ID: 970486984

View in Genome Browser
Species Human (GRCh38)
Location 4:16534766-16534788
Sequence GATTCAGATGAACTTCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970486980_970486984 18 Left 970486980 4:16534725-16534747 CCAAGAAAGAAGAGGATATCCGA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 970486984 4:16534766-16534788 GATTCAGATGAACTTCTGTAGGG 0: 1
1: 0
2: 2
3: 15
4: 132
970486982_970486984 -1 Left 970486982 4:16534744-16534766 CCGACTCAGAAGTATTAGGACAG 0: 1
1: 0
2: 1
3: 6
4: 113
Right 970486984 4:16534766-16534788 GATTCAGATGAACTTCTGTAGGG 0: 1
1: 0
2: 2
3: 15
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970486984 Original CRISPR GATTCAGATGAACTTCTGTA GGG Intronic
908462841 1:64362843-64362865 GATTCTCATGCACTTCTGAAAGG - Intergenic
908985601 1:70016187-70016209 GTTGCAGATAAACTTCTGGAGGG + Intronic
910978125 1:92929827-92929849 GATGAAGATGAACCTCTGGAAGG - Intronic
912218342 1:107642644-107642666 GATACCGTTGAACTTCTGAAAGG - Exonic
912508532 1:110172926-110172948 GACTGAAATGAACTTCTGGAAGG + Intronic
913989582 1:143598395-143598417 GAGTAAAATGCACTTCTGTAGGG + Intergenic
916100819 1:161391686-161391708 GATTCGGATGAATTACTTTAAGG - Intergenic
916531135 1:165657762-165657784 GGTTCAGATGGAGTTTTGTAAGG + Intronic
921666542 1:217879576-217879598 GATTCAGAGTATCTTCTGTGTGG - Intergenic
924063411 1:240199496-240199518 GAATCAGATAATCTTCTGTTTGG + Intronic
1076279704 10:129235853-129235875 GATTTAAATAAACTTCAGTATGG - Intergenic
1081635633 11:44719847-44719869 GATTCAGATCAACTTCCTTGAGG - Intergenic
1082256478 11:50038627-50038649 GACTTAGAAAAACTTCTGTAGGG + Intergenic
1083386039 11:62311100-62311122 GACTCAGATGAGCTACTGTGTGG - Intergenic
1084132684 11:67148852-67148874 GATTCAGCTGAAATTGTCTATGG + Intronic
1085769508 11:79312149-79312171 GATTCAGATGGAGTCCTGTGGGG - Intronic
1087253130 11:95925420-95925442 GATTCCGATGAAGATCTGTCTGG - Intergenic
1087416332 11:97860852-97860874 GATTCAAATTCACTTCTGTTGGG - Intergenic
1088736835 11:112734621-112734643 GATTCAGCTGACCACCTGTAGGG - Intergenic
1092460776 12:8684153-8684175 AATTTAGATGACCTTCAGTATGG - Intronic
1092701486 12:11236119-11236141 AATTCACATGAACTTCTCTCAGG + Intergenic
1098031080 12:66255172-66255194 GATAGAGATGAACCTGTGTAAGG + Intergenic
1098073225 12:66698706-66698728 GATTCATATTAACCTCTGGAGGG - Intronic
1098125932 12:67292877-67292899 GATTCCTATGAACATCTGTAAGG - Intronic
1098154301 12:67581482-67581504 AATTCAGATGAACTCATGGAAGG - Intergenic
1099621995 12:85014261-85014283 AATTCAGGTGAACTTCTGAACGG + Intergenic
1102888381 12:116538747-116538769 GATGCAGAGGAGCTGCTGTATGG - Intergenic
1103311156 12:120009448-120009470 GATTCAGATTAATTACTGTAGGG + Intronic
1106126607 13:26904901-26904923 GATTCCTATTAACTTCAGTAGGG - Intergenic
1106639796 13:31572178-31572200 GATTCAGAAGAACTGCTTTGGGG + Intergenic
1108680758 13:52778345-52778367 GATCCAGATGAACTCCTTAAGGG - Intergenic
1109584118 13:64375508-64375530 GATTCAGCTAAACTTATTTAAGG - Intergenic
1110681288 13:78315411-78315433 AATTAAGATGCACTTCAGTAGGG + Intergenic
1111003350 13:82215120-82215142 TATTTTGATGAACTTCTTTAAGG + Intergenic
1112286211 13:98106802-98106824 GATTCAGCTGAACTTCAGGTTGG + Intergenic
1113113669 13:106851423-106851445 GAATCAAATGCACTTCCGTAAGG - Intergenic
1115167877 14:30470140-30470162 GATTCATAGGAATTTCTGTTTGG - Intergenic
1116812189 14:49549881-49549903 GATACAGATGGACTGCTGGATGG + Intergenic
1117164220 14:53017802-53017824 GATCCAGAAGATCTTCTGGAGGG - Intergenic
1118674199 14:68165207-68165229 CTTTCAGATGTTCTTCTGTATGG + Intronic
1119353536 14:73986476-73986498 GATAAACATGAAGTTCTGTAGGG - Intronic
1126845607 15:52758025-52758047 GATACAGGTGAAGTTCTGTGAGG + Intronic
1126989797 15:54361431-54361453 GATTCCCCTGAACTTCTTTAAGG + Intronic
1128991766 15:72266752-72266774 GAATCAGAGGAATTTCTCTATGG - Exonic
1135947598 16:26878347-26878369 GCTGCAGATGCAGTTCTGTAGGG + Intergenic
1136686736 16:31999406-31999428 GATTGAGATGAAATACTGTATGG - Intergenic
1136787350 16:32942943-32942965 GATTGAGATGAAATACTGTATGG - Intergenic
1136882426 16:33910839-33910861 GATTGAGATGAAATACTGTATGG + Intergenic
1138941381 16:61794609-61794631 GGCCCAGATGAACTTCTTTAAGG - Intronic
1139543927 16:67639942-67639964 CTTTCAAATGAACTTCTCTAGGG - Intergenic
1140949907 16:79806984-79807006 GGTTCTGCTGAACTTATGTAGGG + Intergenic
1203089583 16_KI270728v1_random:1204615-1204637 GATTGAGATGAAATACTGTATGG - Intergenic
1146734740 17:35228827-35228849 GATTCATATGAACATATGAAGGG + Intergenic
1147147699 17:38495069-38495091 GATTGAGATGAAATACTGTATGG - Intronic
1149203681 17:54217954-54217976 GATTCAGATGACTTTCTGCTTGG - Intergenic
1149411244 17:56409611-56409633 GATGCTGATTAACTTCTGTGAGG - Intronic
1150053371 17:61988108-61988130 GATTCAGATTAAAGTCTGTCTGG - Intronic
1150954358 17:69840384-69840406 GATTCAGATGCAGTTTTGTTAGG - Intergenic
1156137777 18:34064452-34064474 ATTTCAGACGAACTTCTGAATGG - Intronic
1158194511 18:54868937-54868959 GATTCAGATAAGCCTTTGTAAGG - Intronic
1160327164 18:77961387-77961409 CATTAAGATGAACATCTGTATGG - Intergenic
1168383153 19:55941258-55941280 GATCCTGATATACTTCTGTAGGG + Intergenic
927656348 2:24950129-24950151 AATTCAGATGACCTCGTGTAGGG - Intronic
929269341 2:39956491-39956513 GATTCAGATGAAAATCTCAAAGG - Intergenic
929343465 2:40851464-40851486 GATTCAAATGACATTCTCTAAGG + Intergenic
929739202 2:44585342-44585364 AATTCAGCTGAACTTCAGAAAGG + Intronic
935648911 2:105365490-105365512 AACTCAGATGAACTTCCGTTAGG + Intronic
935956803 2:108384948-108384970 CATTTAGATGCACTTCTCTAAGG + Intronic
937471166 2:122175105-122175127 GAGTCAAATGAAGTTCTGTCTGG + Intergenic
938279605 2:130054527-130054549 AATTCACATGAGTTTCTGTAGGG + Intergenic
938330550 2:130445237-130445259 AATTCACATGAGTTTCTGTAGGG + Intergenic
938359395 2:130676266-130676288 AATTCACATGAGTTTCTGTAGGG - Intergenic
938435793 2:131282915-131282937 AATTCACATGAGTTTCTGTAGGG - Intronic
938591455 2:132740598-132740620 CATTAAGATGACCTTCTGGAAGG + Intronic
938661260 2:133489449-133489471 GATTCATGTGAGTTTCTGTATGG + Intronic
938831430 2:135053372-135053394 AATTCAGATGAACAGCTGTCTGG + Intronic
939342680 2:140919368-140919390 AATTGAGCTGAACTTCTGTCTGG - Intronic
942058862 2:172209533-172209555 CATTGAGATGAACTGCTGTATGG + Intergenic
942610822 2:177740922-177740944 GATTCAAATGCACATCTGTTTGG - Intronic
942982806 2:182102640-182102662 GATTCAAATGAAATTCAATATGG + Intronic
945355056 2:208830455-208830477 GAAGCAGATGAATTTCTTTATGG - Intronic
946007290 2:216536176-216536198 GATTCCCATGAACTCCAGTAAGG - Intronic
1170648274 20:18215794-18215816 GATTCAGAAGGACTGGTGTAGGG - Intergenic
1171163792 20:22953051-22953073 GAGCCACATGAACTTCTGTGGGG - Intergenic
1172238778 20:33397522-33397544 GACTCAGATAAAAATCTGTATGG + Intronic
1173267696 20:41500499-41500521 GTTTTGGATTAACTTCTGTATGG - Intronic
1173565637 20:44036364-44036386 GATTCACATGAATGTCTGTGTGG - Intronic
1173872968 20:46353094-46353116 GATTAAAATGAACGTTTGTAGGG - Intronic
1178117202 21:29429478-29429500 GAATCAGATGAATCTCTGCAGGG - Intronic
1178858053 21:36266604-36266626 GGTTCGGATGAGCTTCTGGATGG - Intronic
1180411761 22:12618211-12618233 AATTCAGATGAACTTCTTATTGG + Intergenic
1182083083 22:27543035-27543057 GGTTGTGCTGAACTTCTGTAAGG - Intergenic
1184321751 22:43747235-43747257 GATCCAGAAGAACTTGTGTTTGG - Intronic
953043335 3:39274061-39274083 CATTCAGATGAGGTTCTGTTTGG + Intronic
953668380 3:44942395-44942417 GATTCAGATGAACTAAAGTGAGG - Intronic
963326898 3:143873444-143873466 AACTTAGATGAACTTTTGTAGGG + Intergenic
965023178 3:163261680-163261702 TATTTATATGAATTTCTGTAAGG - Intergenic
970486984 4:16534766-16534788 GATTCAGATGAACTTCTGTAGGG + Intronic
972044811 4:34652513-34652535 AATTCAGAACAACTTCTGTGGGG - Intergenic
972918765 4:43911164-43911186 TACTCAGATTAACTTCTGTATGG + Intergenic
977007014 4:91580368-91580390 GAATCAAATGAGCTACTGTATGG - Intronic
977786413 4:101040051-101040073 GATTCACATGAACAGCTTTATGG + Intronic
977876880 4:102160631-102160653 GAATCAGATGAGCTTCTTTGAGG - Intergenic
978322410 4:107512607-107512629 TATTCAAATGAACTACTGTCTGG + Intergenic
979100790 4:116610873-116610895 GTTTCTAATGAACTTGTGTATGG + Intergenic
980498357 4:133614226-133614248 TGTTCAGATGTAATTCTGTAAGG + Intergenic
983303770 4:165960024-165960046 GATTTTGCTGAACTTCTGTATGG - Intronic
987327658 5:16827131-16827153 GATTCCAATGAAATTCTCTAGGG - Intronic
989790163 5:45389342-45389364 GATTCATATGGAATACTGTAGGG - Intronic
990488939 5:56285204-56285226 CTTTCAGATGAACTTCTCCAAGG - Intergenic
990758527 5:59102678-59102700 GATGCTGATGAACTGCTGGATGG - Intronic
992904823 5:81335686-81335708 GATGGAGATGGACTTCAGTATGG + Intronic
993742162 5:91555085-91555107 TATTCCAATGAACTTCTTTAAGG - Intergenic
1000654760 5:163863156-163863178 GATTCAGAATAATTTCTGAAGGG - Intergenic
1000882400 5:166713383-166713405 GATTCAGAGGATCTTGGGTAGGG + Intergenic
1004628970 6:17403711-17403733 AATTAAGATAAACTTCTGTAGGG + Intronic
1004836671 6:19538971-19538993 GAAGCAGATGAACAACTGTAAGG + Intergenic
1008647767 6:53532606-53532628 CATTCAGATTAACTGCTGGAGGG - Intronic
1009696018 6:67104006-67104028 TATTCATATGCACTGCTGTATGG + Intergenic
1010528014 6:76926833-76926855 GAATCAGATAAACATCTATAGGG - Intergenic
1011819293 6:91231827-91231849 GATTCACATGAGCTTTTTTATGG - Intergenic
1013073127 6:106747092-106747114 AATAAAGATAAACTTCTGTAAGG - Intergenic
1016039987 6:139422783-139422805 GATTCAGATGTTCTTCTGGGTGG + Intergenic
1016491306 6:144606909-144606931 GCTTCAGGTGAACGCCTGTAAGG + Intronic
1018880184 6:167869995-167870017 GAATCAGTGGAACTTCTGTGTGG + Intronic
1020777657 7:12474672-12474694 AATTTTGATGCACTTCTGTAGGG + Intergenic
1028056673 7:86253859-86253881 GATTGAAATGAAATTCTGAAGGG + Intergenic
1029435863 7:100563791-100563813 GGCTCAGGTGAACTTCTGGAAGG - Intronic
1035826913 8:2654346-2654368 GAGTCAGATGAACTTCTCCTGGG - Intergenic
1041247880 8:55906040-55906062 ATATCAGATGAACTACTGTATGG - Intronic
1041868470 8:62605056-62605078 GATTGTGAGGAACTTCTGGAAGG + Intronic
1042016959 8:64323785-64323807 GATTCAGGTGAACTTCAGAAAGG - Intergenic
1043188943 8:77192579-77192601 GATTCTGTTGATCTTTTGTATGG - Intergenic
1046091563 8:109508901-109508923 GAATAAGATGAACTTCTAAAAGG + Intronic
1047049754 8:121097695-121097717 GTTTCACATGAATTTCTCTATGG + Intergenic
1047661313 8:127039997-127040019 GATTCAGATGCACTCTGGTAAGG - Intergenic
1047681342 8:127257549-127257571 GATTCACATGAACTGCAGAAGGG + Intergenic
1050428592 9:5538032-5538054 CATTAAGATAAAATTCTGTAGGG + Intronic
1052785302 9:32822663-32822685 GGTTCACATGAACTTCTTCAGGG + Intergenic
1056692919 9:88823531-88823553 GGTTCAGATGAGCTTGAGTAAGG + Intergenic
1057226362 9:93295340-93295362 GCATCAGATGATCTTCTGGAAGG - Intronic
1060336060 9:122724286-122724308 GATCCAGATGTACTTCTTCATGG + Exonic
1061250347 9:129422812-129422834 GAGGAAGATGGACTTCTGTAAGG - Intergenic
1188530440 X:31134368-31134390 GATATAGATAAACTACTGTATGG - Intronic
1191031575 X:55979461-55979483 GATACAGAGGCACTCCTGTAGGG + Intergenic
1194609995 X:96031485-96031507 GGTTGAGAAGAACTTCTGTATGG - Intergenic
1195176002 X:102316044-102316066 GCCTCAGATGAACTTCTGTAGGG - Intronic
1195182862 X:102371049-102371071 GCCTCAGATGAACTTCTGTAGGG + Intronic
1199469984 X:148183694-148183716 GCTTCATATGAAATACTGTAAGG + Intergenic
1201866013 Y:18655824-18655846 GATTCAGATAAACTTTTTTGTGG + Intergenic