ID: 970487085

View in Genome Browser
Species Human (GRCh38)
Location 4:16535581-16535603
Sequence TACTCAATCCAGACTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970487085 Original CRISPR TACTCAATCCAGACTAGGGT GGG Intronic
905525261 1:38633492-38633514 TTCTCTATCCAGAATAGAGTGGG - Intergenic
910812367 1:91251700-91251722 AACTCCATGCACACTAGGGTTGG + Intergenic
912159754 1:106967382-106967404 TCCTCTATCCAGACTAGAATGGG - Intergenic
914006032 1:143733264-143733286 TTCTCAATCCTGACAAGGGAAGG - Intergenic
914098507 1:144564498-144564520 TTCTCAATCCTGACAAGGGAAGG - Intergenic
914518206 1:148392285-148392307 TTCTCAATCCTGACAAGGGAAGG - Intergenic
916599806 1:166281813-166281835 AACAGAATTCAGACTAGGGTGGG - Intergenic
919563059 1:199147429-199147451 TACTCAGTCCAGATTGGAGTAGG + Intergenic
921423368 1:214974272-214974294 TTCTCTATCTAGACTGGGGTAGG + Intergenic
1075892329 10:125963503-125963525 TTCTTAATCCAGTCTATGGTTGG - Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1078337230 11:10474050-10474072 CACTTAATCCAGACTAGGGGTGG - Intronic
1079487026 11:20945797-20945819 TCCTCAATCCAGACCATGATGGG - Intronic
1080963496 11:37187376-37187398 AATTCAATCCAGACTAGTTTAGG - Intergenic
1090402709 11:126459137-126459159 TCCTCAAACCAGACTTGGGGTGG - Intronic
1095838999 12:46671081-46671103 GACTGAATCCAGTCAAGGGTTGG - Intergenic
1098489949 12:71063964-71063986 TACTCAATCCAAACAAGAGATGG + Intronic
1105444301 13:20439122-20439144 AACACAATTCAGAGTAGGGTTGG - Intronic
1114294816 14:21319603-21319625 TCCTCCATCCAGGCCAGGGTGGG + Intronic
1115485780 14:33910029-33910051 TACTTAAGCCAGACTAGTGCAGG - Intergenic
1122039621 14:98975387-98975409 TACTCAATCCAGGCTGGGCGCGG + Intergenic
1126672164 15:51126368-51126390 TACTCAGTCAAGATTAGGTTTGG - Intergenic
1129525472 15:76211070-76211092 TAATCTAGCCTGACTAGGGTGGG - Intronic
1142306361 16:89288142-89288164 ACCTCATTCCAGACGAGGGTGGG + Intronic
1148847847 17:50539668-50539690 CTGTCAATCAAGACTAGGGTTGG + Intronic
1154143299 18:11844691-11844713 TACTCAATGCAGACTAGCCCTGG + Intronic
1155981505 18:32184975-32184997 TACTCCATCCAGATGTGGGTGGG + Intronic
1156138787 18:34079408-34079430 TACACACTCCAGCCTAGGATGGG - Intronic
937203973 2:120223946-120223968 AACTGGATCCAGACCAGGGTTGG + Intergenic
940739456 2:157490513-157490535 TGTTCAGTCCAAACTAGGGTGGG - Intergenic
941495001 2:166189104-166189126 TTCTTAATCCAGTCTATGGTGGG - Intergenic
945197458 2:207250706-207250728 TACTCAATTTAAACTGGGGTTGG + Intergenic
946140991 2:217690438-217690460 TGCTGAAACCAGACTAGGTTTGG - Intronic
946278433 2:218648344-218648366 CACTCAAGCCTGACTAGGGGTGG + Intronic
946337038 2:219044779-219044801 TTCTCAGCCCAGTCTAGGGTGGG + Intergenic
950877486 3:16289342-16289364 TACTCAATCCACACTTGGCTGGG + Intronic
954384457 3:50236935-50236957 TACAGATTCCAGACTAGGGATGG - Intronic
955713001 3:61799940-61799962 CACTAAAGCCAGACTAGGGTGGG + Intronic
957875762 3:86144201-86144223 TACTCAATCCACACTAATGTAGG - Intergenic
964384266 3:156130655-156130677 TAATCAACCCAAACTAGGGCAGG - Intronic
970487085 4:16535581-16535603 TACTCAATCCAGACTAGGGTGGG + Intronic
971251166 4:24974655-24974677 TACTGAATGCAGACTGGTGTGGG - Intronic
974380684 4:61136098-61136120 TTCTTAATCCAGACTATTGTTGG - Intergenic
975143224 4:70939389-70939411 TACTGCACCCAGACTAGGATTGG - Intronic
982236167 4:153253074-153253096 TACTCAATCCAGACTGTGGGTGG + Intronic
982356735 4:154477898-154477920 TAGTCAATCCCAAATAGGGTGGG + Intronic
983996793 4:174191711-174191733 TACTCAATCAAGATAAGGGCAGG - Intergenic
986171224 5:5316408-5316430 TGCTCAAACGAGGCTAGGGTTGG - Intronic
992575008 5:78098986-78099008 AACCTAATCCAGACTATGGTGGG + Intronic
994598824 5:101875576-101875598 TACTCAATAGAGACTACTGTTGG + Intergenic
997717510 5:136053102-136053124 TACTCATCCCAGACTCAGGTAGG + Exonic
998363230 5:141609682-141609704 AATTCATTCCAGACTAGGATAGG - Intronic
999429108 5:151510877-151510899 AACTCAAACCACACCAGGGTGGG + Intronic
1005495787 6:26386664-26386686 AACCCAATTCAGACTAGGGAAGG - Intronic
1006055734 6:31383317-31383339 TACTCAATCAACACTACTGTAGG - Intergenic
1007442134 6:41871293-41871315 TACTGAAACAAGTCTAGGGTAGG - Intronic
1009646632 6:66411843-66411865 TACTAAACCCAGACTTGGGACGG - Intergenic
1015520595 6:134127050-134127072 AATTCAATCAAGACTAGGCTGGG - Intergenic
1015710376 6:136132652-136132674 TATTCAATCCATACGAGGCTAGG - Intronic
1024117605 7:46208641-46208663 TACTAAATCCAGACAAGGTGAGG - Intergenic
1024297448 7:47856884-47856906 TACTTGAGCCAGACTGGGGTCGG + Intronic
1030252156 7:107459008-107459030 TACTCAATCCAAAAAAGGGTAGG + Intronic
1040447267 8:47507980-47508002 TACTCAATCCAGTATTGAGTGGG - Intronic
1049318444 8:141982399-141982421 CAATCAATGCAGACTATGGTTGG - Intergenic
1050165665 9:2762365-2762387 TTCTAAATCCAGACAAGGGAAGG + Intronic
1061053181 9:128207888-128207910 TTCTCCATCCAGGGTAGGGTAGG + Intronic
1061191854 9:129086752-129086774 TACTCAAACCAGAGTACGTTGGG - Exonic
1188840869 X:35015613-35015635 TAAGCAATCCATACTAGTGTGGG + Intergenic
1196257688 X:113541147-113541169 TCCTAAATCCAGACAAGGGAAGG - Intergenic