ID: 970492441

View in Genome Browser
Species Human (GRCh38)
Location 4:16588229-16588251
Sequence CAGATTTAGCACTGTGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970492438_970492441 -8 Left 970492438 4:16588214-16588236 CCAAATATTCCACTTCAGATTTA 0: 1
1: 0
2: 1
3: 23
4: 324
Right 970492441 4:16588229-16588251 CAGATTTAGCACTGTGATCAGGG 0: 1
1: 0
2: 0
3: 12
4: 159
970492437_970492441 -7 Left 970492437 4:16588213-16588235 CCCAAATATTCCACTTCAGATTT 0: 1
1: 0
2: 5
3: 55
4: 747
Right 970492441 4:16588229-16588251 CAGATTTAGCACTGTGATCAGGG 0: 1
1: 0
2: 0
3: 12
4: 159
970492436_970492441 3 Left 970492436 4:16588203-16588225 CCAAGAGAAGCCCAAATATTCCA 0: 1
1: 0
2: 1
3: 39
4: 368
Right 970492441 4:16588229-16588251 CAGATTTAGCACTGTGATCAGGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970492441 Original CRISPR CAGATTTAGCACTGTGATCA GGG Intronic
902739063 1:18421773-18421795 CAGTTTTGGCTCTGTGAGCAGGG + Intergenic
902806328 1:18863457-18863479 CAGAATTGGCTGTGTGATCAGGG + Intronic
905389401 1:37626540-37626562 GAGATTCATCTCTGTGATCAGGG + Intronic
908028863 1:59978560-59978582 GAGATTTAGCAAGATGATCAAGG + Intergenic
910912923 1:92257006-92257028 GAGATTTTGCACTGGGATGATGG - Intronic
910954148 1:92683159-92683181 CAGAAGTAGAATTGTGATCATGG - Intronic
910954456 1:92686646-92686668 GAGATTTTGCACTGAGATGATGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912247658 1:107977667-107977689 CAGACTTTGCCCTGTGATCCAGG + Intergenic
913100095 1:115555776-115555798 CTGTGTTAGCACTGTGACCAAGG - Intergenic
916668936 1:166994371-166994393 TAGATTTAGGACTGTTTTCAGGG + Intronic
917018865 1:170564264-170564286 GAGGTTTTGCACTGTGTTCATGG + Intergenic
917035768 1:170745458-170745480 CTGAATCAGCACTGTGGTCAGGG + Intergenic
917475254 1:175363783-175363805 CACAATTAGCAATGTGACCAAGG - Exonic
917994670 1:180423311-180423333 CAGATATGGCACTGTGATGCAGG - Intronic
919854812 1:201698012-201698034 CAGCTTTACCACTGTGACCTTGG - Intronic
923169801 1:231404936-231404958 TAGATTTGGCACTGTGAGAAAGG - Intronic
923263150 1:232286467-232286489 AAGAGTTAGAACTGTGAGCATGG + Intergenic
1066414542 10:35208565-35208587 GAGATTCAGCAGTGTTATCAAGG + Intronic
1068452878 10:57214640-57214662 ATGATTTAGCAATGTGATGAGGG - Intergenic
1069162422 10:65108121-65108143 CACTTTAATCACTGTGATCATGG - Intergenic
1070713020 10:78697090-78697112 CAGAATTGGCACTGTGACCCAGG - Intergenic
1073354057 10:102839859-102839881 CACTTTAATCACTGTGATCATGG - Intergenic
1076601501 10:131659655-131659677 CACAATTATCACTGTGATTATGG - Intergenic
1078441185 11:11369947-11369969 CAGATATATCACAGTGATCTAGG - Intronic
1078512367 11:11994940-11994962 CAGACTGAGGACAGTGATCATGG - Intronic
1079029755 11:16977676-16977698 CAGGTTTGGCACTGGGATGATGG - Intronic
1079139209 11:17796575-17796597 CAGATGTGGCCCTGTGATCTTGG + Intronic
1079882000 11:25940213-25940235 AAGATTGAGCAATGTGCTCAAGG - Intergenic
1081047831 11:38297806-38297828 CAGTGTTAGCACTTTGAGCAGGG + Intergenic
1082572930 11:54764485-54764507 CACTTTAATCACTGTGATCATGG + Intergenic
1083204082 11:61137532-61137554 CATATTAAGCACTGTGAGCATGG - Intronic
1087174100 11:95080340-95080362 CAGCTTTGGCACTGTGAGAAAGG + Intergenic
1093138995 12:15485608-15485630 TAGATTTAGGACTGTAATGACGG + Intronic
1101005508 12:100397598-100397620 CACATTTACCACTGTGTTGATGG - Intronic
1101368866 12:104105620-104105642 CATATTTATCTCTGTGATAAGGG + Exonic
1102434062 12:112906871-112906893 GAAATTCAGCACTGGGATCAGGG + Exonic
1103310610 12:120004246-120004268 CACTTGTAGCACTGTGATGAGGG - Intronic
1106848095 13:33759507-33759529 CAGATTTAATACTGAGATAATGG - Intergenic
1107269882 13:38602641-38602663 CAGAATGAACTCTGTGATCAGGG - Intergenic
1107702652 13:43063360-43063382 AAGATTTAGCACAGTGACCTGGG - Intronic
1110081995 13:71325457-71325479 TTGAAGTAGCACTGTGATCATGG - Intergenic
1111359484 13:87156715-87156737 CAGCAGTAGCACTGTGATCATGG - Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1114537182 14:23430414-23430436 CAGAATGTGCCCTGTGATCAGGG - Intronic
1116155907 14:41205565-41205587 TAGTTTTACAACTGTGATCAAGG + Intergenic
1117091845 14:52259049-52259071 CAGATTTTGCAGAGTGATCAAGG - Intergenic
1120002409 14:79317355-79317377 CAGCTGCAGCACTTTGATCACGG + Intronic
1121064791 14:90952450-90952472 CACTTTAATCACTGTGATCATGG + Intronic
1124021382 15:25927869-25927891 AAGATTTAGCACTGTAACCCAGG - Intergenic
1126589073 15:50321341-50321363 AAGATCTAGCTCTGAGATCAAGG - Intronic
1128502299 15:68235092-68235114 CACATTAAGCACTGAGATCAGGG - Intronic
1128826455 15:70721956-70721978 CAGACTTAGAACTGAGTTCATGG - Intronic
1133795064 16:9039405-9039427 AAGATTCAGCACTGTGGACAGGG - Intergenic
1138065894 16:53941010-53941032 CAGCTTTAGAACTTTGATCGGGG + Intronic
1139123493 16:64048741-64048763 CAACTGTAGCAATGTGATCAAGG + Intergenic
1140280757 16:73553395-73553417 CAGTTTCAACACTGTCATCAGGG + Intergenic
1141071899 16:80964535-80964557 AAGATTTATCACTGAGTTCAGGG + Intergenic
1144378885 17:14673157-14673179 AAGATTGAGCCCTGTTATCATGG - Intergenic
1145801370 17:27687936-27687958 CACTTTAATCACTGTGATCATGG - Intergenic
1145991754 17:29083229-29083251 CCGATGAAGCACTGTGAGCAAGG - Intronic
1146932158 17:36785105-36785127 GTGATTTAGCCCTGGGATCATGG - Intergenic
1148002288 17:44396937-44396959 CACATTTGGCACTGTTATCTTGG - Intronic
1150515907 17:65809017-65809039 CAGATGTAGCACCTTGATCTTGG + Intronic
1152596509 17:81240231-81240253 CAGAGTCAGCACTGGCATCAAGG - Intronic
1154392776 18:13955262-13955284 CATATTTAGCACTTTGTTAAGGG - Intergenic
1156734312 18:40234714-40234736 AAGATGTAGGACTGTGATTAAGG + Intergenic
1160749515 19:727310-727332 CAGAGTCAGGACTGAGATCAGGG - Intronic
1163941730 19:20501482-20501504 CACTTTAATCACTGTGATCATGG - Intergenic
1164712189 19:30364981-30365003 CACTTTTCACACTGTGATCAAGG - Intronic
1167056568 19:47114759-47114781 CAGATTTATCACTGTTGACACGG - Intronic
1168683636 19:58334916-58334938 CAGAGTGAGCAATGTGGTCATGG - Exonic
925046712 2:777979-778001 CTGATGTATCCCTGTGATCAGGG - Intergenic
928710455 2:33999422-33999444 CAGATTTTGCTCTGTCATCCAGG + Intergenic
931199144 2:60080312-60080334 CAGATTGAGGACTGTGGTAAAGG + Intergenic
932417197 2:71580531-71580553 CAGAGCTGGCACTGTGAGCAAGG + Intronic
932601084 2:73126286-73126308 CACATCTAGCACTCAGATCATGG + Intronic
935353159 2:102172719-102172741 TATATTAAGCACTGTGATGAGGG - Exonic
937738270 2:125317318-125317340 CAGTTTTAGCAATATGGTCATGG + Intergenic
939255423 2:139738118-139738140 CAGAATTAGCAATGTCAGCAGGG + Intergenic
940439102 2:153693329-153693351 CGGATTTAGCCCTGGGATCTAGG + Intergenic
940897843 2:159097674-159097696 GAGAGTCAGCACTGTGGTCAAGG - Exonic
941675492 2:168339521-168339543 CAGTTTTAGCATTGTTTTCAAGG + Intergenic
945766594 2:213987663-213987685 TATATTTGGCACTGTGATGAAGG + Intronic
945939871 2:215937573-215937595 AAGTTTTAGCACTGTGATATTGG - Intergenic
947422306 2:229951955-229951977 CAAGTTTTGCACTGTGGTCATGG + Intronic
1169006426 20:2210885-2210907 CTTTTTTAGCACTGTCATCATGG + Intergenic
1170334954 20:15259437-15259459 CAGATATAGCACTGTGACTGGGG + Intronic
1174526428 20:51175724-51175746 CAGATTCAGCACATTGAGCAAGG + Intergenic
1177187588 21:17815040-17815062 CAGATTTTGTACTGTGGGCATGG - Intronic
1178086498 21:29117764-29117786 CAGGTTTCACAGTGTGATCAGGG + Intronic
1178917891 21:36719179-36719201 CAGAATTAGCACAGTCATCTCGG + Intronic
1180604732 22:17048926-17048948 TAGAGATAGCACTGTGATCCAGG + Intergenic
1181314071 22:21960729-21960751 CAGAATAAGCACTGTGACCTTGG - Intronic
1183090935 22:35521441-35521463 TAGATTCAGCAGTGTGCTCAAGG + Intergenic
1185229495 22:49672006-49672028 CAGATCTTGGACTGTGAACAAGG + Intergenic
949460967 3:4293697-4293719 CATATTCAGCAGTGAGATCAAGG + Intronic
951919837 3:27842249-27842271 AACATTTAGCACAGTGCTCAGGG + Intergenic
952377355 3:32778924-32778946 CAGAGGTAGCACTGAGATGAAGG - Intergenic
954841723 3:53517270-53517292 CAGATGTGGCACTGGCATCATGG - Intronic
955135099 3:56209373-56209395 CAGAATAAGGACTGTGACCAAGG - Intronic
956190223 3:66601002-66601024 CAGACTCAGCACTGTTAACATGG - Intergenic
956995121 3:74818212-74818234 TAGATTTACCAGTGTAATCAAGG - Intergenic
958089869 3:88862983-88863005 CATATTAAGCACTATGATCAAGG + Intergenic
959294988 3:104523500-104523522 CAGATTTATCAATGTGCACATGG + Intergenic
960534010 3:118796493-118796515 AAGATTTAGAACTATGATCTAGG - Intergenic
962157371 3:132962118-132962140 TAGATTTAGCACAGTTCTCAAGG + Intergenic
963225442 3:142857382-142857404 CACATTTAGCCATGTGTTCAAGG + Intronic
965176613 3:165343312-165343334 CAGATTTAGCTATGTGCTCTAGG + Intergenic
970492441 4:16588229-16588251 CAGATTTAGCACTGTGATCAGGG + Intronic
971060994 4:22969553-22969575 CAGTTTTAGCACTGCCATTATGG - Intergenic
971971412 4:33625411-33625433 CATATTTAGAAATGTAATCAAGG - Intergenic
974659906 4:64873390-64873412 CTGGTTTACCACTGTTATCAAGG - Intergenic
975216278 4:71759794-71759816 CAGATTTAGCTATCTGATAAGGG - Intronic
975653596 4:76619327-76619349 GGGACTCAGCACTGTGATCACGG - Intronic
976288807 4:83396626-83396648 CAGAATTATCAGTGTGATCAGGG + Intergenic
976433016 4:84985483-84985505 TAGATTTAGCACAGTTATAAAGG - Intergenic
979900227 4:126206667-126206689 GAGATTTTGCACTGAGATGATGG + Intergenic
980321878 4:131290388-131290410 CAGCTATGGCACAGTGATCAGGG - Intergenic
981665582 4:147222319-147222341 CAGATTGAGTAGTGTGATCCAGG + Intergenic
983190815 4:164751595-164751617 CACTTTAATCACTGTGATCATGG + Intergenic
983193389 4:164778799-164778821 CAGAATTAACTGTGTGATCATGG + Intergenic
983919041 4:173325626-173325648 CAAATTTAGTACTGGGGTCAAGG + Intergenic
986146600 5:5083596-5083618 CAGATTTGGCACAGTGAGCAGGG + Intergenic
987721542 5:21639774-21639796 CATAATTAGCACTGAAATCATGG + Intergenic
989222493 5:38984572-38984594 CAGAGTCAGAACTGTGATTAGGG - Intronic
990684361 5:58284773-58284795 CATGTTTAGCCCTGTGATAAAGG + Intergenic
992481580 5:77157029-77157051 CAGCTTCAGCAGGGTGATCATGG + Intergenic
995074314 5:107963745-107963767 CACATTTAGCTCTGGGAGCATGG + Intronic
1000394100 5:160754993-160755015 CAGATATAGCAGTGTGAAAATGG - Intronic
1000904757 5:166951582-166951604 CAGTTTTAGTACTGTGAAAATGG + Intergenic
1005867147 6:29944797-29944819 CAGATTTATCACCTTGATTACGG + Intronic
1006970477 6:38039017-38039039 CAGATTGAGAAATGTGATCTAGG - Intronic
1009707671 6:67275187-67275209 AAGATTCAGCACTCAGATCAAGG + Intergenic
1010492060 6:76488533-76488555 CACTTTAATCACTGTGATCATGG - Intergenic
1010716082 6:79232337-79232359 CAGATTAAACACGGCGATCATGG - Intronic
1013796606 6:113895860-113895882 CAGGATGAGCTCTGTGATCATGG - Intergenic
1014941619 6:127447115-127447137 GAGATTTAGCAGGGTGATCTGGG + Exonic
1015824504 6:137297236-137297258 CAGATTTAGCTGTGTGACCTAGG + Intergenic
1017295496 6:152789301-152789323 CAGATTAAACACTGTGGGCATGG + Intergenic
1022817684 7:33929112-33929134 CAGAGTTTGCACTGTGAGCTGGG + Intronic
1024427522 7:49244557-49244579 CAGACTTTCCATTGTGATCAGGG - Intergenic
1025639108 7:63350600-63350622 CAGACTTAGCACTGTGAACTGGG + Intergenic
1025643591 7:63397492-63397514 CAGACTTAGCACTGTGAACTGGG - Intergenic
1025713178 7:63930524-63930546 CAGACTTAGCACTGTGAACTGGG - Intergenic
1029312084 7:99676816-99676838 CAGATTGACAACTGTGTTCATGG + Intronic
1029322876 7:99780703-99780725 CAGATTGACAACTGTGCTCAAGG + Intronic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1030653936 7:112145517-112145539 CAGCTTTAGCACTGTAAACTGGG - Intronic
1033161584 7:139001777-139001799 CAGATTTAGCCTTTGGATCAGGG - Intergenic
1037877846 8:22557127-22557149 CAGATCTAGAACTCTCATCAGGG + Intronic
1038018450 8:23533798-23533820 CAGACATACCCCTGTGATCATGG + Intronic
1042651957 8:71052774-71052796 CAGATTGCGCACTGTGATGCTGG + Intergenic
1044142413 8:88672068-88672090 CACTTTAATCACTGTGATCATGG - Intergenic
1045301071 8:100910635-100910657 TAGATGTAACACTCTGATCATGG + Intergenic
1045728020 8:105198660-105198682 CAGATTTTCCACTAAGATCAGGG - Intronic
1046824720 8:118675000-118675022 AAGATTTAGCACTCTAGTCAGGG - Intergenic
1047551315 8:125875369-125875391 AACATCTAGCACTGTGCTCAGGG + Intergenic
1050397093 9:5210503-5210525 CAGATTCACCACTTTGATGAGGG - Intergenic
1051998780 9:23251017-23251039 GAGATTTTGCACTGAGATGATGG - Intergenic
1052005337 9:23341069-23341091 CAGAGTTAGGATTGTGCTCAGGG - Intergenic
1052202560 9:25800466-25800488 TAGATTCAGCACTTTGATCAAGG - Intergenic
1055282397 9:74689485-74689507 TTGTTTTAGCACTGTGTTCAGGG + Exonic
1055826324 9:80329558-80329580 CTGAATTAGCTCTGTCATCAGGG - Intergenic
1061690910 9:132328747-132328769 CAGATTTAGGACTGATGTCAGGG + Exonic
1061748226 9:132755569-132755591 CCGATTAAGCCCTGTGATGAGGG - Intronic
1062024324 9:134333318-134333340 CAGAGGTAGGACTGTGACCAAGG - Intronic
1188406546 X:29817778-29817800 CTCATTTAGCAATGTCATCAAGG + Intronic
1189557736 X:42163029-42163051 GAGATTAATCACTGTGATCATGG - Intergenic
1197328286 X:125121466-125121488 CAGATTTAGCAATGTAATTGTGG + Intergenic
1202328663 Y:23721413-23721435 CACTTTAATCACTGTGATCATGG + Intergenic
1202542108 Y:25948641-25948663 CACTTTAATCACTGTGATCATGG - Intergenic