ID: 970498961

View in Genome Browser
Species Human (GRCh38)
Location 4:16657330-16657352
Sequence CAGGGTAATAATGATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 781
Summary {0: 1, 1: 0, 2: 3, 3: 75, 4: 702}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970498961_970498966 22 Left 970498961 4:16657330-16657352 CCATCATCATCATTATTACCCTG 0: 1
1: 0
2: 3
3: 75
4: 702
Right 970498966 4:16657375-16657397 ATTTGCTGTCACCACCTAATTGG 0: 1
1: 0
2: 1
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970498961 Original CRISPR CAGGGTAATAATGATGATGA TGG (reversed) Intronic
900505075 1:3025971-3025993 GATGGTAACAGTGATGATGATGG + Intergenic
900505105 1:3026184-3026206 GATGGTGATAGTGATGATGATGG + Intergenic
900505131 1:3026413-3026435 AATAGTAATGATGATGATGATGG + Intergenic
900650315 1:3727191-3727213 CAGGGTGATGATGATGAGGATGG - Exonic
900805775 1:4767318-4767340 GATGGTAATAATGATAGTGATGG - Intronic
900805776 1:4767336-4767358 GATGGTGATAATGATGGTGATGG - Intronic
900805813 1:4767652-4767674 GATGATAATAGTGATGATGATGG - Intronic
901193965 1:7429619-7429641 GATGGTGATAATGATGATGATGG + Intronic
901989452 1:13100866-13100888 GAGGGTATTGATGAGGATGAGGG - Intergenic
901992361 1:13125898-13125920 GAGGGTATTGATGAGGATGAGGG + Intergenic
902957075 1:19932942-19932964 GATGGTGATAATGATGATAATGG - Intergenic
902957087 1:19933085-19933107 TAGGATAATGATGATGATGGTGG - Intergenic
903030905 1:20463683-20463705 GATGGTAATTATGATGATTATGG - Intergenic
903804189 1:25992509-25992531 CAGAGTAAGTATGATGATGATGG - Intronic
904324465 1:29719109-29719131 AATGGTAATAATGGTGATGGTGG - Intergenic
904379769 1:30102787-30102809 GACGATGATAATGATGATGATGG + Intergenic
904413341 1:30338824-30338846 AATGGTAATGATGATGGTGATGG + Intergenic
904413349 1:30338956-30338978 GATGGTAATGATGATGATGATGG + Intergenic
904431020 1:30464249-30464271 GATGGTGATAATGATGGTGATGG + Intergenic
904431022 1:30464276-30464298 GAAGATGATAATGATGATGATGG + Intergenic
904434936 1:30488495-30488517 GATGGTAGTAATGATGATGATGG + Intergenic
905697986 1:39990007-39990029 CAGGGTGGTAGTGATAATGATGG - Intergenic
906711926 1:47937072-47937094 CATGGTAGTGGTGATGATGATGG - Intronic
906711942 1:47937195-47937217 CATGGTAGTGGTGATGATGATGG - Intronic
906711975 1:47937513-47937535 ATTTGTAATAATGATGATGATGG - Intronic
906789429 1:48645759-48645781 AATGGTAATAGTGATGATGATGG - Intronic
906926905 1:50127436-50127458 CAGGGTAATTTAGATGGTGATGG + Intronic
907560968 1:55387109-55387131 CATAATAATATTGATGATGATGG - Intergenic
907853820 1:58281943-58281965 GATGATAACAATGATGATGACGG - Intronic
907908067 1:58802834-58802856 GATGGTGATGATGATGATGAAGG + Intergenic
908422238 1:63970232-63970254 CAGTGTCTTAATGGTGATGATGG - Intronic
909305142 1:74065357-74065379 AAGGGTAATTATGATGCTAAGGG - Intronic
909530846 1:76680486-76680508 GAGGATAATAAAGAAGATGATGG - Intergenic
909949594 1:81704100-81704122 GAGGGGAAGTATGATGATGAAGG - Intronic
910339945 1:86174657-86174679 GAGGGTAATAATGAATTTGAAGG + Intergenic
910429120 1:87143700-87143722 CAGGATGATGATGACGATGATGG + Intronic
912209241 1:107540753-107540775 GTGGGTAACAGTGATGATGACGG - Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
912558720 1:110535023-110535045 AAGAATAATAATGATGATGGTGG - Intergenic
912904835 1:113693380-113693402 CAAGGTAAGCATGATAATGAAGG + Intergenic
912937302 1:114014623-114014645 CAGAGCAATCATGATGATGGTGG - Intergenic
913071554 1:115303545-115303567 GATGGTGATGATGATGATGACGG - Intronic
913590676 1:120321571-120321593 CAGGCTAGTAATAATAATGATGG + Intergenic
913617566 1:120577115-120577137 CAGGCTAGTAATAATAATGATGG - Intergenic
914201265 1:145487463-145487485 CAGGGCAGTGATGATGGTGAGGG + Intergenic
914572704 1:148933858-148933880 CAGGCTAGTAATAATAATGATGG + Intronic
914600135 1:149196404-149196426 CAGGCTAGTAATAATAATGATGG - Intergenic
915346644 1:155200919-155200941 CAGTGTGATGATGATGCTGATGG - Exonic
916152067 1:161803790-161803812 CAGGTTAAGAATGATGAAAAAGG + Intronic
917373397 1:174320884-174320906 CAGGGTAACAGTGATGTTCAGGG + Intronic
917619138 1:176777829-176777851 GATGGTAATGATAATGATGATGG - Intronic
917808306 1:178634127-178634149 CAGGGTAATAGGGAAGATAATGG - Intergenic
918568563 1:185959661-185959683 AATGGTGATAATGATGATGGTGG + Intronic
918641307 1:186844384-186844406 CATTATAAGAATGATGATGATGG + Intronic
919079005 1:192847759-192847781 CAGGTTAAGGATGATAATGATGG + Intergenic
919079006 1:192847765-192847787 AAGGATGATAATGATGGTGATGG + Intergenic
919082473 1:192883053-192883075 GAGGGTAATACTAATGATGAAGG - Intergenic
919366348 1:196666109-196666131 CAGGATAATTTTGCTGATGAAGG + Intronic
920190312 1:204189674-204189696 CTGGGTAGTTATGAGGATGAAGG + Intergenic
921085420 1:211786872-211786894 CAAGATAAAAATGATGATGAAGG + Intronic
921558562 1:216628843-216628865 CAGGTTACTAGTGATGAAGATGG - Intronic
921929108 1:220739862-220739884 CAAGATCATAATGATGAAGAAGG - Intergenic
923216133 1:231849509-231849531 CAGGGCTCTGATGATGATGATGG + Intronic
923977562 1:239281283-239281305 CAGTGTAAGGATGATAATGAGGG - Intergenic
1062950388 10:1495744-1495766 AATGATAATGATGATGATGATGG - Intronic
1063012434 10:2037470-2037492 CATGGTGATGATGATGTTGATGG + Intergenic
1063693293 10:8307758-8307780 CAGCGTAGTAATGATTAGGATGG - Intergenic
1067759579 10:49034163-49034185 AATGGTAGTGATGATGATGACGG - Intronic
1068083028 10:52343433-52343455 CAGGATGATGATGATGATGATGG + Intergenic
1069707052 10:70465531-70465553 CAGGGTTATTTTGACGATGACGG - Intergenic
1069792646 10:71032895-71032917 GATGATAACAATGATGATGATGG + Intergenic
1069792652 10:71032946-71032968 GATGATAATAATGATGATGGTGG + Intergenic
1069792666 10:71033069-71033091 GATGATAATAATGATGAAGATGG + Intergenic
1069792672 10:71033168-71033190 AATGGTGATGATGATGATGATGG + Intergenic
1069852685 10:71420418-71420440 GATGGTGATGATGATGATGATGG + Intronic
1070227065 10:74519642-74519664 TATGGTAACAATGATGAAGAAGG - Intronic
1070293881 10:75142265-75142287 GAAGGAAATAATAATGATGAGGG - Intronic
1071601639 10:86961441-86961463 CATGATGATGATGATGATGATGG - Intronic
1073155062 10:101339805-101339827 GATGCTAGTAATGATGATGATGG - Intergenic
1073580211 10:104658728-104658750 CATGATGATGATGATGATGATGG + Intronic
1073635518 10:105194329-105194351 AACAGTAAAAATGATGATGATGG + Intronic
1074697580 10:116064525-116064547 CAGGGTAATTATGAAAAAGAAGG - Exonic
1074731863 10:116387017-116387039 TAGGGCAATTATGTTGATGAAGG + Intergenic
1075922818 10:126227127-126227149 AATGGTGATAATGATGGTGATGG - Intronic
1076677502 10:132154762-132154784 CAGAGTGATAGTGATGATAATGG + Intronic
1076720887 10:132392429-132392451 GATGGTGATCATGATGATGATGG + Intergenic
1077546715 11:3174567-3174589 GATGATAATGATGATGATGAAGG - Intergenic
1077552428 11:3206665-3206687 GATGGTGATAATGGTGATGATGG + Intergenic
1077552435 11:3206719-3206741 GATGGTGATAATGATGATGATGG + Intergenic
1077552451 11:3206839-3206861 GATGGTGATAATGGTGATGATGG + Intergenic
1077552458 11:3206893-3206915 GATGGTGATAATGATGATGATGG + Intergenic
1077916551 11:6615394-6615416 CAGGGTAAGAGTGAGGATGGGGG - Intronic
1078822504 11:14895921-14895943 CATGGTGATGATGATGATGGTGG + Intergenic
1079247838 11:18766117-18766139 GATGGTGATGATGATGATGATGG - Intronic
1079345418 11:19647478-19647500 CAGAGTTATAATGAGGATGAGGG - Intronic
1079390037 11:20014214-20014236 CAGGGTGATAATGAGGGAGAGGG - Intronic
1079487210 11:20947761-20947783 AAATGTAATAATGATGATAATGG - Intronic
1079519290 11:21306451-21306473 AAGTATAATAATAATGATGATGG + Intronic
1080099557 11:28443819-28443841 CAGGGGAACAATGATGAAGGTGG - Intergenic
1080590819 11:33721967-33721989 CTGTGTTTTAATGATGATGATGG - Intronic
1080757255 11:35213715-35213737 GATGGTGATAATGATGGTGATGG + Intronic
1080953509 11:37065010-37065032 CAGGGCAGTGATGATAATGATGG + Intergenic
1081251213 11:40836869-40836891 CATGATAATAAAGATGATAATGG - Intronic
1082214627 11:49553969-49553991 GGTGGTAATGATGATGATGATGG - Intergenic
1082957338 11:58884574-58884596 CAGGGAAAAAGTTATGATGATGG + Intronic
1084443385 11:69189099-69189121 GATGGTGATTATGATGATGATGG - Intergenic
1084443403 11:69189285-69189307 GATGATGATAATGATGATGATGG - Intergenic
1084444305 11:69194622-69194644 CGTGGTGATGATGATGATGATGG + Intergenic
1084444368 11:69195126-69195148 GATGGTGATGATGATGATGATGG + Intergenic
1084459973 11:69291462-69291484 GACGGTAATGATGATGATGCTGG - Intergenic
1084459996 11:69291656-69291678 GAAGATGATAATGATGATGATGG - Intergenic
1084460004 11:69291731-69291753 GAGGATGATAATGGTGATGATGG - Intergenic
1084460012 11:69291794-69291816 GAGGATGATAATGGTGATGATGG - Intergenic
1084508646 11:69587511-69587533 CAGGGTGATGATGCTGTTGAAGG - Intergenic
1084551316 11:69844199-69844221 AATGGTGATGATGATGATGATGG + Intergenic
1084581370 11:70025730-70025752 GATGGTGATGATGATGATGATGG + Intergenic
1084581390 11:70025886-70025908 GATGGTGATGATGATGATGATGG + Intergenic
1084581457 11:70026416-70026438 AACAGTAATAATGATGATGGTGG + Intergenic
1084738795 11:71124131-71124153 GATGGTGATAATGGTGATGATGG + Intronic
1085099961 11:73792195-73792217 CAGTGTACTGATGATCATGATGG + Intronic
1085366820 11:75955411-75955433 TAGGGTAATAATAATAATGTTGG + Intronic
1085652719 11:78282892-78282914 CAAGGGAATAATTATGATAATGG - Intronic
1085793114 11:79513179-79513201 CTGGATGATAATGATGATGACGG - Intergenic
1085884084 11:80501579-80501601 GAGGGTAGTGAGGATGATGACGG + Intergenic
1085997858 11:81943250-81943272 CAGGGTAGTAATAATGTTTAGGG + Intergenic
1086862691 11:91943821-91943843 CAGGGTAATGGTGGTGAAGATGG - Intergenic
1087963493 11:104382103-104382125 CAAGTTGATAAAGATGATGAAGG - Intergenic
1088547278 11:110972478-110972500 AATGGTGATAATGATGGTGATGG - Intergenic
1089303444 11:117512452-117512474 CAGGGAAAAAATGGGGATGAGGG + Intronic
1090493654 11:127188849-127188871 CATGATAATGATGATGATGATGG + Intergenic
1091068366 11:132539723-132539745 GATGGTGATAATGATGGTGATGG + Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091179080 11:133587355-133587377 AATGGTAATAATAATGATGGTGG + Intergenic
1091309954 11:134565710-134565732 GATGGCGATAATGATGATGATGG + Intergenic
1092691996 12:11122743-11122765 CAGGGTAATAATAATTTTCATGG + Intronic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1094395606 12:30002258-30002280 GAGGACAATAATGATGATGATGG + Intergenic
1094470602 12:30797718-30797740 CAAGGAAATGAAGATGATGATGG - Intergenic
1094822348 12:34236115-34236137 GATGGTGATAGTGATGATGATGG - Intergenic
1094822389 12:34236465-34236487 CATGGTGATGATGATGATGATGG - Intergenic
1095180295 12:39140094-39140116 AAGGGGAAAAATAATGATGAAGG - Intergenic
1098045446 12:66396051-66396073 CAGGATATTGTTGATGATGAGGG - Intronic
1099080638 12:78175874-78175896 AAGTGAAAAAATGATGATGATGG + Intronic
1099151873 12:79124530-79124552 AATGGTGATGATGATGATGATGG - Intronic
1100955104 12:99899058-99899080 GATGATAATAATGATGGTGATGG + Intronic
1101018028 12:100522162-100522184 GGTGGTGATAATGATGATGATGG + Intronic
1101726038 12:107388841-107388863 CAAGTTGTTAATGATGATGATGG + Intronic
1101744546 12:107528825-107528847 CATGGTGATGATGATGGTGATGG + Intronic
1101744548 12:107528861-107528883 TATGGTGATAGTGATGATGATGG + Intronic
1101744551 12:107528897-107528919 GATGGTGATAATGATGATTATGG + Intronic
1101744552 12:107528915-107528937 TATGGTGATAGTGATGATGATGG + Intronic
1101819210 12:108170367-108170389 CAAGACAACAATGATGATGATGG + Intronic
1101927285 12:108983256-108983278 CATGATAGTAATGATGATGATGG - Intronic
1102149870 12:110681660-110681682 CGGGATGATGATGATGATGATGG - Intronic
1102427869 12:112858574-112858596 CAGGGGACTTATGATGATTATGG + Intronic
1103199509 12:119075631-119075653 AGTGGTAATGATGATGATGATGG + Intronic
1103199532 12:119075874-119075896 GATGGTAGTAGTGATGATGATGG + Intronic
1103199534 12:119075904-119075926 GATGGTGATGATGATGATGATGG + Intronic
1103248638 12:119480608-119480630 GATGGTGATGATGATGATGATGG - Intronic
1103248639 12:119480626-119480648 GATGGTGATAATGATGGTGATGG - Intronic
1103248683 12:119480962-119480984 GATGGTGATAATGATGGTGATGG - Intronic
1103315030 12:120046381-120046403 CTGGCTTATAATAATGATGAAGG + Intronic
1103464971 12:121134798-121134820 CTGATTGATAATGATGATGAAGG + Intronic
1103871127 12:124092857-124092879 GATGGTGATCATGATGATGATGG + Intronic
1103871131 12:124092896-124092918 GATGGTGATCATGATGATGATGG + Intronic
1103871157 12:124093131-124093153 GATGGTAGTGATGATGATGATGG + Intronic
1103934396 12:124467688-124467710 GAGGGTGATAAGGATGATGGAGG - Intronic
1103934399 12:124467706-124467728 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934478 12:124468029-124468051 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934545 12:124468304-124468326 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934658 12:124468771-124468793 GAGGGTGATGAGGATGATGAGGG - Intronic
1104130093 12:125885119-125885141 AATGACAATAATGATGATGACGG - Intergenic
1104375417 12:128261878-128261900 GATGGTAATTATGATGGTGATGG + Intergenic
1104524290 12:129503915-129503937 GACAGTAATGATGATGATGATGG - Intronic
1104524307 12:129504161-129504183 CAGGATGATGATGATGGTGATGG - Intronic
1104578931 12:129994955-129994977 GATGGTAATGGTGATGATGATGG - Intergenic
1104606566 12:130193737-130193759 CAGGGTAGAAAGGATGAAGACGG - Intergenic
1104683208 12:130766723-130766745 GATGGTGATAATGATGGTGATGG - Intergenic
1104762126 12:131303379-131303401 GATGGTGATGATGATGATGATGG - Intergenic
1104762171 12:131303828-131303850 GATGGTGATGATGATGATGATGG - Intergenic
1104762181 12:131303974-131303996 GATGGTGATAATGATGTTGATGG - Intergenic
1104776969 12:131395402-131395424 GATGGTGATGATGATGATGATGG + Intergenic
1104777012 12:131395923-131395945 GATGGTGATGATGATGATGATGG + Intergenic
1104777016 12:131395982-131396004 GATGGTGATGATGATGATGATGG + Intergenic
1104777444 12:131399258-131399280 GATGGTGATAATGATGGTGATGG + Intergenic
1104790369 12:131477709-131477731 AATGGTGATAGTGATGATGATGG + Intergenic
1104798850 12:131539452-131539474 GATGGTAATGGTGATGATGATGG + Intergenic
1104817595 12:131656822-131656844 GATGGTGATAATGATGTTGATGG + Intergenic
1104817605 12:131656971-131656993 GATGGTGATGATGATGATGATGG + Intergenic
1104817650 12:131657405-131657427 GATGGTGATGATGATGATGATGG + Intergenic
1104932992 12:132350048-132350070 CATGATGATAGTGATGATGATGG - Intergenic
1105294315 13:19074880-19074902 GATGGTGATAGTGATGATGATGG - Intergenic
1107668902 13:42722570-42722592 AAGGGTTATAATCTTGATGAAGG + Intergenic
1108251895 13:48575993-48576015 GGTGATAATAATGATGATGATGG + Intergenic
1108705083 13:52978032-52978054 TATGGTGATGATGATGATGATGG + Intergenic
1110039651 13:70736654-70736676 CAGGGTAATAATTAGGAACATGG + Intergenic
1110796479 13:79644385-79644407 CAGGGTAGTAGTGAGGCTGAAGG - Intergenic
1111904099 13:94235482-94235504 CAAGGTAATAATGTTTATCAAGG - Intronic
1113259764 13:108548566-108548588 GAGGATAATAATGATGGTGGTGG + Intergenic
1113281367 13:108792013-108792035 CAAGGGAAAAATGATAATGATGG - Intronic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113930548 13:113966546-113966568 GATGGTAATAGTGACGATGATGG + Intergenic
1114210221 14:20607785-20607807 CAGGGTAATAGAGATGAAGAGGG + Intronic
1114285464 14:21238663-21238685 GAGGGGAAATATGATGATGAGGG - Intronic
1115019420 14:28657851-28657873 CAGGGTATTAATGGAAATGATGG - Intergenic
1115161596 14:30402583-30402605 CAGTGCAATAATGATGAATATGG + Intergenic
1115831222 14:37344280-37344302 CAGGGGAATAAAAAAGATGAAGG - Intronic
1115934696 14:38538680-38538702 AATGATGATAATGATGATGATGG + Intergenic
1116128193 14:40816930-40816952 CAGGGTAACAATTATCAGGATGG - Intergenic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1117185879 14:53240404-53240426 GATGATAATGATGATGATGATGG + Intergenic
1118963648 14:70559392-70559414 CAGGGTGATAATGATGGGGATGG - Intergenic
1119800668 14:77442210-77442232 CAGGGTTATTATGAAGATGAAGG - Intronic
1121101240 14:91251951-91251973 CACGGTGAGGATGATGATGATGG - Exonic
1121840996 14:97133612-97133634 AATAGTAATAATGATGATGATGG - Intergenic
1121889508 14:97575790-97575812 AATGATGATAATGATGATGATGG + Intergenic
1122180664 14:99952076-99952098 CGGCGTGATAGTGATGATGATGG + Intergenic
1122384175 14:101332795-101332817 CATGGCAATGATGGTGATGACGG + Intergenic
1122394814 14:101416953-101416975 CAGGGAAACAGTGATTATGAGGG + Intergenic
1124097180 15:26659556-26659578 CAGGTTAAGTATCATGATGATGG + Intronic
1124134092 15:27018988-27019010 CACGATAATCATGATGATGATGG + Intronic
1124181147 15:27475799-27475821 GATGGTAATGATGATTATGATGG + Intronic
1125382088 15:39096993-39097015 TAGGGTAATAGTGATGATTAAGG + Intergenic
1126410788 15:48371062-48371084 CAGGATGGTGATGATGATGATGG + Intergenic
1126421146 15:48473658-48473680 GACGATAATGATGATGATGATGG + Intronic
1126437138 15:48646975-48646997 CAGGGTTGTAATGGTGATGATGG + Intergenic
1126581387 15:50245393-50245415 GAGGATGATGATGATGATGATGG + Intronic
1126821375 15:52507326-52507348 CTGGTTAAGAATGTTGATGATGG + Intronic
1127282525 15:57504121-57504143 GATGATGATAATGATGATGAGGG + Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1128546035 15:68568408-68568430 AAGGGCAATAGTGATGATGATGG - Intergenic
1128598835 15:68977824-68977846 CAGGATAATAGTGATGTTCAGGG - Intronic
1128606889 15:69043255-69043277 GATGGTGATGATGATGATGAGGG - Intronic
1128780458 15:70355641-70355663 CAGGGTGAGAGTGATGATGATGG - Intergenic
1130056374 15:80529606-80529628 CCGGGCAATAATGAAAATGAAGG - Intronic
1130127080 15:81103067-81103089 CATGATGATGATGATGATGATGG + Intronic
1130857465 15:87853586-87853608 AATGATAATAATGATGGTGATGG + Intergenic
1131275446 15:90976657-90976679 CAAGGTAATAATGTTGCTAAGGG - Exonic
1131300429 15:91194967-91194989 CAGGATCAGAATGAAGATGAAGG + Intronic
1132015323 15:98310581-98310603 ATTGGTAATGATGATGATGATGG + Intergenic
1132169429 15:99633735-99633757 CAAGGTAATTATAATGATGCTGG + Intronic
1133042415 16:3067684-3067706 CAGGGTGAGAAGGATGAAGAGGG + Intronic
1133595721 16:7289424-7289446 GATGGTAATGATGATGGTGATGG - Intronic
1133742674 16:8663236-8663258 TAGGGAGATGATGATGATGATGG - Intergenic
1133815135 16:9191326-9191348 CAGGATGATGATGATGATGGTGG + Intergenic
1133882374 16:9795012-9795034 CATGATGATGATGATGATGACGG + Intronic
1133910071 16:10057562-10057584 CAGGGCACTAATTATGATTAGGG + Intronic
1134330534 16:13246879-13246901 AATGATGATAATGATGATGATGG - Intergenic
1134556035 16:15166034-15166056 TATGGTGATGATGATGATGATGG - Intergenic
1134642954 16:15843870-15843892 CCGGGTGATGATGATGATGCTGG + Intronic
1134912157 16:18037334-18037356 GAAGATAATAATGATGGTGATGG + Intergenic
1134916619 16:18077769-18077791 TATGGTGATGATGATGATGATGG - Intergenic
1135237211 16:20768468-20768490 CTAGGTGATAAAGATGATGATGG + Intronic
1135467475 16:22699594-22699616 CTTAGTAATTATGATGATGATGG + Intergenic
1135539025 16:23315902-23315924 GATGGTAATGGTGATGATGATGG - Intronic
1135869912 16:26139946-26139968 GATGGTAATAACGATGATGATGG + Intergenic
1135869938 16:26140292-26140314 AATGGTGATAAGGATGATGATGG + Intergenic
1135907481 16:26526074-26526096 GATGGTGATAGTGATGATGATGG - Intergenic
1135909127 16:26543200-26543222 GATGGTAATGATGATGATGGTGG - Intergenic
1136021827 16:27445369-27445391 CATGGTAACAATGATGATGATGG + Intronic
1136283300 16:29226955-29226977 GATGGTAATGATGGTGATGATGG - Intergenic
1137243889 16:46687298-46687320 GAGAGAAATAAGGATGATGAGGG + Intronic
1137483739 16:48874533-48874555 GATGGTAATAATGATGGTGCTGG + Intergenic
1138204931 16:55117699-55117721 GAGGATGATGATGATGATGATGG + Intergenic
1138211334 16:55165627-55165649 AAGGATGATAATGATGATGGTGG - Intergenic
1138821526 16:60265966-60265988 TAGGATAATAATGATGAACATGG - Intergenic
1140834847 16:78783795-78783817 GAGGGTGATGGTGATGATGATGG + Intronic
1140898060 16:79342594-79342616 GATGGTGACAATGATGATGATGG - Intergenic
1140901882 16:79375595-79375617 GATGGTAATGATGATGATGAAGG + Intergenic
1140947862 16:79786963-79786985 CATGGCAATGATGATGTTGATGG - Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1140987400 16:80171407-80171429 GGTGGTAATGATGATGATGATGG - Intergenic
1141061682 16:80878613-80878635 CGTGGTGATGATGATGATGATGG + Intergenic
1141140710 16:81495190-81495212 TACAGTAATGATGATGATGATGG - Intronic
1141319783 16:82996707-82996729 GAGAGTGATGATGATGATGATGG + Intronic
1141813693 16:86394269-86394291 GATGGTGATAATGATGATGATGG - Intergenic
1141873010 16:86802132-86802154 TGGGGTAATGATGATGATGGTGG + Intergenic
1141873031 16:86802346-86802368 GATGGTAGTGATGATGATGATGG + Intergenic
1141881277 16:86861334-86861356 AATGGTGATGATGATGATGATGG + Intergenic
1141881322 16:86861661-86861683 GATGGTGATGATGATGATGATGG + Intergenic
1141931813 16:87210152-87210174 CATGTTAATGATGGTGATGATGG + Intronic
1141931819 16:87210194-87210216 CATGTTAATGATGGTGATGATGG + Intronic
1141988714 16:87597227-87597249 GATGGTGATAGTGATGATGATGG - Intergenic
1142103532 16:88289221-88289243 GAGGGTGATGATGATGATGAAGG + Intergenic
1142103539 16:88289275-88289297 GAGGGTGATGGTGATGATGATGG + Intergenic
1142103550 16:88289356-88289378 GAGGGTGATGATGGTGATGATGG + Intergenic
1142110956 16:88331138-88331160 GATGGTAATAGTGATGGTGATGG - Intergenic
1142110958 16:88331156-88331178 GATGGTAATGATGGTGATGATGG - Intergenic
1142261786 16:89046061-89046083 GATGGTGATAGTGATGATGATGG - Intergenic
1142788330 17:2243215-2243237 CTGGGTAAGAATGATAGTGATGG - Intronic
1142896646 17:2983890-2983912 GAGGGTCATATAGATGATGATGG + Intronic
1143919715 17:10321203-10321225 GATGCTAATAATAATGATGATGG + Intronic
1143979118 17:10852856-10852878 TAGGGAGAGAATGATGATGAAGG + Intergenic
1144069304 17:11653365-11653387 CCGGGTTATAAGGATGATGCTGG - Intronic
1144719729 17:17460365-17460387 CATGGTGATGATGGTGATGATGG - Intergenic
1145415743 17:22712376-22712398 GATGGTGATAATGATGGTGATGG + Intergenic
1145415765 17:22712576-22712598 GACGGTGATAATGATGATGATGG + Intergenic
1146259119 17:31410327-31410349 GAGGATGATGATGATGATGAAGG + Intronic
1146505157 17:33398531-33398553 GATGGTTATAATAATGATGATGG + Intronic
1146675406 17:34770118-34770140 GATGGTAATGATGATGGTGATGG + Intergenic
1148186928 17:45651006-45651028 CAGGGTAATAGATATCATGAGGG + Intergenic
1149127316 17:53251203-53251225 TAGGTTGAGAATGATGATGAGGG - Intergenic
1149745446 17:59093211-59093233 CAAGGTAATAATAATGTTCAAGG - Intronic
1149951621 17:60994459-60994481 GAGGGAAAAAATGATGATCAGGG - Intronic
1150023933 17:61651943-61651965 CAGGGGAATGATGAGAATGATGG + Intergenic
1150343844 17:64389009-64389031 CAGGATAATTATGAAGATTATGG + Intronic
1151027721 17:70698683-70698705 CAGGTGAGTGATGATGATGACGG + Intergenic
1151432873 17:74076429-74076451 GGCGGTAATAATGATGGTGATGG + Intergenic
1152115907 17:78386986-78387008 GATGGTGATGATGATGATGATGG + Intronic
1152131287 17:78478174-78478196 GATGGTGATAATGGTGATGATGG - Intronic
1152131363 17:78478677-78478699 GATGGTAATAATTGTGATGATGG - Intronic
1152214832 17:79025885-79025907 GATGGTGATGATGATGATGATGG - Intronic
1152371946 17:79893743-79893765 GATGGTGATGATGATGATGATGG - Intergenic
1152371948 17:79893776-79893798 GATGGTGATGATGATGATGATGG - Intergenic
1152371951 17:79894070-79894092 GATGGTGATGATGATGATGATGG - Intergenic
1152371956 17:79894130-79894152 GATGGTGATGATGATGATGATGG - Intergenic
1152371958 17:79894169-79894191 GATGGTGATGATGATGATGATGG - Intergenic
1152371961 17:79894220-79894242 GATGGTGATGATGATGATGATGG - Intergenic
1153851426 18:9098953-9098975 GATGGTGATGATGATGATGAAGG + Intergenic
1155431824 18:25767737-25767759 CAGGGAAAGAATGAAGTTGATGG + Intergenic
1155873886 18:31061137-31061159 CAGGGTGATTCTGATGCTGATGG + Exonic
1155898697 18:31361364-31361386 CAGGGTAATAATGATTGGAATGG - Intergenic
1156638999 18:39067331-39067353 CCAGGTAATAATGATGATGTTGG + Intergenic
1156787532 18:40933257-40933279 GAGGGTGATGATGATGATGGTGG - Intergenic
1156795582 18:41041836-41041858 GATGTTAATAATAATGATGATGG + Intergenic
1157001524 18:43531997-43532019 CATGATAACAATTATGATGAAGG + Intergenic
1157305797 18:46516713-46516735 GATGGTGATTATGATGATGAGGG - Intronic
1158096885 18:53782997-53783019 GATGGTGATAGTGATGATGATGG - Intergenic
1158420444 18:57288319-57288341 TAGAGTGATAATGAAGATGATGG - Intergenic
1159144109 18:64431332-64431354 CTGGGCATGAATGATGATGATGG - Intergenic
1159995350 18:74959280-74959302 CATGACAATACTGATGATGATGG - Intronic
1160143197 18:76344416-76344438 GATGGTGATAATGGTGATGATGG + Intergenic
1161899480 19:7107710-7107732 GATGGTGATGATGATGATGATGG + Intergenic
1162146621 19:8616320-8616342 AATGGTGATAATGATGGTGATGG + Intergenic
1162183125 19:8884325-8884347 CATGATGATAATGAGGATGATGG - Intronic
1162183572 19:8887520-8887542 AATGAGAATAATGATGATGATGG - Intronic
1162183997 19:8890530-8890552 GATGGTGATGATGATGATGATGG - Intronic
1162184789 19:8896429-8896451 AATGGTGATAATGATGATGGTGG - Intronic
1162185991 19:8905343-8905365 GATGATAATAATGATGGTGATGG - Intronic
1162186012 19:8905560-8905582 GAGTGTGATGATGATGATGATGG - Intronic
1162836039 19:13318607-13318629 CAGGCAAGTGATGATGATGATGG + Intronic
1164396790 19:27872487-27872509 AATGGTGATAATGATGATTATGG + Intergenic
1164640500 19:29821796-29821818 CATGGAATTAATGATTATGAAGG + Exonic
1164721471 19:30434852-30434874 GATGGTGATAATGATGATGATGG + Intronic
1164721500 19:30435223-30435245 GATGGTGATAGTGATGATGATGG + Intronic
1164721527 19:30435525-30435547 GATGGTGATAGTGATGATGATGG + Intronic
1167212347 19:48141046-48141068 GACGGTAACAATGATGAAGATGG + Intronic
1167299312 19:48670094-48670116 GATGGTGATGATGATGATGATGG - Intronic
1167325441 19:48821659-48821681 GATAGTGATAATGATGATGATGG + Intronic
1168144544 19:54413547-54413569 GATGATAATGATGATGATGATGG - Intergenic
1168144658 19:54414217-54414239 GATGATAATTATGATGATGATGG - Intergenic
1168144659 19:54414268-54414290 GATGGTGATGATGATGATGATGG - Intergenic
1168322748 19:55519749-55519771 GATGGTAATGATGATGATGATGG + Intergenic
1168361760 19:55746726-55746748 GATGGTGATGATGATGATGACGG + Intergenic
1168591948 19:57643681-57643703 CATTGTAATAATTATAATGATGG - Intergenic
925609972 2:5694128-5694150 GATGATAATGATGATGATGATGG + Exonic
925897316 2:8482591-8482613 GATGGTGATAATGATGGTGATGG + Intergenic
926117355 2:10221821-10221843 CAGGGTGATGATGATGAAGATGG + Intergenic
926634787 2:15167408-15167430 CAGGGCATGAATGATGATGAAGG - Intronic
926774684 2:16410137-16410159 AATGGTGATGATGATGATGATGG - Intergenic
926791066 2:16572264-16572286 CAGGGTCATAATGAAGATGATGG + Intronic
926881955 2:17555464-17555486 GAAGGTGATAATGATGATGGTGG - Intronic
927332688 2:21884459-21884481 CATAGTGATGATGATGATGATGG + Intergenic
927882841 2:26700730-26700752 GATGGTGATGATGATGATGATGG - Intronic
927882842 2:26700748-26700770 GATGGTGATGATGATGATGATGG - Intronic
928273286 2:29876507-29876529 AATGGTAATGATGATGGTGATGG + Intronic
928273292 2:29876552-29876574 GATGGTAATGATGATGCTGATGG + Intronic
928393265 2:30925473-30925495 CAAGGTAGTAATGGTGATGCTGG + Intronic
928936390 2:36683186-36683208 CAGGCAAGAAATGATGATGATGG + Intergenic
929122134 2:38492128-38492150 CTGTGGAGTAATGATGATGACGG - Intergenic
929529829 2:42742454-42742476 CAGGCAAAAAATGATGGTGAAGG - Intronic
929883293 2:45855938-45855960 CAGGGTTTTCATGATGATGATGG + Intronic
930548833 2:52805290-52805312 AAGGAAAATAATGATGATGGTGG - Intergenic
931427864 2:62187524-62187546 CATGATTATATTGATGATGATGG + Intergenic
931764560 2:65443432-65443454 TAGGGCAATAATGATGATCATGG + Intergenic
932378292 2:71258112-71258134 TAGAATAATGATGATGATGATGG - Intergenic
933021857 2:77204376-77204398 GATGGTGATAATGATGATGATGG + Intronic
933259160 2:80112489-80112511 GAAGATAATAATGGTGATGATGG - Intronic
933331673 2:80900080-80900102 AATGGTGACAATGATGATGATGG - Intergenic
933495975 2:83051104-83051126 CAGTGAAACATTGATGATGAAGG - Intergenic
933665696 2:84963123-84963145 CTGAGCAATAATGATGCTGAAGG - Intergenic
933833113 2:86226138-86226160 GAGGATGATGATGATGATGATGG - Intronic
933884667 2:86707012-86707034 AAGGATAATTATGATAATGAGGG - Intronic
935995234 2:108764023-108764045 CATGGGGATGATGATGATGACGG + Exonic
937507885 2:122557435-122557457 TAGGGTAATGATGAGGATAAAGG + Intergenic
937759363 2:125581837-125581859 CATGGCAATGATGATGGTGAAGG + Intergenic
937936314 2:127248378-127248400 CATGGTAACAATACTGATGATGG + Intergenic
938680458 2:133684594-133684616 CATGATGATGATGATGATGATGG + Intergenic
938809793 2:134842641-134842663 CATGCTAACAATGATGCTGATGG - Intronic
939441120 2:142251230-142251252 CAGGGACATAATGATGCTGGTGG + Intergenic
939650839 2:144759793-144759815 TAGAGTAATAGTGGTGATGATGG - Intergenic
940062573 2:149588548-149588570 CACTGTAATAATGGTGATAAAGG - Intergenic
940911784 2:159215901-159215923 CTTGCTAATGATGATGATGATGG + Intronic
941294835 2:163724206-163724228 CAGGAAAGTAACGATGATGAAGG - Intronic
941666970 2:168251771-168251793 GACAGGAATAATGATGATGATGG - Intergenic
942810812 2:179998369-179998391 CAGGGTAATTATGAGGATTGAGG - Intronic
944031092 2:195235557-195235579 GATGATGATAATGATGATGATGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944687037 2:202126598-202126620 CTCAGTAAAAATGATGATGATGG + Intronic
945036263 2:205706517-205706539 AATGATAATAATGATGATAATGG - Intronic
945183574 2:207116592-207116614 CAGGATAACCATGATCATGACGG + Intronic
945253865 2:207787793-207787815 CAGGGTGATAAAGATATTGAGGG + Intergenic
945264885 2:207881367-207881389 CAGTGTTATAATCATTATGATGG - Intronic
946900088 2:224364044-224364066 TAGAATAATAATGATCATGATGG - Intergenic
947269074 2:228313384-228313406 CTTGGGAATAATAATGATGATGG - Intergenic
947383100 2:229563977-229563999 GAGGATGATGATGATGATGATGG - Intronic
947383163 2:229564368-229564390 TGGGGTGATGATGATGATGATGG - Intronic
947619366 2:231578922-231578944 GATGGTGATGATGATGATGATGG - Intergenic
947619392 2:231579696-231579718 GATGGTGATAATGATGGTGATGG - Intergenic
947832259 2:233149903-233149925 AAGGGTAATAATAATGGTGGTGG - Intronic
947924185 2:233906665-233906687 GAATATAATAATGATGATGATGG + Intergenic
949047466 2:241878316-241878338 AATGGTAACAATGCTGATGATGG - Intergenic
1169043493 20:2516591-2516613 CAGGACAACAGTGATGATGAGGG + Intronic
1169411969 20:5378971-5378993 AAGGCTGATGATGATGATGATGG + Intergenic
1169831901 20:9834706-9834728 GAGGGTTATAGTGATGATTATGG + Intronic
1171253689 20:23669716-23669738 AATGGTAGTCATGATGATGATGG - Intergenic
1171258702 20:23711656-23711678 GGTGATAATAATGATGATGATGG - Intergenic
1171269288 20:23800847-23800869 AATGGTAGTCATGATGATGATGG - Intergenic
1171557843 20:26094526-26094548 GATGGTGATAATGAAGATGATGG - Intergenic
1171878899 20:30602223-30602245 GATGGTGATAGTGATGATGATGG - Intergenic
1171878904 20:30602307-30602329 GATGGTGATAGTGATGATGATGG - Intergenic
1172114902 20:32567921-32567943 GATGGTGATGATGATGATGATGG - Intronic
1172310978 20:33918244-33918266 GATGGTGATGATGATGATGATGG - Intergenic
1172870346 20:38131766-38131788 AAGGGCTATAATGATGATGATGG + Intronic
1172897997 20:38314174-38314196 GATGATAATAATGATGGTGATGG + Intronic
1172940670 20:38651874-38651896 GAGGGTAATAATGGTAATGATGG + Intergenic
1173072544 20:39783214-39783236 GATGATAATGATGATGATGATGG - Intergenic
1173726084 20:45298755-45298777 GAGGGTGATGATGATGGTGATGG - Intronic
1174043931 20:47719930-47719952 AAAGATAATAATGATAATGATGG - Intronic
1174086404 20:48011212-48011234 GAGGGTGATATTGATGATGGTGG - Intergenic
1174310492 20:49649734-49649756 CTGAGTAATAATTAGGATGAGGG - Intronic
1174773151 20:53320096-53320118 AACGATGATAATGATGATGATGG - Intronic
1174792033 20:53487874-53487896 CAAGATAATGATGATGATCAAGG - Exonic
1174846443 20:53947934-53947956 CAGGGTTAGCATGAAGATGAAGG - Intronic
1175127212 20:56761424-56761446 AATGGTAGTGATGATGATGATGG + Intergenic
1175127213 20:56761442-56761464 GATGGTGATAATGATTATGATGG + Intergenic
1175486343 20:59349390-59349412 GATGGTGATAATGATAATGATGG + Intergenic
1175574091 20:60047493-60047515 TATGATAATAATAATGATGATGG + Intergenic
1175671476 20:60906827-60906849 GAGGCTAATAATGATGAGGATGG + Intergenic
1175674460 20:60934784-60934806 CAGGGTTATTGTGATGATCAAGG - Intergenic
1175799812 20:61795089-61795111 GATGGTAATGATGGTGATGATGG + Intronic
1176908285 21:14531124-14531146 AAAGGTAATATTGAAGATGATGG + Intronic
1176961605 21:15165061-15165083 AAGGTTAATAATGAGCATGATGG + Intergenic
1177047237 21:16185490-16185512 CAGGGTAAGAGTGATGTTTAGGG - Intergenic
1178340783 21:31784319-31784341 GATGGTGATAATGGTGATGATGG - Intergenic
1178341118 21:31785904-31785926 GATGGTAATGATGATGATGGTGG - Intergenic
1179069619 21:38059593-38059615 AATGGTAATAGTGATGGTGATGG + Intronic
1181532605 22:23525477-23525499 CAGGGTGATAATAATGATGGTGG + Intergenic
1181879880 22:25969933-25969955 GATGATAATGATGATGATGATGG - Intronic
1181895534 22:26104418-26104440 GATGGTGATAATGAAGATGATGG + Intergenic
1182006838 22:26967523-26967545 AATGGTGATAATGGTGATGATGG + Intergenic
1182057360 22:27370238-27370260 CAGGGTAACAATTATTTTGAGGG - Intergenic
1182111296 22:27725622-27725644 AATGGTAATAGTGATGATGATGG - Intergenic
1183009181 22:34930892-34930914 GATGGTGATAATGATGATAATGG - Intergenic
1183092671 22:35533594-35533616 AATGGTGATAATGATGATGATGG + Intergenic
1183095171 22:35547541-35547563 CATGGTCATAGTGATGGTGATGG + Intronic
1183268136 22:36843494-36843516 CATGGTGGTGATGATGATGATGG + Intergenic
1183494337 22:38133869-38133891 CAAGATGATGATGATGATGATGG - Intronic
1183530491 22:38350878-38350900 GATGGTGATGATGATGATGACGG + Intronic
1184263677 22:43334547-43334569 GATGGTGATATTGATGATGATGG - Intronic
1184263832 22:43335798-43335820 GATGGTGATGATGATGATGATGG + Intronic
1184292324 22:43504073-43504095 GATAGTAGTAATGATGATGATGG + Intronic
1184292406 22:43504907-43504929 CATGGTGATAGTGATGATGATGG + Intronic
1184292413 22:43504973-43504995 AAAGGTAGTGATGATGATGACGG + Intronic
1184436337 22:44480024-44480046 TAGCATAATGATGATGATGATGG - Intergenic
1184534970 22:45080339-45080361 GATGATAATGATGATGATGATGG - Intergenic
1184666833 22:45993748-45993770 GATGGTGATGATGATGATGATGG + Intergenic
1184833964 22:47009705-47009727 GATGGTGATAGTGATGATGATGG - Intronic
1184870775 22:47237002-47237024 GATGGTAATGATGATGGTGATGG + Intergenic
1184927622 22:47654567-47654589 GATGGTAGTGATGATGATGATGG + Intergenic
1185060716 22:48605227-48605249 GATGGTAATGATGGTGATGATGG + Intronic
1185136149 22:49073867-49073889 AATGGTAATCATGGTGATGATGG - Intergenic
1185136178 22:49074139-49074161 AATGGTAATCATGGTGATGATGG - Intergenic
1185154817 22:49187008-49187030 CAGTGTAATCATCATGATCACGG + Intergenic
949872438 3:8600586-8600608 GATGGTGATAATGATGATGGTGG - Intergenic
949929445 3:9067150-9067172 AGGGATAATAATGATGATGATGG - Intronic
950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG + Intronic
951285526 3:20808449-20808471 CATGATAATTATGATAATGATGG + Intergenic
951451640 3:22846445-22846467 TGGGGTGATGATGATGATGATGG + Intergenic
951918340 3:27825474-27825496 CTGGATAATAATAATGATAATGG + Intergenic
953142534 3:40242285-40242307 GAGGATAATGATGATGATGGTGG - Intronic
953142535 3:40242288-40242310 GAGGAGGATAATGATGATGATGG - Intronic
955102509 3:55864864-55864886 GATGGTGATAATGATGATGATGG - Intronic
955178249 3:56638885-56638907 AAGGGTCATACTGGTGATGATGG + Intronic
955633960 3:61005395-61005417 CAGGATGATAATGATTGTGATGG + Intronic
955913344 3:63881041-63881063 AATGGGAATAATGATGATAATGG + Intronic
956145381 3:66186465-66186487 CAGGGTCAGAGTGATGATTAAGG - Intronic
956145416 3:66186698-66186720 CAGGGTAAGAGTAAGGATGAAGG - Intronic
956365436 3:68496906-68496928 AATAGTAATGATGATGATGATGG - Intronic
956516072 3:70049661-70049683 AATGATAATGATGATGATGATGG - Intergenic
956524731 3:70145073-70145095 CTGGGTAAGAATGAAGAAGAAGG - Intergenic
960799660 3:121525418-121525440 CAAGGTAAAGATGATGAAGATGG - Intronic
961526267 3:127500080-127500102 GATGGTGATATTGATGATGATGG - Intergenic
961903328 3:130236633-130236655 GGTGGTAATAATGAAGATGATGG - Intergenic
961924254 3:130460663-130460685 CATGGTAGTAGTGAAGATGATGG + Intronic
962166496 3:133054727-133054749 CAGGGTAAGAATGATGGTCCTGG + Intronic
962864698 3:139438179-139438201 GATGATAATATTGATGATGATGG + Intergenic
963112626 3:141699792-141699814 CAGGGTAAGAATGAGTAGGAGGG + Intergenic
963248080 3:143081318-143081340 CAATGTAGTGATGATGATGATGG - Intergenic
963299442 3:143582432-143582454 CAGCAGAATGATGATGATGACGG - Intronic
964408267 3:156372529-156372551 CCAGGTAATACTGATGATGCTGG + Intronic
964825676 3:160825014-160825036 CAGTGTCATAAATATGATGATGG + Intronic
965424247 3:168501555-168501577 CAAGGAGAGAATGATGATGATGG + Intergenic
966428463 3:179806634-179806656 AATAGTAATAAGGATGATGATGG + Intronic
967897364 3:194408890-194408912 CGGGGAGATGATGATGATGAAGG + Intronic
968590049 4:1453434-1453456 AATGGTAATGATGATGGTGATGG - Intergenic
968592917 4:1468351-1468373 GATGGTGATGATGATGATGATGG + Intergenic
969104263 4:4793276-4793298 CAAAGTAATAATGATGGTGCTGG + Intergenic
969234543 4:5856383-5856405 GATGGTAATGATGGTGATGATGG - Intronic
969234561 4:5856534-5856556 AATGGTAATGATGATGATGATGG - Intronic
969234580 4:5856673-5856695 AATGGTAATGATGATGATGATGG - Intronic
969234610 4:5856888-5856910 AATGTTAGTAATGATGATGATGG - Intronic
969256227 4:6003448-6003470 GAGGGTGGTAATGGTGATGATGG + Intergenic
969256353 4:6004535-6004557 GAGGGTGGTAATGGTGATGATGG + Intergenic
969485306 4:7469134-7469156 CATGGTGGTGATGATGATGATGG + Intronic
969585774 4:8090637-8090659 CATGGTGACAATGATGATCACGG - Intronic
969628514 4:8321284-8321306 GAGGGTAATGGTGATGATGATGG - Intergenic
969628536 4:8321488-8321510 GAGGGTAATGTTGATCATGATGG - Intergenic
969710827 4:8842136-8842158 TATGTTAATGATGATGATGATGG + Intergenic
969835646 4:9838225-9838247 GATGGTAATGATGATGACGATGG + Intronic
970161907 4:13197518-13197540 CAGGATTATAAAAATGATGAAGG - Intergenic
970326826 4:14934485-14934507 CATGAAAATAATGAGGATGAAGG - Intergenic
970497392 4:16640497-16640519 CTGAGAAATAATGATGAAGAAGG - Intronic
970498961 4:16657330-16657352 CAGGGTAATAATGATGATGATGG - Intronic
970777128 4:19688484-19688506 CAGTCAAATAAAGATGATGAAGG + Intergenic
970907142 4:21229152-21229174 CTGGGAAATGATGATGATGTGGG - Intronic
970926553 4:21459058-21459080 GATGATGATAATGATGATGATGG - Intronic
971166284 4:24187154-24187176 CAAGGTGATGATGATGATGGCGG + Intergenic
971365386 4:25972816-25972838 CTGGCAGATAATGATGATGATGG - Intergenic
971648434 4:29238666-29238688 GATGATAATTATGATGATGATGG + Intergenic
972126417 4:35772212-35772234 GAGCTTAATAATGCTGATGATGG - Intergenic
972753527 4:42018855-42018877 GAGGATGATAATGATAATGATGG - Intronic
973123113 4:46547605-46547627 TTGGATAATAATGGTGATGATGG - Intergenic
973228995 4:47820262-47820284 GAGGGAAATAATGAGGGTGAGGG + Intronic
975402502 4:73953832-73953854 CAGGGTAACAGTGATGTTCAGGG - Intergenic
975441235 4:74413357-74413379 CATGGTGATGATGATGGTGATGG + Intergenic
976792015 4:88889034-88889056 CAGGGGAATAATGACAAGGAGGG + Intronic
977113506 4:92990970-92990992 GTGGGCAATAATGATGATAATGG + Intronic
977152759 4:93533727-93533749 CAGGGTAATAATGGTGGAGGTGG - Intronic
977679544 4:99784254-99784276 CAGGGTCGTTATGATGAAGATGG - Intergenic
978076581 4:104538721-104538743 CAAGGGAATGATTATGATGATGG + Intergenic
978609293 4:110519639-110519661 TTGAATAATAATGATGATGATGG - Intronic
978834782 4:113136222-113136244 CAGGGTAACAATCATCCTGATGG + Intronic
978911612 4:114070315-114070337 CTGGGTAATAATAAAGAAGAAGG + Intergenic
979023253 4:115530413-115530435 GAGGGGAATAATAATGATGATGG + Intergenic
979303118 4:119110209-119110231 GATGATAATGATGATGATGATGG - Intergenic
979550184 4:121981957-121981979 CGGGACAAGAATGATGATGAAGG - Intergenic
979762868 4:124428256-124428278 GAGGGTGACAATGCTGATGATGG + Intergenic
982450637 4:155548489-155548511 CAGTAGAATAATCATGATGAAGG + Intergenic
982523551 4:156450209-156450231 TAGGGAAATAAAGATGATTATGG - Intergenic
982607681 4:157535850-157535872 CAGGGTACTAATAATCATGGTGG - Intergenic
982761175 4:159285788-159285810 CAAGATGACAATGATGATGAGGG - Intronic
983073921 4:163302139-163302161 CAGGATTATAATGAGGTTGAAGG + Intergenic
983497674 4:168461545-168461567 AATGGTAACAATGATAATGATGG - Intronic
984077012 4:175195843-175195865 GATGGTACTAATGATAATGATGG + Intergenic
984532996 4:180940540-180940562 CAGGGTAGTTATGATTGTGAGGG + Intergenic
984621124 4:181953276-181953298 CATGATGATGATGATGATGATGG - Intergenic
985034745 4:185827123-185827145 AATGGTGATGATGATGATGATGG - Intronic
985034750 4:185827186-185827208 GATGGTGATGATGATGATGATGG - Intronic
985034789 4:185827908-185827930 GATGGTGATGATGATGATGATGG - Intronic
985034793 4:185827979-185828001 GATGGTGATGATGATGATGATGG - Intronic
986384138 5:7215120-7215142 TAGGATGATAATGATGTTGATGG - Intergenic
986436746 5:7741611-7741633 GATGGTGATAATGATGGTGATGG - Intronic
986736301 5:10670048-10670070 GATGGTGATAATGATGATGAAGG + Intergenic
986736306 5:10670093-10670115 AATGGTAATGATGATGGTGATGG + Intergenic
988940996 5:36147362-36147384 AATGATGATAATGATGATGATGG + Intronic
990079964 5:51900507-51900529 CAGGCTTATAATGAAGATAAGGG - Intergenic
990524793 5:56614389-56614411 GGTGGTGATAATGATGATGATGG - Intergenic
990856590 5:60274152-60274174 CAGGCAAATATTGATGATGGGGG + Intronic
991080152 5:62589680-62589702 CTGGGCAATAATGATGCTGAAGG + Intronic
993074128 5:83205806-83205828 CAGGGTGAGAATAAGGATGAGGG + Intronic
993936379 5:94009353-94009375 CAAAGAAATAATGCTGATGAGGG - Intronic
996251878 5:121345217-121345239 AATGGTATTGATGATGATGATGG - Intergenic
997453189 5:133999828-133999850 GATGGCAATGATGATGATGATGG - Intronic
998264235 5:140655456-140655478 TAAGGTAATATTGATGATGATGG - Intronic
998613249 5:143712149-143712171 CAGGGTAATAAGGAAGCAGAGGG - Intergenic
998625796 5:143844266-143844288 CAAGGGAATTATTATGATGATGG - Intergenic
998760408 5:145425962-145425984 AATAATAATAATGATGATGAGGG - Intergenic
999010810 5:148037663-148037685 GATGGTGATAATGAGGATGATGG - Intronic
999078318 5:148818491-148818513 GATGATGATAATGATGATGATGG + Intergenic
999190266 5:149742009-149742031 GATGGTGATGATGATGATGATGG + Intronic
999683047 5:154077518-154077540 AATGGTAATAATGAAAATGATGG + Intronic
1000581884 5:163045039-163045061 CAGGGTAATAATGACTTTGTAGG - Intergenic
1000780414 5:165473491-165473513 AAGGCTGATAATGATGATGAAGG - Intergenic
1000983775 5:167845192-167845214 AGGGGTAATAATGATGGTGAGGG - Intronic
1001300641 5:170531205-170531227 GAGGGGAATTATTATGATGATGG + Intronic
1001302938 5:170550584-170550606 GATGGCAATGATGATGATGATGG + Intronic
1001313043 5:170624817-170624839 CAGGGTAAGGATGGTGAGGAAGG - Intronic
1001427384 5:171632132-171632154 GAGGGAAATCATGATGATGATGG - Intergenic
1001780421 5:174364099-174364121 GATGGTGATGATGATGATGATGG + Intergenic
1003676811 6:8212217-8212239 CAGAGTGACAATGATGATTATGG + Intergenic
1004080547 6:12388080-12388102 GACGCTAATAATGATGACGAAGG + Intergenic
1004084138 6:12427876-12427898 CAAGGTAATATTGATGCTGCTGG - Intergenic
1004185391 6:13416991-13417013 TATGATAAGAATGATGATGATGG - Intronic
1004210237 6:13633406-13633428 TAAGGTAATGACGATGATGATGG + Intronic
1004295932 6:14410564-14410586 GAGGATGATAATGATGGTGATGG - Intergenic
1005225328 6:23635894-23635916 CATTGTAATAATGATGAGAAAGG + Intergenic
1005604064 6:27457670-27457692 GATGGTAATGATGACGATGAAGG - Intronic
1006225533 6:32533838-32533860 GAGGGTAAGGATGATAATGAGGG - Intergenic
1006572061 6:35013753-35013775 CAGAGTTATAAGGATGGTGAAGG + Intronic
1007634989 6:43294233-43294255 GATGGTAATAATGATGGTGGTGG - Intergenic
1007684516 6:43657288-43657310 GAGGGATCTAATGATGATGATGG + Intronic
1007969869 6:46040552-46040574 AAAGGTGATAATGATGCTGATGG + Intronic
1008039271 6:46778749-46778771 GAGGATAATGATGATGGTGATGG + Intergenic
1008845606 6:55959710-55959732 CTGGCTAATAATGATAATAATGG + Intergenic
1008900271 6:56606196-56606218 CAGGATGACGATGATGATGATGG - Intronic
1008974243 6:57405906-57405928 CTGGGTGATGATGATGATGGTGG - Intronic
1009883446 6:69597528-69597550 CAGGGTAATTATTTTGTTGAAGG - Intergenic
1010488195 6:76441645-76441667 CATGATTCTAATGATGATGATGG + Intergenic
1011224332 6:85090423-85090445 GATGATAATGATGATGATGATGG - Intergenic
1011859489 6:91737369-91737391 AAGGGTGATAAGGATGAAGACGG - Intergenic
1012272978 6:97237504-97237526 CAAGGTAAGTATGATGATGTAGG - Intronic
1012503213 6:99913855-99913877 CATGATAATGAAGATGATGAGGG + Intergenic
1012850504 6:104441059-104441081 GATGATGATAATGATGATGACGG - Intergenic
1013767165 6:113588573-113588595 GATGGTGATGATGATGATGATGG + Intergenic
1014042623 6:116847562-116847584 CAGGATAATAGTGTTAATGAAGG - Intergenic
1014908300 6:127057638-127057660 CGTGATAATAGTGATGATGAAGG - Intergenic
1015264393 6:131276029-131276051 CAGTGTAAAAATGATGAGGGTGG + Intronic
1017026414 6:150185239-150185261 CAGGGTAGTTGTGAGGATGAAGG + Intronic
1017600464 6:156075133-156075155 CAGTGAATTAATGATGAAGAGGG - Intergenic
1017720186 6:157238399-157238421 GAGGGTGATGGTGATGATGATGG + Intergenic
1017750122 6:157483538-157483560 CACAGTAATGATGATGATGATGG + Intronic
1018102864 6:160456805-160456827 AGTGGTAGTAATGATGATGATGG + Intergenic
1018102876 6:160456876-160456898 AATGGTAGTAATGATGATGACGG + Intergenic
1018110822 6:160535443-160535465 AGTGGTAGTAATGATGATGATGG + Intronic
1018124521 6:160669010-160669032 CTGAGTAGTAATGATGGTGATGG + Intergenic
1018228438 6:161653473-161653495 GAGGCTAATACTGATGATGGCGG - Intronic
1018427450 6:163696199-163696221 CTGGGTAATGATGACGTTGATGG + Intergenic
1019138033 6:169923611-169923633 GATGGTGATAATGATGGTGATGG - Intergenic
1019138044 6:169923731-169923753 GATGGTGATAATGATGGTGATGG - Intergenic
1019180392 6:170183781-170183803 GATGGTGATGATGATGATGATGG + Intergenic
1019288895 7:237694-237716 AATGGTGATAATGATGATAATGG + Intronic
1019288899 7:237741-237763 GATGATGATAATGATGATGATGG + Intronic
1019353503 7:566721-566743 GATGGTGATGATGATGATGATGG - Intronic
1019490237 7:1309548-1309570 GATGGTGATAATGATGGTGATGG + Intergenic
1019765980 7:2850658-2850680 GATGGTGATAATGATGGTGATGG - Intergenic
1019820027 7:3235534-3235556 CGTGGTAATGATGGTGATGATGG + Intergenic
1019824295 7:3270843-3270865 GATGGTGATAATGATGATGGTGG + Intergenic
1020504344 7:8964627-8964649 TAGGGTAAGACTGATGATCAGGG - Intergenic
1021006005 7:15396002-15396024 TAGGGAGATGATGATGATGATGG - Intronic
1021371601 7:19855518-19855540 GATGATGATAATGATGATGATGG - Intergenic
1021562987 7:21987308-21987330 CAAGGTAATTTTGATGATGTCGG - Intergenic
1022068880 7:26890334-26890356 CAGGGTAATAATGTTAGAGAAGG - Intronic
1022793895 7:33716677-33716699 GATGGTGAAAATGATGATGAAGG - Intergenic
1023882560 7:44328548-44328570 GGTGGTAATAATGATAATGATGG + Intronic
1024217571 7:47260537-47260559 AATGGTGATAATGATGATGGTGG + Intergenic
1026009579 7:66626459-66626481 CAGGATAATTATGATGCTGCTGG - Intergenic
1026113287 7:67475564-67475586 GATGATAATCATGATGATGATGG + Intergenic
1026223674 7:68422360-68422382 CAGGCTAAAAAAGATGAGGAAGG - Intergenic
1026376714 7:69758986-69759008 GAGGATAATAATAATTATGATGG + Intronic
1026450140 7:70521495-70521517 CAGGGTTTTGATGATGTTGATGG + Intronic
1027609634 7:80344208-80344230 TATAATAATAATGATGATGATGG - Intergenic
1028498244 7:91486961-91486983 CATGATAATAGTAATGATGAAGG - Intergenic
1028615494 7:92762140-92762162 CAGAGTAATAATCATAATGGGGG + Intronic
1028883951 7:95910896-95910918 CATGATGATAAAGATGATGATGG - Intronic
1030328617 7:108248959-108248981 CAGGATGATGATGATGATGATGG + Intronic
1030788190 7:113688538-113688560 CAGTGTCATAATGAAGTTGAAGG - Intergenic
1031626470 7:123998250-123998272 CAAGGCACTAATTATGATGATGG + Intergenic
1031846942 7:126816627-126816649 CATGATGATGATGATGATGATGG + Intronic
1032885377 7:136132725-136132747 TAGAATAATCATGATGATGAAGG - Intergenic
1033271619 7:139937658-139937680 GATGGTAATAATAAGGATGATGG - Intronic
1033304148 7:140212171-140212193 GATGGTGATGATGATGATGATGG + Intergenic
1034679067 7:152914530-152914552 AATGGTAATAGTGATGATGTTGG - Intergenic
1034826148 7:154265138-154265160 GATGGTGATAATGATGGTGATGG + Intronic
1034826156 7:154265270-154265292 GATGGTCATAATGATGATGATGG + Intronic
1035041760 7:155934025-155934047 GATGGTGATGATGATGATGATGG - Intergenic
1035041763 7:155934055-155934077 GATGGTGATGATGATGATGATGG - Intergenic
1035041770 7:155934120-155934142 GATGGTGATAATGATGATGATGG - Intergenic
1035041773 7:155934150-155934172 GATGGTGATAATGATGATGATGG - Intergenic
1035041776 7:155934180-155934202 GATGGTGATAATGATGATGATGG - Intergenic
1035041778 7:155934207-155934229 GATGGTGATAATGATGATGGTGG - Intergenic
1035310723 7:157966525-157966547 GATGGTGATAATGAAGATGATGG - Intronic
1035310725 7:157966570-157966592 GATGGTAATGATGAAGATGATGG - Intronic
1035310744 7:157966804-157966826 GATGGTGATAATGAAGATGATGG - Intronic
1035381108 7:158441528-158441550 GATGGTAATAGTGATGGTGATGG + Intronic
1035384755 7:158463303-158463325 GATGATAGTAATGATGATGATGG - Intronic
1035639628 8:1174477-1174499 GATGGTAATGATGATGATGATGG - Intergenic
1035639649 8:1174710-1174732 CATGGTAATGATGGTGGTGATGG - Intergenic
1035659641 8:1337332-1337354 GATGGTAATAGTGAGGATGATGG + Intergenic
1035987195 8:4447295-4447317 CATTGTAATAATAATGATCACGG - Intronic
1036237862 8:7056932-7056954 CAAGGTGTTAATGATGATAAGGG + Intergenic
1036704011 8:11033010-11033032 CAGGATGGTAAGGATGATGATGG + Intronic
1036704019 8:11033120-11033142 CACGATGGTAATGATGATGATGG + Intronic
1036704055 8:11033438-11033460 GATGGTCGTAATGATGATGATGG + Intronic
1037904751 8:22709576-22709598 CAGGGTGATGATATTGATGATGG - Intergenic
1038298306 8:26317231-26317253 CAGGGTAGTCAAGATTATGAAGG - Intronic
1038921569 8:32090879-32090901 TTTGGTCATAATGATGATGATGG - Intronic
1039237476 8:35517697-35517719 CAGGGTTATACTGGTAATGATGG + Intronic
1039922102 8:41900528-41900550 GATGGGAATGATGATGATGATGG - Intergenic
1039922104 8:41900546-41900568 GATGGTGATGATGATGATGATGG - Intergenic
1042660665 8:71150708-71150730 GATGATAATAATGATGATGATGG - Intergenic
1043125436 8:76388712-76388734 AGGTGTAATAATGATGATGAAGG - Intergenic
1044129956 8:88509541-88509563 CAGGCTAATATTGCTGTTGATGG + Intergenic
1044452124 8:92348938-92348960 CAGACTAATAATCATGTTGAGGG - Intergenic
1044630430 8:94273029-94273051 TAGGGTAATAATTATGATGATGG - Intergenic
1045176553 8:99731314-99731336 CAGGGTTATAGTGAAGATAATGG - Intronic
1045713860 8:105018680-105018702 AATAGTGATAATGATGATGACGG - Intronic
1045887357 8:107114336-107114358 CAGGGCTATACTGAGGATGATGG + Intergenic
1046911240 8:119630083-119630105 TAGGGAAGAAATGATGATGAAGG - Intronic
1046970775 8:120220821-120220843 GATGGTGATAATGATAATGATGG + Intronic
1047058035 8:121189829-121189851 CAGAGAAATGCTGATGATGATGG - Intergenic
1047361058 8:124169815-124169837 CAGGGTAGTGATAATGGTGATGG + Intergenic
1047368446 8:124234536-124234558 CAGGGTAATAAGGTGGGTGAGGG - Intergenic
1047633038 8:126728965-126728987 AAGTGTGATAATGATGATGATGG - Intergenic
1047799918 8:128298184-128298206 CAGGGTATTAATTAGGAAGAAGG + Intergenic
1048141436 8:131798463-131798485 GATGTTGATAATGATGATGACGG + Intergenic
1048185556 8:132237242-132237264 AAGAGTAATGATGATGATGATGG + Intronic
1048221478 8:132546176-132546198 AATGATAATGATGATGATGATGG - Intergenic
1049282279 8:141755983-141756005 CTGTGAAATGATGATGATGATGG + Intergenic
1049298792 8:141858447-141858469 GATGGTAATGGTGATGATGATGG - Intergenic
1049428410 8:142548068-142548090 GGTGGTGATAATGATGATGATGG + Intergenic
1049498775 8:142949973-142949995 AACGGTGATAATGATGGTGATGG + Intergenic
1052007827 9:23371473-23371495 CAGGCTAATAACACTGATGACGG + Intergenic
1054360590 9:64111530-64111552 CAGGGTAAGAATTGTGATAAAGG + Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1055074414 9:72198704-72198726 CAGGCTGATGATGGTGATGATGG + Intronic
1055163920 9:73167372-73167394 GAGGTGAAGAATGATGATGAGGG + Intronic
1056335610 9:85565708-85565730 GAGGGTCATAATGATGAATATGG - Intronic
1057265530 9:93614889-93614911 GATGGTAATGATGGTGATGATGG + Intronic
1057265542 9:93615030-93615052 GATGGTGATAGTGATGATGATGG + Intronic
1057265550 9:93615093-93615115 GATGGTAATAAAGATGGTGATGG + Intronic
1057267081 9:93624739-93624761 GATGGTAATGATAATGATGATGG + Intronic
1059322574 9:113481123-113481145 CTGAGTCTTAATGATGATGAAGG - Intronic
1059407035 9:114107793-114107815 CGTGGTAATAGTGATGATGGTGG - Intergenic
1059436235 9:114278208-114278230 GACGATAATAATGATGGTGATGG + Intronic
1059450657 9:114369849-114369871 AATGGTAAAAATGGTGATGATGG - Intronic
1059612187 9:115910527-115910549 CATGATGATGATGATGATGATGG - Intergenic
1059659954 9:116390836-116390858 CAGTGAGGTAATGATGATGATGG - Intronic
1060022200 9:120141343-120141365 GATGGTGATGATGATGATGATGG + Intergenic
1060388820 9:123260173-123260195 CAGGGGAATAATGATGTTGCAGG + Intronic
1060939939 9:127537472-127537494 CAAAATAATAATGATAATGATGG + Intronic
1061845007 9:133382751-133382773 GATGGTAATGATGGTGATGATGG + Intronic
1062098326 9:134714296-134714318 GATGGTCATAATGATGCTGATGG + Intronic
1185683065 X:1904711-1904733 CATGATAATGATGGTGATGATGG + Intergenic
1185683076 X:1904863-1904885 CATGATAATGATGTTGATGATGG + Intergenic
1185683086 X:1904995-1905017 GGTGGTGATAATGATGATGATGG + Intergenic
1185683095 X:1905070-1905092 GGTGGTAATGATGATGATGAGGG + Intergenic
1185689003 X:2137608-2137630 GATGGTGATCATGATGATGATGG - Intergenic
1185689020 X:2137753-2137775 GATGGTGATAATGATGATGATGG - Intergenic
1185689053 X:2138052-2138074 GATGATGATAATGATGATGATGG - Intergenic
1185721232 X:2383402-2383424 GATGGTGATGATGATGATGATGG - Intronic
1185739637 X:2520910-2520932 CTTGGTGATAATAATGATGATGG - Intergenic
1185930141 X:4193642-4193664 GATGGTAATAATGTTGATGATGG + Intergenic
1185976869 X:4731126-4731148 GATGTTGATAATGATGATGACGG - Intergenic
1186002730 X:5031876-5031898 GACGGTGATGATGATGATGATGG - Intergenic
1186002744 X:5032037-5032059 GATGGTAATGATGGTGATGATGG - Intergenic
1186010183 X:5122336-5122358 GATGGTGATAATGGTGATGATGG + Intergenic
1186098852 X:6133149-6133171 GATGGTGATAATGATGATGGTGG - Intronic
1186131627 X:6472860-6472882 AATGGTGATGATGATGATGATGG + Intergenic
1186131629 X:6472902-6472924 GATGGTGATAATAATGATGATGG + Intergenic
1186131632 X:6472938-6472960 GATGGTAGTAATGATGGTGATGG + Intergenic
1186131639 X:6473017-6473039 GATGGCAATAATGATGATAATGG + Intergenic
1186131689 X:6473521-6473543 GATGGTAATTATTATGATGATGG + Intergenic
1186214554 X:7284951-7284973 GATGGTGATGATGATGATGATGG + Intronic
1186359126 X:8821148-8821170 GATGGTGATGATGATGATGATGG - Intergenic
1187496519 X:19800603-19800625 GAGGGTAATATTGGTGATGGTGG - Intronic
1188085265 X:25895384-25895406 CAGGGTAATTGTGATTATCAAGG + Intergenic
1188705209 X:33319626-33319648 AAAGGTGATAATGATGATAAAGG - Intronic
1188856118 X:35198053-35198075 TATGGTGATGATGATGATGATGG - Intergenic
1189927456 X:45971654-45971676 AAAGGTATTAATGATGGTGATGG - Intergenic
1192139162 X:68632908-68632930 CTGGGTAATAATAATAATAATGG - Intergenic
1192184488 X:68937574-68937596 AGAGGTAGTAATGATGATGAAGG + Intergenic
1192192809 X:69003086-69003108 CATGGTAATAATATTGATGTGGG - Intergenic
1192950408 X:76010454-76010476 TATGGTAATGATAATGATGATGG - Intergenic
1193248390 X:79258523-79258545 GATGGTGATGATGATGATGATGG + Intergenic
1194976993 X:100406543-100406565 CAGGGCAATAATGAAAATCAAGG + Exonic
1195836397 X:109119421-109119443 CAGGAAAATAATTATGATCAGGG + Intergenic
1197302071 X:124793381-124793403 CTGGAGAATAATTATGATGATGG - Intronic
1198144419 X:133840637-133840659 CATGGTGATGATGGTGATGATGG - Intronic
1198450568 X:136763522-136763544 TAGGGTTATAAAGATGATCACGG + Intronic
1198701648 X:139403241-139403263 GATGGTGATAATGATGATAATGG + Intergenic
1200089819 X:153629329-153629351 CAGGATAAAAATGAGGCTGAAGG - Intergenic
1201143524 Y:11048062-11048084 GATGGTGATGATGATGATGATGG + Intergenic
1201614111 Y:15876995-15877017 GATGGTGATGATGATGATGATGG + Intergenic
1201616257 Y:15902782-15902804 GATGGTGATGATGATGATGATGG - Intergenic
1201669564 Y:16503188-16503210 GATGTTAATAATGGTGATGATGG - Intergenic
1201699965 Y:16869912-16869934 GATGGTAATAATGATGGTAATGG + Intergenic
1201709986 Y:16980370-16980392 GATGATAATGATGATGATGATGG + Intergenic
1201947199 Y:19524010-19524032 CAGTGTAATAATGATGTGGAAGG + Intergenic
1202390345 Y:24363687-24363709 GATGGCAATGATGATGATGATGG - Intergenic
1202480439 Y:25306429-25306451 GATGGCAATGATGATGATGATGG + Intergenic