ID: 970491822

View in Genome Browser
Species Human (GRCh38)
Location 4:16582797-16582819
Sequence GGTCCCAGTGGAGCTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970491822_970491828 11 Left 970491822 4:16582797-16582819 CCAGCCACAGCTCCACTGGGACC 0: 1
1: 0
2: 0
3: 33
4: 336
Right 970491828 4:16582831-16582853 CATCATCGTACCTCTTAGCTCGG 0: 1
1: 0
2: 1
3: 3
4: 61
970491822_970491829 12 Left 970491822 4:16582797-16582819 CCAGCCACAGCTCCACTGGGACC 0: 1
1: 0
2: 0
3: 33
4: 336
Right 970491829 4:16582832-16582854 ATCATCGTACCTCTTAGCTCGGG No data
970491822_970491830 13 Left 970491822 4:16582797-16582819 CCAGCCACAGCTCCACTGGGACC 0: 1
1: 0
2: 0
3: 33
4: 336
Right 970491830 4:16582833-16582855 TCATCGTACCTCTTAGCTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970491822 Original CRISPR GGTCCCAGTGGAGCTGTGGC TGG (reversed) Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900379429 1:2376514-2376536 GTACCCAGTGAGGCTGTGGCTGG + Intronic
900648955 1:3721817-3721839 GGTGCCAGGGCAGCTGTGCCTGG + Intronic
901055314 1:6446433-6446455 GGTGGAAGTGAAGCTGTGGCTGG + Intronic
901391956 1:8951929-8951951 GGTACCAGGGAAGCTGAGGCAGG - Intronic
901761804 1:11476835-11476857 GGTGGCAGTGGAGCTGGTGCAGG - Intergenic
902819871 1:18937304-18937326 GGTTCCAGCGCAGCTGAGGCAGG + Intronic
903336076 1:22625706-22625728 GGTCCCAGTGGAGCTGTCCGGGG - Intergenic
903759609 1:25688862-25688884 TGTCCCAGTGAGCCTGTGGCAGG + Intronic
905298303 1:36968687-36968709 GCCCCACGTGGAGCTGTGGCAGG - Intronic
905928190 1:41767021-41767043 GGGCTGAGTGGAACTGTGGCTGG - Intronic
906032453 1:42732528-42732550 GGTGCCAGTGGAGCAGGGGTGGG - Intergenic
907458100 1:54588665-54588687 GAAGCCAGTGGAGCTGTGTCTGG + Intronic
910259985 1:85285033-85285055 GCTCCCTGTGAGGCTGTGGCTGG - Intergenic
910914255 1:92272262-92272284 GGACCCAATTAAGCTGTGGCTGG + Intronic
911004042 1:93199359-93199381 GCTCCCTGTGAGGCTGTGGCTGG + Intronic
912472265 1:109913794-109913816 GGGCCCAGGGGAGCTGTCTCTGG + Intronic
915596807 1:156900897-156900919 GGGCCCATTGCTGCTGTGGCTGG + Intronic
916214561 1:162384232-162384254 GGACCAAGAGGAGCTATGGCTGG - Intronic
918238688 1:182603406-182603428 GGTCCCAGAAGAGCTCTGGGTGG + Intronic
919454044 1:197801784-197801806 GCTCCCTGTGAGGCTGTGGCTGG - Intergenic
921625495 1:217373866-217373888 GCTCCCTGTGAGGCTGTGGCTGG - Intergenic
923145391 1:231194174-231194196 GGGCCCCCTGGGGCTGTGGCTGG - Intronic
923688260 1:236169243-236169265 GGTGCAGGTGCAGCTGTGGCAGG + Intronic
1064010428 10:11730884-11730906 GCTCCCTGTGAGGCTGTGGCTGG - Intergenic
1064693628 10:17943412-17943434 GGACCCAGCTGAGCTGTGCCTGG + Intergenic
1065838574 10:29681077-29681099 GTTCCCTGTGGAGGTGGGGCAGG + Intronic
1066311981 10:34206160-34206182 GGTCCCAGTGCAGGTGTGGAAGG + Intronic
1067296941 10:44980029-44980051 GTTCCAGGTGGGGCTGTGGCTGG - Intronic
1067472528 10:46547295-46547317 GCTTCCAGTGGAGATGTGCCAGG - Intergenic
1069850010 10:71398178-71398200 GGTCGCAGTGGGGCGGCGGCTGG - Intronic
1070386420 10:75928816-75928838 GCACCCAGTGGCTCTGTGGCAGG + Intronic
1071094248 10:81954839-81954861 GGTTACAGTGCAGCAGTGGCTGG - Intronic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1072625777 10:97110708-97110730 GTTCCCTCTGGAGCTGAGGCTGG + Intronic
1073350004 10:102812885-102812907 GAGCCCAGTGGCTCTGTGGCTGG + Exonic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1076146438 10:128126084-128126106 CGTCCCAGGTGAGCTGCGGCCGG - Exonic
1076515692 10:131043313-131043335 GGTCCCAGGGAAGCTGTGTCTGG - Intergenic
1076904589 10:133355694-133355716 GGCCCCAGTGGGGATGGGGCAGG + Intronic
1077496661 11:2889995-2890017 GGTCCCTGGGGTGCTGTGGGAGG - Intronic
1077501077 11:2909957-2909979 CGTCCCAGTGGGGCTGTGCGTGG - Intronic
1079032277 11:16994583-16994605 GGTCCCAGCAGGGCTGTGACCGG - Intronic
1081542905 11:44049068-44049090 GGGACCACTGGTGCTGTGGCAGG + Intronic
1083455442 11:62775761-62775783 GGCCCCAGTGGAGCTGGGAGTGG - Exonic
1084086614 11:66857888-66857910 GCGCACAGTGGAGCTGCGGCTGG + Exonic
1084525869 11:69697685-69697707 GGTCCCTCTGGATTTGTGGCTGG + Intergenic
1085257481 11:75183953-75183975 GGTCCCAGTGAAGATGGAGCAGG + Intronic
1085274898 11:75292083-75292105 GCTCCCAGGGGAGGTGGGGCGGG - Intronic
1085484382 11:76849484-76849506 TGGCACTGTGGAGCTGTGGCAGG + Intergenic
1086338282 11:85821939-85821961 GGCCCCAGTGCTGGTGTGGCTGG - Intergenic
1087560012 11:99776898-99776920 GTTCACATTGGAGCTGGGGCTGG - Intronic
1088911829 11:114197959-114197981 GGTCCCAGAGGAGCTGGGAGGGG + Intronic
1089969235 11:122679125-122679147 GGTGCCACTGGAGCTGAGGTTGG + Intronic
1090838336 11:130469467-130469489 GGGCCCAGGGGAGGTGAGGCTGG + Intronic
1090910034 11:131110803-131110825 GCTCCCTGTGAGGCTGTGGCTGG + Intergenic
1092137481 12:6159801-6159823 GGTGCCAGTGGAGCAGCGGGCGG - Intergenic
1092888783 12:12949670-12949692 CGTCCCACTGGGGCTGTCGCTGG + Exonic
1094311844 12:29092865-29092887 GGGCCTAGTTGAGCTGTGGTGGG - Intergenic
1095271579 12:40225039-40225061 CGCCCCCGGGGAGCTGTGGCCGG + Intronic
1096189422 12:49605595-49605617 GTTACCAGAGGAGCTGTGCCTGG - Exonic
1099832801 12:87866802-87866824 GGACACAGTGCAGCTGGGGCTGG + Intergenic
1101399470 12:104375186-104375208 GGTCCCGGCGGAGATGTGGGTGG + Intergenic
1101782040 12:107845468-107845490 CGTCCCGGTGTAGCGGTGGCTGG + Intergenic
1102521046 12:113477582-113477604 GGTCCCTCTGGAGCTGCAGCAGG + Intergenic
1103060023 12:117851156-117851178 GGTCCCAGTGGCCCTAAGGCTGG + Intronic
1103256182 12:119543415-119543437 GGTCCCAGTGGACATGAGGGAGG + Intergenic
1104380111 12:128299928-128299950 GGTGCCAGTGGAACCGGGGCAGG + Intronic
1104765583 12:131328090-131328112 GCTCCCTGGGGAGCAGTGGCAGG + Intergenic
1104813740 12:131633962-131633984 GCTCCCTGGGGAGCAGTGGCAGG - Intergenic
1107260690 13:38487315-38487337 GGACCCAGTTAAGCTGTGTCTGG - Intergenic
1109174075 13:59133742-59133764 GGTGGCCGTGGAGCTGTGTCGGG + Intergenic
1109525339 13:63567172-63567194 GCTCCCTGTGAGGCTGTGGCTGG - Intergenic
1111237871 13:85431927-85431949 GCTCTCTGTGAAGCTGTGGCTGG - Intergenic
1112502890 13:99956113-99956135 GGCCGCAGTGGAGCTGCGCCCGG + Intergenic
1113255148 13:108497182-108497204 TGTCCCAGTGGATCTGTGGTTGG - Intergenic
1113456426 13:110452279-110452301 GGTCCCAGCTGCGCGGTGGCGGG - Intronic
1113659137 13:112092795-112092817 GGTCCCAGAGGAGCCCGGGCAGG - Intergenic
1113665869 13:112141983-112142005 AGGCCCAGGGGAGCCGTGGCTGG - Intergenic
1113848917 13:113407096-113407118 GGTCCCAGTGGGGATGATGCAGG + Intergenic
1117189832 14:53278741-53278763 GGCCCCAGTGGAAATGTGGGAGG - Intergenic
1118294294 14:64554773-64554795 GGACCCAGATGAGCTCTGGCAGG + Intronic
1118709278 14:68506485-68506507 GGCCCCAGTACAGCTGTGACAGG - Intronic
1118773982 14:68962006-68962028 TGGCCCAGTACAGCTGTGGCTGG + Intronic
1119246694 14:73115785-73115807 GGTTCCAGTGAAGTTGTGGAAGG + Intronic
1119340964 14:73877142-73877164 GGTGCCTGTGGATCTGTGGCTGG + Exonic
1120590142 14:86364802-86364824 GCTCCCTGTGAGGCTGTGGCTGG - Intergenic
1121451480 14:94011077-94011099 GGTTACAGTGGAGCAGTGCCTGG - Intergenic
1121685166 14:95830350-95830372 GCTCTCAGGGGAGCTATGGCTGG + Intergenic
1121967843 14:98326861-98326883 GTTCCCAGTGGTGCTGAGCCTGG - Intergenic
1122405098 14:101496180-101496202 GGTCCCAGCAGAGCTGTGACTGG - Intergenic
1122914746 14:104853522-104853544 GGGTCCAGTTCAGCTGTGGCAGG + Intergenic
1123945512 15:25236969-25236991 GGTCTAGGTGGAGCTCTGGCTGG + Intergenic
1126991051 15:54375828-54375850 AGACCCAGCGGAGCTGTGCCTGG + Intronic
1127396446 15:58547234-58547256 AGCCCCTGTGCAGCTGTGGCTGG - Intronic
1127811349 15:62568173-62568195 TGTCCCAGTGTGGCTGGGGCTGG + Intronic
1129336691 15:74856225-74856247 GCTTCCAGTGGAGGTGAGGCTGG - Intronic
1129664171 15:77570079-77570101 GGCACCAGGGGAGCTGTGGTGGG + Intergenic
1130235170 15:82126643-82126665 AGGCCCAGAGGACCTGTGGCTGG + Intergenic
1131202618 15:90412814-90412836 GGTACCAGAGGAGCTGTTCCTGG + Intronic
1132376700 15:101332785-101332807 GCTCCCTGTGGAGCTGTCGGTGG - Intronic
1132551683 16:556310-556332 GGTCCTAGAGGAGCCCTGGCCGG - Intergenic
1132594760 16:743658-743680 GCTCCGGGTGGAGCTGGGGCGGG + Intronic
1132662792 16:1069061-1069083 GGTCCCAGCTGGGCTGCGGCAGG + Intergenic
1132804028 16:1767478-1767500 GGTGGCCCTGGAGCTGTGGCAGG + Intronic
1132837370 16:1960806-1960828 GGTCCCTGTGCAGCTGGGGGAGG + Intronic
1134762569 16:16727160-16727182 GGTCCCAGTTAAGCTGTACCTGG - Intergenic
1134983484 16:18631994-18632016 GGTCCCAGTTAAGCTGTACCTGG + Intergenic
1135733793 16:24915153-24915175 GGACCCAGAGAAGCTGTGCCTGG + Intergenic
1136555004 16:31002353-31002375 GGTGGCAGTGGTGCTGTGGGTGG - Intronic
1136637936 16:31537582-31537604 GGTCCCAGGTGAGCTGCGGCCGG - Intergenic
1136666790 16:31819571-31819593 GGTCCCAGGTGAGCTGCGGCCGG + Intergenic
1137494572 16:48959872-48959894 GGTCCCAGTGGGTCTGAGACTGG + Intergenic
1137950742 16:52781193-52781215 GCTCCCAGGGGAGCTGAGCCTGG - Intergenic
1138552378 16:57754765-57754787 GGTTCCAGAGGACCTGGGGCAGG - Intronic
1139379434 16:66521311-66521333 ATTCCCAGGGGAGCTGTGGCAGG - Intronic
1140261846 16:73387233-73387255 GCACCCAGTGGATTTGTGGCAGG + Intergenic
1141645484 16:85365139-85365161 TGTCCCAGAGGAGCTCTGGAGGG - Intergenic
1141813002 16:86388745-86388767 GGTCTCAGTGGAGCACTGGCTGG - Intergenic
1141997707 16:87645795-87645817 GGTCCCCGCCAAGCTGTGGCTGG + Intronic
1142491014 17:279677-279699 GGTCACAGCTGAGCTGTGGGAGG - Intronic
1142635388 17:1253982-1254004 GCTCCCCGTGGAGCTGAGGCAGG + Intergenic
1142753068 17:1999893-1999915 GGGCCCAGAGCAGCTGGGGCAGG + Intronic
1143089344 17:4439804-4439826 GGACCCAGTGGGGCTGGAGCTGG - Intronic
1143661427 17:8326901-8326923 GCTCGCGGTGGAGCTGTCGCTGG - Intergenic
1144949305 17:18985445-18985467 GGGCCCAAAGGAGCTGGGGCAGG + Intronic
1144952382 17:19001213-19001235 GGTCCCAGGACAGATGTGGCAGG + Intronic
1145205556 17:20983328-20983350 GGTCCCAGTATGGCTGTTGCAGG - Intergenic
1145976842 17:28988744-28988766 GCTCCAAGTGGGGCAGTGGCTGG + Intronic
1146000430 17:29127443-29127465 GGTCCCAGGGGATGAGTGGCTGG + Intronic
1146224241 17:31051971-31051993 GGTCCAAATGCAGGTGTGGCTGG + Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147019572 17:37520781-37520803 GTTCCCAGTGGATGTGTGGGAGG - Intronic
1147264253 17:39225437-39225459 GGTCCCTGGGGGGCTGTGGGTGG + Exonic
1148068710 17:44893469-44893491 GCTCCCAGTGCAGCTGTAGCTGG + Intronic
1148284149 17:46372998-46373020 GGTAGCAGGGGAGCGGTGGCAGG + Intergenic
1148306370 17:46590919-46590941 GGTAGCAGGGGAGCGGTGGCAGG + Intronic
1148740467 17:49889887-49889909 GGTTCCAGTGGGGGTGGGGCAGG + Intergenic
1148751696 17:49948994-49949016 GGTGCCAGTGGGGCTGAGGAAGG + Intergenic
1149554111 17:57560913-57560935 CGCCCCAGTGGAACTGGGGCAGG + Intronic
1150106277 17:62464792-62464814 GGTCCAAGAGGACCTGTGGGTGG + Intronic
1150653359 17:67024138-67024160 AGTCGCAGGGGAGGTGTGGCTGG - Intronic
1151422455 17:74007401-74007423 GGTCACAGTGGAGCTGCTCCTGG + Intergenic
1151787046 17:76280115-76280137 GGACCCAGTGAAGCAGTTGCTGG - Exonic
1152018836 17:77769957-77769979 GCTCTCAGGGAAGCTGTGGCAGG - Intergenic
1152097045 17:78278443-78278465 GGTCCCAGCAGAGCTGCTGCTGG - Intergenic
1152267881 17:79306784-79306806 GGTGCCCGTGGAGCTGGGGGTGG - Intronic
1152515060 17:80818200-80818222 GGTCCCAGCCGTGCTATGGCTGG - Intronic
1152573417 17:81130227-81130249 GTTCCCAGAGGAGCTGGGGGTGG + Intronic
1152610540 17:81313136-81313158 GGCCCCGGTGGGGCTGGGGCTGG + Exonic
1152756883 17:82090707-82090729 GGTCTCAGTGGGGCTGTGTGGGG - Intronic
1152855678 17:82663667-82663689 GGTGCCAGCGGGGCTGTGGTCGG - Intronic
1153133659 18:1887555-1887577 GATCCCAGTGTGGCTCTGGCAGG + Intergenic
1155815620 18:30305149-30305171 GGTTTCAGTGGAACTCTGGCGGG - Intergenic
1157404150 18:47409616-47409638 GGTCCTGGTGAAGCTGTGGGTGG - Intergenic
1158275085 18:55758314-55758336 GCTTCCAGTGAGGCTGTGGCTGG - Intergenic
1160512848 18:79462048-79462070 GGTGCCAGGGAAGCTGTGGCAGG - Intronic
1160847835 19:1174129-1174151 GGTCGCGGTGGAGCCGGGGCGGG + Intronic
1160864338 19:1250397-1250419 GGTGCCCGTGGTGCTGTGGATGG - Exonic
1160928751 19:1559870-1559892 GGTGGCAGTGCAGCTGGGGCGGG - Intronic
1161032051 19:2062067-2062089 GGTCACAGAGGAGCTGGGGGGGG + Intergenic
1161122845 19:2539663-2539685 GGTCCCAGTGGAGCCCTGAATGG + Intronic
1161203273 19:3027994-3028016 GGACCCCGTGGAGCTGGGGGGGG - Intronic
1161457372 19:4376285-4376307 TGTCCCTGTGCAGCTGTGCCAGG + Intronic
1161696437 19:5771209-5771231 GGGGCCAGTGGGGCTGGGGCAGG - Intronic
1162791528 19:13065530-13065552 TGTCCCATTGCTGCTGTGGCTGG + Intronic
1163267885 19:16232663-16232685 GGTCCCCGTGCACCTGGGGCAGG - Intronic
1163513370 19:17748681-17748703 GTCCCCAGTGCAGCTGGGGCAGG - Intronic
1163610926 19:18301199-18301221 GGTTCCAGTGGAGGCGGGGCAGG + Intergenic
1164617155 19:29674091-29674113 GGTCACACTGGAGCTGTTGCCGG + Exonic
1166336973 19:42114167-42114189 GGTCCCTGGGGAGCTGGGGGAGG + Intronic
1166871357 19:45872866-45872888 GCTCCCAGGGGAGCTGAAGCTGG + Exonic
1167116770 19:47493081-47493103 GGTCCCTGCGGGGCTGGGGCAGG + Intronic
1167274437 19:48528043-48528065 GGTCCTAGTGCAGCTGCTGCAGG + Intergenic
1167455513 19:49595383-49595405 GGTCCCAGCGGAGCCACGGCTGG + Exonic
1167639979 19:50675883-50675905 GGTCCCAGGGAGGCTGAGGCAGG + Intronic
1168332984 19:55580491-55580513 GGTCCCGGTGGAGGAGGGGCTGG + Intronic
925020188 2:562768-562790 GGGCCCTGTGGGGCTGTGGAGGG + Intergenic
925392401 2:3505467-3505489 GGACCCAGTAGAGCTTTTGCAGG - Intronic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
926254380 2:11177346-11177368 GGTGCCTGGGGAGCTGAGGCGGG + Intronic
929592734 2:43157731-43157753 AGTCCCTGTGGGGCTGTGGGTGG - Intergenic
929830419 2:45342629-45342651 GGTCCCAGCCCAGCTGTGTCAGG - Intergenic
931300630 2:60974710-60974732 GCTCCCTGTGAAGCTGAGGCTGG - Intronic
932492133 2:72128955-72128977 GCTCCGAGTGTGGCTGTGGCTGG - Intergenic
932497261 2:72152205-72152227 GGTTCAAGTGGAGCTCTGCCTGG + Intergenic
932733421 2:74236478-74236500 GGTCAAAGTGGAGGTGTGACAGG - Intronic
935660953 2:105466428-105466450 GGTGCCAGCTGGGCTGTGGCTGG + Intergenic
935921721 2:108022686-108022708 GGTCCCAGTGGACCTCTTCCTGG - Intergenic
936014139 2:108944875-108944897 GGTCCCAGAGGAACTGACGCCGG + Intronic
937212469 2:120283978-120284000 GGAGCCAGTGGAACTCTGGCTGG + Intronic
941921212 2:170852802-170852824 GGCCCCAGTGTAGCTTTGGAGGG - Intronic
941998980 2:171627509-171627531 GCTCCATGTGAAGCTGTGGCTGG - Intergenic
943736620 2:191363547-191363569 GGTACCTCTGGTGCTGTGGCGGG - Intronic
944171667 2:196786239-196786261 GGATCCAGTAGAGCTGGGGCAGG + Intronic
944995798 2:205292102-205292124 GGTCCCACTGGAGCTCTACCTGG - Intronic
945254515 2:207792307-207792329 GCTCACAGTTGAGCTGTGGCGGG - Intergenic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
946397337 2:219449554-219449576 GGACCCAGGGGAGCTATGGCGGG - Intronic
947037664 2:225877703-225877725 GAACCCAGTGGAACTGTGCCTGG - Intergenic
947910112 2:233795225-233795247 GTTCCGCGTGGAGCTGTGGATGG + Intronic
948850060 2:240701440-240701462 GGTGCCAGGGGGGCTGCGGCCGG - Intergenic
948972668 2:241441475-241441497 AGGCGCAGTGGAGCAGTGGCTGG + Exonic
1168868617 20:1109946-1109968 GATCCCAGTGGTCCTATGGCCGG - Intergenic
1169801897 20:9518997-9519019 GGACCCAGCTGTGCTGTGGCAGG + Intronic
1172126330 20:32627178-32627200 GGAGCCAGTGGGGCTGTGCCTGG + Intergenic
1172629289 20:36367344-36367366 GGTGCCAGTGGAAGTGAGGCTGG - Intronic
1172838961 20:37890664-37890686 GGCCCCAGGGCAGCTTTGGCAGG - Intergenic
1173551419 20:43935423-43935445 GGTACCAGTGGAGTTGGGGCGGG + Intronic
1175245424 20:57579274-57579296 GGTCCCAGTTGGACTGTGTCTGG - Intergenic
1175245443 20:57579358-57579380 GGTCCCAGTTGGACTGTGTCTGG - Intergenic
1175245462 20:57579442-57579464 GGTCCCAGTTGGACTGTGTCTGG - Intergenic
1175783556 20:61698369-61698391 CCTCCCAGTGGGGCTGTGCCAGG + Intronic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176082103 20:63278689-63278711 GGACCCTGTGGTGATGTGGCAGG + Intronic
1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG + Intergenic
1176711613 21:10155019-10155041 CGGCCTAGTGGAGCTGTGGGAGG - Intergenic
1178920255 21:36734062-36734084 GGCAGCAGTGGAGCTGGGGCAGG + Intronic
1179562475 21:42224329-42224351 GGTCCCAATGCCCCTGTGGCAGG - Intronic
1179717235 21:43295683-43295705 GATCTCTGGGGAGCTGTGGCTGG + Intergenic
1179888958 21:44326338-44326360 GGTGCCAGTGGGGCTGGGCCTGG - Intronic
1180169847 21:46052359-46052381 GCCCCCAGTGCAGCTGTGTCTGG + Intergenic
1180180262 21:46115788-46115810 CCTCTCAGAGGAGCTGTGGCAGG + Intronic
1180647042 22:17347835-17347857 GGTCCCAGTGGACGTGGTGCGGG - Intergenic
1181037490 22:20176928-20176950 GGTCCCTGTGCAGCTGTTCCCGG + Intergenic
1181318279 22:21985270-21985292 GGTCAGAGTGGAGCTGGGGTTGG - Intergenic
1181480159 22:23193785-23193807 GGTCCCTGTGGAGGAGTGACAGG + Intronic
1181672219 22:24430980-24431002 GGTACAAGTGGAGCTGGTGCTGG - Intronic
1182170126 22:28220359-28220381 GGACCCAGTGAAGCTATGCCTGG - Intronic
1183738462 22:39656946-39656968 AGTCCCAGGGGAGCCGTGGCAGG + Intronic
1183948109 22:41338278-41338300 GGCCACAGTGGCGCTGTGGCTGG - Intronic
1184115045 22:42417401-42417423 GGTCCCATGGGATCTGGGGCAGG + Intronic
1184479137 22:44736976-44736998 GGTCCCGGTGGGGCCCTGGCCGG - Exonic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1184932324 22:47690546-47690568 GAGCCCAGTGGAGCTGGGGAGGG - Intergenic
949226474 3:1700741-1700763 GCTCCGTGTGAAGCTGTGGCTGG - Intergenic
949422003 3:3875597-3875619 TGCCCCATTGGAGCTGTGGATGG - Intronic
950414176 3:12858957-12858979 GGTCCCAGTTGACCTATGACTGG - Intronic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
951501145 3:23389094-23389116 GGTCCCACAGGGGCAGTGGCAGG + Intronic
952256794 3:31702615-31702637 GGTCACAGAGGAGCTCTGCCCGG - Intronic
953347499 3:42188456-42188478 GGAGCCAGAGGTGCTGTGGCAGG + Intronic
955045218 3:55353150-55353172 GTTCTCAGTGGAGCTGGGGGTGG + Intergenic
955712223 3:61792310-61792332 GGTGCCTGTGGAGCTGAGGTGGG - Intronic
956061712 3:65355109-65355131 GATCCCACAGGAGCTGTGGTTGG - Intronic
958103954 3:89049218-89049240 GATGCCAGGGGAGCTGTGCCTGG + Intergenic
958178343 3:90024834-90024856 GAACCCAGTGAAGCTGTGCCTGG - Intergenic
959162111 3:102736161-102736183 GGCCCCAGTGGAAATGTGGGAGG + Intergenic
960243584 3:115374506-115374528 AGTGCCAGTGGAGCTGGTGCAGG - Intergenic
960534669 3:118802882-118802904 GGCCCCAGTGGAAATGTGGGAGG - Intergenic
960952562 3:123009072-123009094 GGACCCGGTGGACCCGTGGCAGG + Intronic
963574440 3:147042341-147042363 GGTCTCAGTTGAGCTGTGAGAGG - Intergenic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
967687322 3:192432805-192432827 GGACCCAGTGAAGCTGTGTCCGG + Intronic
968074594 3:195809527-195809549 GGACCAAGTGGAGCTGGGCCAGG - Intronic
969061470 4:4438655-4438677 TGCCCCAGTGGAGGTGTGTCCGG - Intronic
969574598 4:8029714-8029736 CGACCCAGTGGAGCTTGGGCTGG + Exonic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
970498790 4:16655363-16655385 CCTGCCAGGGGAGCTGTGGCAGG + Intronic
972645936 4:40967540-40967562 GCTCCCTGTGAGGCTGTGGCTGG - Intronic
974420247 4:61663399-61663421 GCTCCCAGCGAGGCTGTGGCTGG - Intronic
975493434 4:75012905-75012927 GGTCACAGTGGAGCTATGGTTGG - Exonic
976097728 4:81527434-81527456 GCTCCCTGTGAGGCTGTGGCTGG + Intronic
976213169 4:82692220-82692242 GGTTGCAGTAGAGCTGGGGCAGG - Intronic
977487238 4:97665000-97665022 GCTCCCTGTGAGGCTGTGGCTGG + Intronic
978206885 4:106090265-106090287 TGGCCCAGTTAAGCTGTGGCCGG + Intronic
978498593 4:109385320-109385342 GCTCCCTGTGAGGCTGTGGCTGG - Intergenic
981588255 4:146327977-146327999 GGTGCCAGTGCACTTGTGGCAGG - Intronic
983484719 4:168319828-168319850 GTTCCCTGTGGAGCAGTGCCTGG - Intergenic
984935227 4:184883877-184883899 GGTCCCAGTGGACCTTTTCCGGG - Intergenic
985950586 5:3219125-3219147 GGTCTCAGTGCACCTGTGGAGGG - Intergenic
988257172 5:28835513-28835535 GGACCCACTTGAGCTGTGACTGG + Intergenic
988363253 5:30263397-30263419 AGTCCCACTGCTGCTGTGGCAGG + Intergenic
988505487 5:31818570-31818592 GGTGCCAGTGCATCTGTGCCTGG - Intronic
990492754 5:56318667-56318689 GGTCCAAGTGGGGTGGTGGCTGG + Intergenic
990747226 5:58971131-58971153 GGTAACAGTGGAGCTAGGGCTGG - Exonic
990878882 5:60518089-60518111 GCTCCCTGTGAGGCTGTGGCTGG - Intronic
992266543 5:75024243-75024265 GGTGCCAGTGGTGGTGAGGCAGG - Intergenic
992440854 5:76796531-76796553 GCTCCCAGTGGAGTAGTGGATGG + Intergenic
993750626 5:91662114-91662136 GGTCCAACAGGAGCTGTGACTGG + Intergenic
996308545 5:122077772-122077794 GGTCCCGGCGGCGCTGAGGCTGG + Exonic
996355224 5:122588386-122588408 GTGTCCAGTGGAGTTGTGGCGGG - Intergenic
996467802 5:123823684-123823706 AGCCCCAGTGGAGAAGTGGCAGG - Intergenic
998092998 5:139381841-139381863 GATCACAGTGGAGGGGTGGCGGG + Intronic
999518224 5:152322228-152322250 GCTCTCACTGGAGCAGTGGCAGG + Intergenic
999875931 5:155805724-155805746 GGTGCCAGTGGAGAGGAGGCGGG + Intergenic
1001143035 5:169161219-169161241 GGTCCCAGGGGATTTGTGGTCGG + Intronic
1002394384 5:178941678-178941700 GGTCCCTCGGGGGCTGTGGCAGG - Intronic
1006449775 6:34099245-34099267 GGAGCCAGGGGAGCTGTGGAGGG + Intronic
1008621868 6:53278788-53278810 GGCCCCAGTGGAAGTGTGGTAGG - Intronic
1009413418 6:63392388-63392410 GGTCCCTTTGGAGCTGGAGCTGG - Intergenic
1012053237 6:94370912-94370934 TGACCCAGTGGATCTGTGGCAGG - Intergenic
1012122470 6:95385076-95385098 GCTCCCTGTGATGCTGTGGCTGG - Intergenic
1012999457 6:106008080-106008102 GGTCCCAGTGGGGCTGGGCGCGG + Intergenic
1013495377 6:110692180-110692202 GGTACCAGTGAGGCTGAGGCAGG + Intronic
1014004234 6:116398527-116398549 GGTCCCAGTGGCACTGTGTTTGG + Intronic
1017887412 6:158610518-158610540 GCTCCCAGTGGCTCTTTGGCAGG + Intronic
1018026276 6:159808756-159808778 GGTCCAACTGGTGCTGAGGCAGG + Exonic
1018669156 6:166165742-166165764 GGTCTCAGGGAAGCAGTGGCTGG + Exonic
1018824744 6:167400621-167400643 GGGGCCAGTGGAGAGGTGGCAGG + Intergenic
1019418200 7:936940-936962 AGGCCCAGTGGGGCTGGGGCTGG + Intronic
1020276690 7:6628802-6628824 GGTCTGAGTGGTCCTGTGGCTGG + Intergenic
1021431027 7:20559548-20559570 GCTCCCTGTGAAGCTGCGGCTGG + Intergenic
1022607307 7:31828204-31828226 GATCCCAGTGGTTCTTTGGCTGG - Intronic
1023350852 7:39319018-39319040 GGTACTAGAGGAGCTGAGGCAGG + Intronic
1023908678 7:44539244-44539266 GGACCCCGTGGAGCTGTGGTCGG - Exonic
1024233446 7:47380134-47380156 GCTCCGAGTGGGGCTGTGGCAGG + Intronic
1024709129 7:51995756-51995778 GATCACAGTGGAGCTGTTCCAGG + Intergenic
1029183886 7:98724766-98724788 GGTCCCAGTGGTGCTGACGGTGG + Intergenic
1029680546 7:102105988-102106010 GGGCCAAGTGGGACTGTGGCTGG + Intronic
1029747674 7:102525475-102525497 GGGGCCAGTGCAGCTGCGGCTGG + Intergenic
1029765625 7:102624565-102624587 GGGGCCAGTGCAGCTGCGGCTGG + Intronic
1030657346 7:112182938-112182960 GGGCCCAGTGGAATTCTGGCTGG + Intronic
1031998289 7:128247224-128247246 GGGCCCGCTGCAGCTGTGGCAGG - Intronic
1032035342 7:128517380-128517402 GGTCCAAGAGGACCTGTGGGTGG + Intergenic
1033236576 7:139642573-139642595 GGTCCAAGTGGAGATGTAGATGG + Intronic
1033392030 7:140937640-140937662 GGTACCTGTGCATCTGTGGCAGG - Intergenic
1034578898 7:152025803-152025825 GGTCGGACTGGGGCTGTGGCGGG + Intronic
1035644830 8:1210781-1210803 GGGCCCAGGGGAGCTGTGGAAGG - Intergenic
1036592588 8:10182404-10182426 GGACCCAGCTGAGCTGTGTCCGG - Intronic
1036707487 8:11056109-11056131 GGACCCAGTGCTGCTGGGGCTGG + Intronic
1037377343 8:18245102-18245124 GGTCCTAGGGAAGCTGAGGCAGG + Intergenic
1037931081 8:22880773-22880795 GGACCCACTGGGGCTCTGGCAGG + Intronic
1039380941 8:37084735-37084757 GGTCCCAGTGGCTCAGTGGTTGG + Intergenic
1041335078 8:56773112-56773134 GGTCAAATTGGACCTGTGGCTGG - Intergenic
1044318687 8:90778021-90778043 GGACCGGCTGGAGCTGTGGCAGG - Intronic
1045473867 8:102536992-102537014 GTTCCCAGTGGAAGTGTGGCTGG + Intronic
1046407226 8:113790508-113790530 GGTCCCTGTGAGGCTGAGGCTGG + Intergenic
1047796166 8:128257917-128257939 TGTCCCAGTTGAGAAGTGGCAGG + Intergenic
1047807271 8:128373522-128373544 GGTGCCAGTGGTGCTGGTGCTGG + Intergenic
1048437504 8:134432010-134432032 GGACCCTGTGGAGCTGTGTCTGG + Intergenic
1048588447 8:135798068-135798090 GGTCCTGCTGGAGCTGGGGCAGG + Intergenic
1048969469 8:139636808-139636830 GGTCACCTTGGAGCTGAGGCAGG - Intronic
1049190290 8:141283718-141283740 GGTCCACGTGGAAGTGTGGCTGG - Intronic
1049199505 8:141333181-141333203 CGTCTCAGTGGACCTGTGGAGGG + Intergenic
1049365259 8:142233959-142233981 TTCCCCAGTGGAGCTGTGGGGGG + Intronic
1049642106 8:143720475-143720497 TGGCCCAGAGGAGCTGTGCCAGG + Intronic
1049705496 8:144040290-144040312 GGTGGCAGTGGAGCTGAGGAGGG - Exonic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1053174776 9:35914848-35914870 GGCTCCTGTGGAGCTGAGGCAGG - Intergenic
1053397767 9:37789893-37789915 GGTACCAATGGAGTTGTGGCTGG - Intronic
1056572610 9:87828790-87828812 AGTGGCAGTGGCGCTGTGGCGGG - Intergenic
1056973917 9:91233232-91233254 GGTGACACTGGAGCTGAGGCAGG + Intronic
1057131034 9:92654876-92654898 GGTTCCAACGGAGCTGAGGCTGG + Intronic
1057277537 9:93683981-93684003 GTTCCCACTGGAGCTGAGGCAGG + Intergenic
1061209537 9:129182804-129182826 GGAGCCAGTGGCGCTGTAGCTGG + Intergenic
1061786401 9:133031050-133031072 CGTCCCCGTGGAGCTGAGGCGGG + Exonic
1061914234 9:133740993-133741015 GTCCCCACTGGAGCGGTGGCGGG - Intergenic
1062076789 9:134594106-134594128 AGCCCCAGCGGAGGTGTGGCAGG - Intergenic
1062350839 9:136137925-136137947 GGCCGCTGTGGAGCCGTGGCAGG - Intergenic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1202796368 9_KI270719v1_random:124008-124030 CGGCCTAGTGGAGCTGTGGGAGG - Intergenic
1185593457 X:1293610-1293632 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593477 X:1293697-1293719 GGTCCAGGTGGAGATGGGGCAGG - Intronic
1185593497 X:1293784-1293806 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593518 X:1293870-1293892 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593547 X:1294000-1294022 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593579 X:1294127-1294149 GGTCCAGGTGGAGATGGGGCAGG - Intronic
1185593905 X:1295726-1295748 GGTCTCTGTGGAGGTGGGGCAGG - Intronic
1185672986 X:1826494-1826516 GGTCCCAGGTGAGGTGAGGCTGG - Intergenic
1185820292 X:3196407-3196429 GTTCCCAGTGAAGCAGAGGCTGG - Intergenic
1186598482 X:11010021-11010043 GGTCACAGTGAAGATGTGGTGGG - Intergenic
1189198955 X:39175467-39175489 GGTGCCAGAGGAGCAATGGCTGG + Intergenic
1193554273 X:82933406-82933428 GCTCCCTGTGAGGCTGTGGCTGG - Intergenic
1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG + Intergenic
1198767325 X:140092328-140092350 GGCCTCAGTGGTGCTATGGCCGG + Intergenic
1199845158 X:151687642-151687664 GGTGCCAGCTGAGCTGTGCCTGG - Intergenic
1200039626 X:153355797-153355819 GGGCCCCCTGGAGCTGGGGCTGG - Intronic
1200149159 X:153942992-153943014 GGGCCCCCTGGAGCTGGGGCCGG + Exonic
1200319910 X:155177263-155177285 TGTCCCACAGGACCTGTGGCTGG + Intergenic