAGCCCCAGAGTAGCTGG - Intergenic
1006012520 6:31054560-31054582 ATCACCTGCCACAGGGAAGCAGG + Intergenic
1006799962 6:36753457-36753479 CTCTTCAGCCCCAGGGACCTAGG + Intronic
1007109243 6:39303596-39303618 ATCTCCAGCCCCAGAGAAGTGGG + Intronic
1007708090 6:43803661-43803683 AGCCACAGCCCCAGGAAAGCAGG - Intergenic
1009468496 6:64002678-64002700 ATCTTCATTCCCACTGAAGCAGG - Intronic
1010031939 6:71280325-71280347 ATCTCCAGCTCCAGTGAAGAAGG + Intergenic
1011755111 6:90490740-90490762 ATCATCAGCCTCAGGTAATCTGG - Intergenic
1012274475 6:97256127-97256149 ATATTCAACCCCAGAGAAGGAGG - Intronic
1013547173 6:111169589-111169611 TTCCCCAGCCCCAGGGAACCTGG - Intronic
1014209802 6:118696399-118696421 ACATTCAGCCACAGGGAGGCAGG - Intronic
1016910723 6:149196066-149196088 GTCTTCATCCCCAGGGAAACTGG - Intergenic
1019324256 7:430232-430254 ACCCTCAGCCCCAGGCAAGAGGG - Intergenic
1019375174 7:686998-687020 AGATTCAGTCCCAGGGAGGCTGG - Intronic
1019956456 7:4418510-4418532 ATCTGGAGCCCCTGGGATGCTGG - Intergenic
1021200804 7:17726884-17726906 GAGTGCAGCCCCAGGGAAGCAGG - Intergenic
1021355399 7:19648989-19649011 ATCTCCAGCCCCAGGGCAAATGG + Intergenic
1021681355 7:23136594-23136616 ATCATCAGCCACAGAAAAGCTGG + Intronic
1021900392 7:25279451-25279473 AGCCTCAGAACCAGGGAAGCTGG - Intergenic
1022546189 7:31191398-31191420 AGCTTGAGAACCAGGGAAGCTGG - Intergenic
1023856864 7:44189381-44189403 CGCCTGAGCCCCAGGGAAGCAGG - Intronic
1025236900 7:57240608-57240630 GTCATCATCCCCAGGGGAGCAGG + Intergenic
1025839587 7:65133214-65133236 ATCTGCAGCCCCAAGGGAGAAGG - Intergenic
1025883480 7:65562751-65562773 ATCTGCAGCCCCAAGGGAGAAGG + Intergenic
1025889965 7:65639855-65639877 ATCTGCAGCCCCAAGGGAGAAGG - Intergenic
1027256890 7:76436658-76436680 ATCCCCAGCCCCACTGAAGCAGG - Intronic
1027281957 7:76615369-76615391 ATCCCCAGCCCCATTGAAGCAGG + Intronic
1029212080 7:98917410-98917432 ATGTTCAGCCCTAGGGAAGGGGG - Exonic
1030608545 7:111664580-111664602 ATCTGGAGAACCAGGGAAGCTGG + Intergenic
1030983131 7:116210273-116210295 ATCTTCAGCTAGAGGGAGGCTGG + Intergenic
1031494957 7:122434606-122434628 CTCTTCAGCCCCATGCAGGCAGG - Intronic
1031852511 7:126882130-126882152 ATCTGCAGCCCCAAGGGAGAAGG + Intronic
1031963135 7:128007493-128007515 ATCTGGAGCCCCAGTGGAGCAGG - Intronic
1032856366 7:135836950-135836972 ATCTGGAGACCCAGGAAAGCTGG + Intergenic
1033360789 7:140637708-140637730 ATCCTGACCCCCGGGGAAGCAGG - Intronic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1034324660 7:150219978-150220000 ATCTCCAGCCCCAGGGTGGCCGG + Intergenic
1034327288 7:150248137-150248159 AGCTCCTGTCCCAGGGAAGCAGG + Intronic
1034765921 7:153721320-153721342 AGCTCCTGTCCCAGGGAAGCAGG - Intergenic
1034768532 7:153749253-153749275 ATCTCCAGCCCCAGGGTGGCCGG - Intergenic
1035850415 8:2914433-2914455 ATCTTCAGCCCCCAGGCAGAAGG + Intergenic
1036501587 8:9319387-9319409 CTCTTCAGCTCCAGGGCAGCAGG + Intergenic
1036545766 8:9768215-9768237 CAGTGCAGCCCCAGGGAAGCAGG + Intronic
1036812516 8:11877284-11877306 ATCTTCAGTCTCAGGTCAGCTGG + Intergenic
1037952453 8:23028053-23028075 ATCTTCAGGCCCAGCCAGGCAGG - Intronic
1037963632 8:23117333-23117355 ATCTTCAGGCCCAGCCAGGCAGG + Exonic
1037967420 8:23145389-23145411 ATCTTCAGGCCCAGCCAGGCAGG - Intronic
1039116128 8:34093124-34093146 CTCTTCAACCCCAGGTAAGCAGG - Intergenic
1040459752 8:47635826-47635848 ATTTTCACCCACTGGGAAGCAGG - Intronic
1041124654 8:54622884-54622906 CTCTTCAGGCCCAGGGATGTGGG + Intronic
1044249920 8:89993801-89993823 AGCTTCTGCCCCAGGAAAACAGG - Intronic
1045173826 8:99698432-99698454 ATCTTCAGCCCCGAGGAGGCTGG - Intronic
1045341430 8:101257986-101258008 AGCTGCAGCTCCAGGAAAGCTGG - Intergenic
1046735528 8:117772575-117772597 ATCATCATCCCCATGAAAGCTGG - Intergenic
1047896692 8:129374213-129374235 CTCCTCAGCCCCAGGAAAACTGG - Intergenic
1048303461 8:133267563-133267585 ATCTCCGGCCCCCTGGAAGCTGG - Intronic
1048449604 8:134522159-134522181 CTCTTGAGCCCCAGGTAAGGAGG + Intronic
1048999415 8:139815238-139815260 ACCTTCTGCCACAGGGAAGGCGG - Intronic
1049509240 8:143019241-143019263 ATCCCCAGGCTCAGGGAAGCTGG - Intronic
1056756269 9:89383880-89383902 ATCCTCAGGCCCAGGGAAGGCGG - Intronic
1057208861 9:93188762-93188784 ATCAGCACCCCCAGGGTAGCTGG - Intronic
1058268609 9:102940089-102940111 ATCATAAGCCCCAGGAAGGCAGG - Intergenic
1058340191 9:103886043-103886065 AGCTTCATAACCAGGGAAGCTGG - Intergenic
1058832973 9:108835899-108835921 ATATTCAGCTCAAGGGAAGAAGG + Intergenic
1059366863 9:113793158-113793180 TTCTTCATCCCCAGGGCTGCCGG - Intergenic
1061562565 9:131415420-131415442 AGCCCCAGCCCCAGGGGAGCGGG - Intronic
1062021523 9:134321722-134321744 ACCTTCAGAGCCAGGGAGGCTGG + Intronic
1062530403 9:136997078-136997100 ATCTGCAGCACCAGGGCATCGGG + Intergenic
1185840729 X:3388578-3388600 GTCTTCTGACCCAGGGAAGAAGG - Intergenic
1190819741 X:53962176-53962198 CCATTCAGCCCCAGGGAATCTGG + Intronic
1192633227 X:72792696-72792718 ATAGTCAGCCCCAGGAGAGCTGG - Intronic
1192648482 X:72928105-72928127 ATAGTCAGCCCCAGGAGAGCTGG + Intronic
1193067481 X:77275216-77275238 ATCCTGAGCCTCAGGGCAGCAGG - Intergenic
1193673616 X:84419568-84419590 ATCTTGAGACCCAGGAAACCTGG + Intronic
1195786377 X:108527977-108527999 TTCTTCAGTCCCTGGGCAGCTGG - Intronic
1197606220 X:128588373-128588395 CACTTCAGCCCCAGGGACGAAGG + Intergenic
1199101517 X:143806453-143806475 ATCTCCAGCTCCAGAAAAGCTGG - Intergenic
1200287202 X:154834715-154834737 ATCCTGAGTCCCAGGCAAGCTGG - Intergenic
1201235251 Y:11903528-11903550 ATCTTCTGACCCAGGGAAGAAGG + Intergenic
1201897799 Y:19011971-19011993 TTCCTTACCCCCAGGGAAGCAGG + Intergenic