ID: 970486703

View in Genome Browser
Species Human (GRCh38)
Location 4:16531912-16531934
Sequence CAGTTCAAACAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970486696_970486703 7 Left 970486696 4:16531882-16531904 CCCACCCATAGTTTTTCCATGGA 0: 1
1: 0
2: 0
3: 10
4: 123
Right 970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG 0: 1
1: 0
2: 1
3: 28
4: 257
970486697_970486703 6 Left 970486697 4:16531883-16531905 CCACCCATAGTTTTTCCATGGAT 0: 1
1: 0
2: 0
3: 8
4: 156
Right 970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG 0: 1
1: 0
2: 1
3: 28
4: 257
970486699_970486703 2 Left 970486699 4:16531887-16531909 CCATAGTTTTTCCATGGATGCTT 0: 1
1: 0
2: 2
3: 15
4: 205
Right 970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG 0: 1
1: 0
2: 1
3: 28
4: 257
970486698_970486703 3 Left 970486698 4:16531886-16531908 CCCATAGTTTTTCCATGGATGCT 0: 1
1: 0
2: 0
3: 15
4: 188
Right 970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG 0: 1
1: 0
2: 1
3: 28
4: 257
970486700_970486703 -9 Left 970486700 4:16531898-16531920 CCATGGATGCTTTGCAGTTCAAA 0: 1
1: 0
2: 1
3: 10
4: 159
Right 970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG 0: 1
1: 0
2: 1
3: 28
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970486703 Original CRISPR CAGTTCAAACAGATGGAGGA AGG Intronic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
902747157 1:18481798-18481820 CATTTCATACAGAAGGCGGAGGG + Exonic
905010444 1:34743320-34743342 CACTTCAAACTGGTGGTGGAAGG - Intronic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
909688994 1:78384490-78384512 CAGTGCAAACTCATGGAGGAAGG + Intronic
909942964 1:81632399-81632421 AATTTCAAACAGAGGGAAGAAGG + Intronic
910416752 1:87009234-87009256 CAGTTTAAAGGGATGGAGAAAGG - Intronic
912203649 1:107486225-107486247 CTATTCAGACAGATGTAGGAGGG - Intergenic
913030719 1:114900187-114900209 AAGTTCAAACAAGTGGTGGAAGG - Intronic
914200529 1:145480710-145480732 CATCTCAAAGGGATGGAGGAAGG - Intergenic
914479643 1:148053837-148053859 CATCTCAAAGGGATGGAGGAAGG - Intergenic
915469974 1:156120012-156120034 CATGTGAAACTGATGGAGGAAGG + Intronic
916121101 1:161528876-161528898 AAGTTCAAACAGGTTGAGGGGGG - Intergenic
916130871 1:161610517-161610539 AAGTTCAAACAGGTTGAGGGGGG - Intronic
916189404 1:162164551-162164573 AAATTCATAGAGATGGAGGATGG - Intronic
917517783 1:175722222-175722244 CAATTCAAACCGATAGGGGAAGG - Intronic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
918227450 1:182497164-182497186 CAGTTCACATTGATGTAGGATGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919860226 1:201735033-201735055 CAAATCAGACAGCTGGAGGAAGG - Intronic
919972894 1:202592150-202592172 GAATTCAAACAGTGGGAGGAAGG + Exonic
920369227 1:205467282-205467304 AAGGTCAAACAGATGTGGGAGGG + Intergenic
921031375 1:211337811-211337833 CATTTCACTGAGATGGAGGAAGG + Intronic
921793813 1:219319745-219319767 AAGTTCAAACACATGTAGAAGGG - Intergenic
922955452 1:229595508-229595530 CAGCTAAAACTGATGGATGAAGG - Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923676400 1:236084257-236084279 CAATGCAAACAGATAAAGGAAGG + Intergenic
1063909100 10:10811579-10811601 CATCTCAAAGGGATGGAGGAAGG + Intergenic
1064581930 10:16802757-16802779 CACTTCAAACAGGTGAAAGAAGG + Intronic
1064693219 10:17939266-17939288 CAGTTCAGAGAAATGGAGAACGG + Intergenic
1065142094 10:22727887-22727909 CACTGCACCCAGATGGAGGAAGG + Intergenic
1067669012 10:48302928-48302950 CAGTTCTTGCAGCTGGAGGATGG + Intergenic
1067996087 10:51274872-51274894 GAGTACAAACACATGGAGGATGG + Intronic
1068001342 10:51337813-51337835 TAGTTCAACCATTTGGAGGAGGG + Intronic
1070344634 10:75529971-75529993 CAGCTCAGAGAGATGGTGGAAGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1073942919 10:108718562-108718584 CAGTTGGAGCAGGTGGAGGAGGG + Intergenic
1075172034 10:120124651-120124673 CAGTTCAAACTTAAGGAGAAGGG + Intergenic
1078135555 11:8649040-8649062 CATTTAAAACAGATGGTGGCTGG + Intronic
1080596760 11:33780026-33780048 CAGTTCTAGCAGCTGGAGGGAGG - Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1081911929 11:46705295-46705317 CAGTTCAGGCAGCTGGGGGAAGG - Exonic
1083601523 11:63951639-63951661 CTGATCAAACAGATTGAGGCAGG - Intronic
1085311832 11:75521368-75521390 CAATTCAAACAGATGCAGCTTGG + Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1088099956 11:106144105-106144127 CAGTTATAAAAGATTGAGGAGGG - Intergenic
1088179017 11:107088181-107088203 GAGTTCAAAGAGATGGGGAAAGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089280995 11:117374423-117374445 TCCTCCAAACAGATGGAGGATGG - Intronic
1092336283 12:7636908-7636930 TATTTCAAGCAGATGGAAGAAGG - Intergenic
1092563434 12:9640357-9640379 AAGTTCAAACAACTGGTGGAAGG - Intergenic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1094268872 12:28589222-28589244 CCTTTCTAACAGATGGAGAAGGG + Intergenic
1095554580 12:43485007-43485029 CTGTTCCAAAAGATGGAGGAGGG + Intronic
1097852385 12:64425593-64425615 CATTTAAAAGAAATGGAGGAGGG - Intronic
1098051737 12:66461505-66461527 CAATGCAAACAGCTGTAGGAAGG - Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099389166 12:82057714-82057736 GAGTTAAAAATGATGGAGGAGGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100182713 12:92102864-92102886 CAGTTCAAACTGGGGGAAGAGGG + Intronic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1100779506 12:98009120-98009142 CAGTTCACCCAGATGCAGCATGG + Intergenic
1102186823 12:110955313-110955335 CATTTCAAACAAATGAAGGAAGG + Intergenic
1103821883 12:123705459-123705481 CACTTAAAACCGATGGAGGCAGG - Intronic
1104038737 12:125115811-125115833 GACTGCACACAGATGGAGGACGG + Intronic
1104154725 12:126120451-126120473 ATTTTCAACCAGATGGAGGAAGG - Intergenic
1104193351 12:126505362-126505384 TAGATTAAATAGATGGAGGATGG + Intergenic
1105210117 13:18252648-18252670 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1107773040 13:43809100-43809122 AATTTCAAATGGATGGAGGAGGG - Intergenic
1107816661 13:44250575-44250597 CAGTTCAATGAGATGGTGGCTGG + Intergenic
1108250046 13:48556192-48556214 CAGTTCAAACAACTGGATGCTGG - Intergenic
1108982984 13:56543692-56543714 CTGTTCAAAAACATTGAGGAGGG + Intergenic
1109002502 13:56824164-56824186 CAGGTATAAAAGATGGAGGAAGG - Intergenic
1110671711 13:78188275-78188297 CAGTTCATATAGTTGGAGAATGG - Intergenic
1111559891 13:89931315-89931337 CATCTCAAACAGCTGGGGGAAGG + Intergenic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1112553063 13:100440676-100440698 GACTTCAAACAGATGGGGGTGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118510328 14:66464915-66464937 TAATTTAAATAGATGGAGGAAGG - Intergenic
1118574936 14:67232850-67232872 CACTTCAAGCAAATGCAGGAAGG - Intergenic
1118610309 14:67534135-67534157 CAGTCCAAACAGTTTGATGAAGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1120650576 14:87127784-87127806 TAGCACAAAGAGATGGAGGAAGG + Intergenic
1121303461 14:92890124-92890146 CAGTTCACTGAGATGGAGGGAGG - Intergenic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1127688155 15:61368663-61368685 CAGTTCACACAGATGTGGGGAGG - Intergenic
1129640522 15:77372466-77372488 AGATTCAAACAGATTGAGGATGG - Intronic
1130150720 15:81309499-81309521 CAGCTCTAACTGATGGAGTATGG - Exonic
1130509036 15:84573130-84573152 AAGTTCACACAGCTGGAGGGTGG - Intergenic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131671128 15:94620532-94620554 GAGGCCAAACAGATGGAGGCAGG - Intergenic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1141295571 16:82765424-82765446 CAGTTAAAATAGAAGGAGTAGGG - Intronic
1143520414 17:7441185-7441207 CAGCTCAACCAGAAGGGGGAAGG - Intronic
1145931656 17:28690299-28690321 CAGTTCCAACAGATTGAGGCAGG + Intronic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1148337068 17:46849112-46849134 CAGTTCTAACATCAGGAGGAGGG + Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1151385113 17:73750437-73750459 CAGCACAAACAGAGGGAGGTGGG + Intergenic
1152626272 17:81389224-81389246 CAGATCAGACAGATGGGGGTTGG - Intergenic
1152797802 17:82316559-82316581 CAGTTCAGGCACATGTAGGAGGG + Intronic
1155091448 18:22515307-22515329 GAGTCCAAACTGATGGAGGGAGG - Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156783322 18:40878703-40878725 AAATGCAAACAGATGTAGGAGGG - Intergenic
1157239856 18:45998762-45998784 CAGTTCCTACGGATGGGGGAGGG - Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1157890697 18:51414248-51414270 CAGTTCAATCAGATTGTGGCAGG + Intergenic
1157921567 18:51718461-51718483 CAGTTCCAACAGATTGAGACAGG + Intergenic
1158802083 18:60923897-60923919 CAGTTCTGCCAGATGGAGTAGGG + Intergenic
1163743578 19:19032043-19032065 CAGTTCTATCTGCTGGAGGAAGG + Intronic
1163894936 19:20050619-20050641 CGGTTCAAAATCATGGAGGAAGG + Intergenic
1164211686 19:23103246-23103268 AAGTTCAAACAAATGGTGGAAGG + Intronic
1164679115 19:30122157-30122179 CACTTCACACAGATGGAGGGAGG + Intergenic
1165743444 19:38217066-38217088 CAGTTCTGACAGCTGAAGGATGG - Intronic
1166062478 19:40335232-40335254 CATTTCAAAGAGATCCAGGAAGG + Intronic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG + Exonic
925662298 2:6215183-6215205 CAGTTCAAACAGGTAGAGAGTGG + Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
928139738 2:28718152-28718174 TAGATCCACCAGATGGAGGAAGG + Intergenic
930296300 2:49558672-49558694 CAGTTCAAACTGAAGGAAAAAGG - Intergenic
930587204 2:53281417-53281439 AAGTTCAAACAGATGTTGGCAGG + Intergenic
930885977 2:56327373-56327395 CAGTTCAAACAGCTCTAGGTTGG - Intronic
931692558 2:64847725-64847747 TAGTGCAATCAGAGGGAGGAGGG + Intergenic
932062601 2:68522736-68522758 CAGTTCAAACTGATGGAGAAAGG + Intronic
932556348 2:72828207-72828229 AATTCCAAACAGATGTAGGAGGG + Intergenic
932786288 2:74607168-74607190 GTGGTCAAACAGTTGGAGGAAGG - Exonic
932794743 2:74684599-74684621 AAGTTCAAGCAGATGGAGAAGGG + Intergenic
933236645 2:79871556-79871578 CAGAACAAAAAGGTGGAGGAAGG - Intronic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934965747 2:98720344-98720366 TAGATCAAAAAGGTGGAGGAAGG + Intronic
936713199 2:115156923-115156945 CAGCTCAAAGAGATGATGGAAGG + Intronic
937937040 2:127254452-127254474 CAGAACAAAAGGATGGAGGAAGG - Intergenic
940798589 2:158107391-158107413 AAGTTCAGAGAGGTGGAGGAAGG + Intronic
941440116 2:165524207-165524229 CAATTCAAATAGCAGGAGGAGGG + Intronic
941853808 2:170210282-170210304 CAGTTTAAACAAATGATGGAAGG - Intronic
945424784 2:209687560-209687582 AAGATCAAGCTGATGGAGGATGG - Intronic
1168910071 20:1440504-1440526 CAGGTCAAAGGGATGGAGGGTGG + Intergenic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1172122862 20:32608897-32608919 CAGTTCAGACACATGGAGTGAGG + Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173232527 20:41211444-41211466 CAGTTCAAATTGGTGGGGGAAGG - Intronic
1173314093 20:41927963-41927985 CAGTGCAAACATGTGGAGGCAGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174166444 20:48586910-48586932 CAGTACAAGCAGCTGGAAGACGG - Intergenic
1175010954 20:55735519-55735541 CAGGTCTTAAAGATGGAGGAAGG - Intergenic
1175543761 20:59764580-59764602 TAGGTCAAACGTATGGAGGAAGG + Intronic
1175595037 20:60224210-60224232 CTGTTCAAAGGGATGGAGGCTGG - Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1179063469 21:38002279-38002301 AAGTTCAAATCAATGGAGGAAGG - Intronic
1179219925 21:39397173-39397195 CATTTCGTACAGATCGAGGACGG - Exonic
1180178414 21:46103827-46103849 CACTTCAACCAGACGGAGAAGGG - Intronic
1180577787 22:16796304-16796326 TAATTCAAACAAATGGTGGAGGG + Intronic
1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG + Intergenic
1180780173 22:18515622-18515644 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1180812889 22:18772943-18772965 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1181023472 22:20115153-20115175 CATTTCAGCCAGATGAAGGAAGG - Intronic
1181199067 22:21207259-21207281 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1182925405 22:34118595-34118617 CAATTAAAAAGGATGGAGGAAGG - Intergenic
1183240488 22:36654199-36654221 TAGTACAAACAGATTGAAGAGGG - Intronic
1184810570 22:46828734-46828756 CAGTCCAAACAGAGACAGGAGGG - Intronic
1203227758 22_KI270731v1_random:87647-87669 CAGTTCCAACACCTGGAGCAGGG + Intergenic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951948884 3:28175734-28175756 CAGTTCAAATGGATGGAGGCTGG - Intergenic
955322441 3:57983957-57983979 CAATTCAGGCTGATGGAGGATGG - Intergenic
955536349 3:59927901-59927923 GTGTTCAAAGAGATGGTGGAAGG - Intronic
956129348 3:66039187-66039209 CATTTCAAACAGGTGGGGGTTGG + Intergenic
957414803 3:79887708-79887730 GAGAACAAACAGATGTAGGAAGG - Intergenic
959625687 3:108446754-108446776 CAGTCCATAAACATGGAGGAGGG + Intronic
964028121 3:152102980-152103002 CAATTCTGACAGTTGGAGGAAGG - Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
965711474 3:171560059-171560081 CAGTTCAACCAGATGCAGCAAGG + Intergenic
968196335 3:196710540-196710562 CATCTCAAAAAGATGGAGGCAGG + Intronic
968513398 4:1005032-1005054 CAGTTTACAGAGATGGAGGCAGG + Intergenic
969261352 4:6036118-6036140 CAGATCACACAGACAGAGGAAGG + Intronic
969462554 4:7336413-7336435 CAATGCGAACAGATGGATGAAGG + Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971866597 4:32180106-32180128 CAATTCAAACAGAGGGAGGCAGG + Intergenic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
979150806 4:117311701-117311723 TAGTTCAAACAGTTGCAGCAAGG + Intergenic
979887305 4:126045316-126045338 TAGAGCAAAAAGATGGAGGAAGG + Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
982312383 4:153999670-153999692 AAATACAAACAGGTGGAGGAAGG - Intergenic
983376883 4:166941123-166941145 CAGTTAAAACAGATTCAGGAGGG + Intronic
985549443 5:525529-525551 CCGTCCAAACAGAGGGAGCAGGG - Intergenic
988238108 5:28573334-28573356 CAGTTCAAAGTGGAGGAGGATGG - Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989306692 5:39966038-39966060 CTGTTTAAAAAGATGCAGGAAGG - Intergenic
993276496 5:85866327-85866349 CAGTTCATACAGATTGAGATAGG + Intergenic
993814297 5:92522259-92522281 TAGTTCAAACATATGAAGAATGG - Intergenic
994411651 5:99414138-99414160 CAGTACACTCACATGGAGGAAGG + Intergenic
994482174 5:100351112-100351134 CAGTACACTCACATGGAGGAAGG - Intergenic
995547436 5:113247128-113247150 TAGTTTACACATATGGAGGAAGG + Intronic
998908440 5:146932057-146932079 CAGTTCAAACATACTAAGGAAGG - Intronic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000486441 5:161849985-161850007 CATCTCAAACAGATGGAAGCTGG - Intronic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003528995 6:6921957-6921979 CAGTTCTAACAAATGGAAGGTGG + Intergenic
1003858872 6:10303688-10303710 GAGGTCACACAGATGGAGGTGGG - Intergenic
1003938224 6:10997477-10997499 CATTTCAAACCAATGGAAGATGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007143072 6:39596147-39596169 CAGGTCAACCAGATGGAGTTTGG + Exonic
1007185983 6:39972615-39972637 CAGATCACACTGATGCAGGAGGG - Intergenic
1008623472 6:53294436-53294458 CACTTCACACAGTTGTAGGATGG - Intronic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1012583470 6:100895626-100895648 AAGTTCAAACAAGTGGTGGAAGG + Intergenic
1013716961 6:112973615-112973637 CATTTCAATCAGATGCTGGAAGG - Intergenic
1014633629 6:123817624-123817646 TAGGTCAAAGGGATGGAGGAAGG - Intronic
1015255832 6:131178729-131178751 CAGGTCAAACAGAAGGAGATAGG - Intronic
1017614679 6:156232284-156232306 CAGTTAAAACAGAAAGAGGCTGG - Intergenic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019117273 6:169775097-169775119 CAGTACATTCAGATGGGGGAAGG - Intronic
1020085814 7:5309534-5309556 CATGTCAAAGAGATGGAAGAGGG - Intronic
1021244486 7:18245045-18245067 CAGTTCTAGAAAATGGAGGAGGG + Intronic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1024437713 7:49378555-49378577 AAGTTCAAACAAGTGGTGGAAGG + Intergenic
1024599998 7:50972045-50972067 CAGTTTAAACACATGGACGTTGG - Intergenic
1026241571 7:68579957-68579979 AAGTTCATCCACATGGAGGAGGG + Intergenic
1027185343 7:75967750-75967772 CGGTCCATACAGAGGGAGGAGGG + Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1031082975 7:117276240-117276262 CAGTTCATCCAGCAGGAGGAAGG + Intergenic
1031431918 7:121682324-121682346 CAGTGCAAACTGATTGAGGAAGG + Intergenic
1032782884 7:135178248-135178270 CAGTTCAAACAGTAGGATCATGG + Intergenic
1033576652 7:142691714-142691736 CAGTTCCATCAGATGGAGGCTGG + Intergenic
1033865868 7:145689549-145689571 AAGTTCAAACAAGTGGTGGAAGG + Intergenic
1034691023 7:153013739-153013761 CAGTTCAAACACGGGAAGGAAGG + Intergenic
1035936651 8:3848684-3848706 CAGATCACACAGATGGTGCAAGG - Intronic
1036526203 8:9537162-9537184 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1040374312 8:46808876-46808898 CAGTTCAAACAAGTTGTGGAAGG - Intergenic
1042418786 8:68560234-68560256 CAGTTCACACACATGCAGTAGGG + Intronic
1043270331 8:78325205-78325227 CAGTTCACACAGCTGGGGGCTGG - Intergenic
1046012790 8:108570874-108570896 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1046035841 8:108840369-108840391 CAGAACAAAAAGGTGGAGGAAGG - Intergenic
1048175827 8:132151429-132151451 AAGTTTAAACAAATGGTGGAAGG + Intronic
1050016111 9:1236200-1236222 CACTTTCAACAGCTGGAGGATGG - Intergenic
1050135511 9:2459469-2459491 CAATTTAAAAAGGTGGAGGAGGG + Intergenic
1051046589 9:12882761-12882783 TAGTTTATACAGATGTAGGAAGG - Intergenic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1052155028 9:25176153-25176175 GAGTTCTAACAAATAGAGGATGG + Intergenic
1052890154 9:33691628-33691650 TAGTTCTATCAGATGGAGGCTGG + Intergenic
1052924885 9:34007053-34007075 CAGTTCTAACAGATGTTTGATGG + Intronic
1053411820 9:37920727-37920749 CAGTGCCACCAGATGAAGGAAGG - Intronic
1053532038 9:38892026-38892048 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054204263 9:62116435-62116457 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054634100 9:67471929-67471951 GAGAACAAAAAGATGGAGGAAGG - Intergenic
1057955091 9:99401051-99401073 AAGTTGAAACAGCTGGGGGAGGG - Intergenic
1058388282 9:104464020-104464042 CAGATCAAAGAGATACAGGAAGG + Intergenic
1058587261 9:106522893-106522915 CTATTCTAAAAGATGGAGGAGGG + Intergenic
1058659139 9:107252969-107252991 ATGTTCAAAAAGATGGAGGTAGG + Intergenic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1061262976 9:129490118-129490140 GAATTCAAACTGGTGGAGGAAGG + Intergenic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1203562058 Un_KI270744v1:65511-65533 CAGGTCAGATAGGTGGAGGAGGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189616751 X:42792122-42792144 AAGTTCAAACAAGTGGTGGAAGG - Intergenic
1189804026 X:44717737-44717759 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1190549196 X:51561583-51561605 AGGTTCAAACAAGTGGAGGAAGG - Intergenic
1191644903 X:63469824-63469846 AAGTTCAAACAAGTGGTGGAAGG - Intergenic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1192864662 X:75117905-75117927 CAGTTCACACAGAGAGAGAAAGG - Intronic
1194561424 X:95427012-95427034 CACTTCAAATACATGGAGCAAGG + Intergenic
1194626871 X:96235568-96235590 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1194810074 X:98378643-98378665 CAGTTCAAACAAGTGGTGGAAGG - Intergenic
1196113579 X:111973210-111973232 CAGTGGAAATAGATGTAGGAGGG - Intronic
1197366001 X:125565639-125565661 AAGTTCAAACAAGTGGTGGAAGG - Intergenic
1198184371 X:134238776-134238798 CAGTTCAAACTGGAGAAGGAGGG + Exonic
1198203194 X:134442310-134442332 CACTTGAAACAGATGTGGGATGG - Intergenic
1199901516 X:152177217-152177239 CAGTTAAAACAGGAGGTGGACGG + Intronic
1200503277 Y:3979362-3979384 CTATTCCAATAGATGGAGGAGGG - Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic