ID: 970501684

View in Genome Browser
Species Human (GRCh38)
Location 4:16683840-16683862
Sequence GACCCAGCTCTTCCTTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 445}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970501683_970501684 -6 Left 970501683 4:16683823-16683845 CCTTGCAGGGATGCAAAGACCCA 0: 1
1: 0
2: 3
3: 16
4: 234
Right 970501684 4:16683840-16683862 GACCCAGCTCTTCCTTCCTGTGG 0: 1
1: 0
2: 6
3: 54
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970501684 Original CRISPR GACCCAGCTCTTCCTTCCTG TGG Intronic
900147026 1:1162868-1162890 GAGCCGGCTCTTCCCTCCCGAGG + Intergenic
900565045 1:3328034-3328056 CCCCCAGGTCTTCCCTCCTGTGG - Intronic
900620081 1:3582705-3582727 GACTCAGCTCTCCCTGCTTGGGG + Intronic
900924966 1:5699240-5699262 GAGGCAGCTCTGCCTGCCTGGGG - Intergenic
901903648 1:12389768-12389790 GACCCAAACCTTCCTTCCTGAGG + Intronic
901961275 1:12828433-12828455 GACCCAGCTGTTCCTTCAGTTGG + Intronic
901967868 1:12883038-12883060 GACCCAGCTGTTCCTTCAGTTGG + Intronic
901983266 1:13053303-13053325 GACCCAGCTGTTCCTTCAGTTGG + Intronic
901985743 1:13074028-13074050 GACCCAGCTGTTCCTTCGGTTGG - Intronic
901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG + Intergenic
901998823 1:13175615-13175637 GACCCAGCTGTTCCTTCAGTTGG - Intergenic
902017308 1:13318742-13318764 GACCCAGCTGTTCCTTCAGTTGG - Intronic
902030216 1:13416683-13416705 GACCCAGCTGTTCCTTCTGTTGG - Intronic
902979945 1:20115450-20115472 GGGCCAGATCTCCCTTCCTGGGG + Intronic
903335601 1:22622190-22622212 GACCCAGCTCTTTCCTCCTCAGG - Intergenic
904358415 1:29956634-29956656 GACCAATCTCTTTCTTCCTTGGG - Intergenic
904385238 1:30137095-30137117 AATCCAGCTGTACCTTCCTGAGG + Intergenic
904425161 1:30418132-30418154 AACCCAGCTCTGCCTGGCTGGGG - Intergenic
904578021 1:31518013-31518035 GACCCAAACCTTCATTCCTGAGG - Intergenic
904610806 1:31725272-31725294 GCCAGAGCTCTTCCTTCCTTGGG + Intergenic
904874401 1:33643155-33643177 GACCCAGCCCTGCCTCCCTGTGG + Intronic
904877013 1:33663124-33663146 GACTCAGCCCTTCTTTCCAGGGG + Intronic
905515427 1:38558834-38558856 TACCCAGGGCTTCTTTCCTGGGG + Intergenic
906422259 1:45679478-45679500 GACCCAGCTCTAGCTGCCAGGGG + Intronic
906540228 1:46579724-46579746 GATCCAGCTCTTCTTCCATGTGG + Intronic
906705905 1:47895156-47895178 AACTCAGGTCTTCCTCCCTGTGG - Intronic
906930652 1:50166605-50166627 GACCCAAACCTTCATTCCTGAGG + Intronic
909548673 1:76875263-76875285 GACCCAAGCCTTCATTCCTGAGG + Intronic
910948484 1:92618626-92618648 GACCCAAACCTTCATTCCTGAGG - Intronic
911355659 1:96816141-96816163 AAACCAGCTCTTCCTGCCTAAGG + Intronic
911738133 1:101360014-101360036 GACCCAAACCTTCATTCCTGAGG + Intergenic
912943485 1:114065982-114066004 GACCCAAATGTTCATTCCTGAGG + Intergenic
913319794 1:117580201-117580223 GACCCTGCTCCTCCAGCCTGGGG + Intergenic
913533173 1:119747625-119747647 GACCCAGCTTCTCATTCCTGTGG + Intergenic
914447350 1:147760995-147761017 GCCCCACCGCTTCCTGCCTGTGG + Intronic
915040362 1:152963236-152963258 GCCCCAGCTCTTCATTCCCAGGG + Intergenic
915913457 1:159928283-159928305 GAGGCAGCGCTTCGTTCCTGCGG - Exonic
916322785 1:163523259-163523281 GATCCAGCTCCTCCTTCTGGGGG - Intergenic
916365844 1:164026960-164026982 GACTCAAACCTTCCTTCCTGAGG + Intergenic
917462968 1:175248074-175248096 GACCCAAACCTTCATTCCTGAGG - Intergenic
918774760 1:188612655-188612677 GACCCAAACCTTCATTCCTGAGG - Intergenic
919065820 1:192691876-192691898 GAACCAGTTTTTACTTCCTGGGG + Intergenic
921936241 1:220799673-220799695 AACCCAGCCCCTCCTTGCTGTGG - Intronic
922100642 1:222474785-222474807 GACCAAGCTCTCCCTCCCAGTGG - Intergenic
922348910 1:224719978-224720000 GACACAGCCCTCCCTCCCTGTGG - Intronic
922733984 1:227969890-227969912 GACCAAGCTCTCCCTCCCAGTGG + Intergenic
922734140 1:227970592-227970614 GGCCCAGCTCTTCCTCTCGGCGG + Intergenic
923394081 1:233543514-233543536 GACCCAGCACTGCCTTGCAGGGG - Intergenic
923417482 1:233777715-233777737 CACACAGCTCTTCTTTCCTCTGG + Intergenic
923818699 1:237410226-237410248 GCCCCAGCTGTTCTTTCATGTGG + Intronic
924397503 1:243638538-243638560 GACCCAGCTTTTCATTTTTGTGG + Intronic
924691384 1:246355078-246355100 GCATCAGCTTTTCCTTCCTGTGG + Exonic
1062802626 10:391350-391372 GACCCAGGTCTTCCTTCCTCTGG - Intronic
1063420152 10:5906189-5906211 GGCCCTGCACTGCCTTCCTGAGG - Exonic
1063577521 10:7275128-7275150 GCCCCAGGTCTGCCTCCCTGCGG - Intronic
1063611289 10:7563863-7563885 GACACAGCTCTTTATTCCTGTGG - Intronic
1063788383 10:9410427-9410449 GACCCAAACCTTCGTTCCTGAGG - Intergenic
1064120647 10:12615201-12615223 GACCTGGGTCTTCCTTCCTAGGG - Intronic
1064767087 10:18686098-18686120 AACCCAACTCTTCCTTGCTTTGG + Intergenic
1065748868 10:28867274-28867296 TAGCCAGCTCCTCCTTCCTCTGG + Intronic
1067850636 10:49751713-49751735 GATCCAGTCCTGCCTTCCTGTGG + Intronic
1069408568 10:68128252-68128274 TACCCAGCTGTACATTCCTGGGG - Intronic
1069514675 10:69068246-69068268 CTGCCAGCTCTCCCTTCCTGGGG + Intergenic
1069869023 10:71521867-71521889 GGCCCAGCCTTTCCTTCCTGGGG + Intronic
1070332698 10:75429816-75429838 GTCCCAGCTCTCCCGTCCTCTGG - Intergenic
1070575152 10:77672039-77672061 GACCCAGCACTGGCCTCCTGCGG - Intergenic
1070700549 10:78598656-78598678 CTCCCGGCTGTTCCTTCCTGGGG - Intergenic
1071737343 10:88316614-88316636 GACCCAGCTATTTGTTCCAGGGG + Intronic
1073455790 10:103635962-103635984 GCCCCAGCTTTTCCCTCCCGGGG - Intronic
1073602976 10:104864820-104864842 AACCAAGCTTTTCCTGCCTGGGG + Intronic
1073656407 10:105422575-105422597 GACCCAAACCTTCATTCCTGAGG + Intergenic
1073918228 10:108430532-108430554 GACCCAAACCTTCATTCCTGAGG + Intergenic
1074243937 10:111669067-111669089 GACCCAAATCTTCATTCTTGAGG + Intergenic
1074531100 10:114299437-114299459 GATCCAGCTCTGCTTACCTGGGG - Intronic
1075551479 10:123395804-123395826 GCACCAGCTGTCCCTTCCTGGGG - Intergenic
1076138374 10:128060510-128060532 GACCCAGTTCTCCTGTCCTGGGG + Intronic
1076360079 10:129881894-129881916 GACCAAACTCTTTCTTCCTTGGG - Intronic
1076548856 10:131264367-131264389 GATCCAACCTTTCCTTCCTGTGG - Intronic
1076663225 10:132069208-132069230 ACCCCAGGTCTTCCTGCCTGAGG + Intergenic
1076739749 10:132477398-132477420 GAGGCTGCTCCTCCTTCCTGGGG + Intergenic
1076815025 10:132910338-132910360 GGCTCAGCTGCTCCTTCCTGCGG - Intronic
1077020752 11:416204-416226 GGCCCTGCTCCTGCTTCCTGCGG - Intronic
1079487781 11:20953334-20953356 GACCCATGTATTCCTTGCTGTGG + Intronic
1080052379 11:27870665-27870687 AAGCCAGCTTTTCCTTCCTCTGG - Intergenic
1080269367 11:30434455-30434477 GATCCAGTTGTTACTTCCTGGGG - Intronic
1080403542 11:31958379-31958401 GACACAGCTCTTCCCTCCCCAGG - Intronic
1080484799 11:32694440-32694462 TTCCATGCTCTTCCTTCCTGGGG + Intronic
1081618392 11:44603929-44603951 AACCAAGCTCCTCCTTCCTCAGG + Intronic
1082026054 11:47573112-47573134 CACCCGGCTTTGCCTTCCTGAGG - Exonic
1082260267 11:50072665-50072687 GGCCCAGCTCTTCCTCCTGGTGG - Intergenic
1082260710 11:50074646-50074668 GGCCCAGCTCTTCCTCCCAGCGG - Intergenic
1082985073 11:59161397-59161419 GACCCAAATCTTCATTTCTGAGG - Intergenic
1083199003 11:61108366-61108388 GAATCTGCTGTTCCTTCCTGCGG + Intronic
1083655154 11:64225946-64225968 CACCCAGCGCTCACTTCCTGAGG - Intronic
1085684929 11:78612753-78612775 GACCCAGACCTTCATTCCTAAGG - Intergenic
1087102848 11:94381658-94381680 GTGCCAGCTGTTTCTTCCTGGGG - Intronic
1087128943 11:94652372-94652394 AGCCCAGTTGTTCCTTCCTGCGG - Intergenic
1087374280 11:97322458-97322480 GACCCAAATCTTCATTTCTGAGG - Intergenic
1087401275 11:97669380-97669402 GACCCAGCTCTTCCACTCTTGGG + Intergenic
1087722056 11:101677681-101677703 AACCCAACTGTTCCTTTCTGTGG + Intronic
1088265701 11:107985505-107985527 GACCCAAACCTTCATTCCTGAGG - Intergenic
1088559986 11:111104601-111104623 TCCCCAGATCTTCTTTCCTGGGG - Intergenic
1089365656 11:117919479-117919501 GGCCCTGCCCTTCCCTCCTGGGG + Intronic
1090532979 11:127610294-127610316 CTCCCACCTCTTCCTTCCTTTGG - Intergenic
1091644888 12:2265801-2265823 CACCCAGCTCTCCCTCTCTGTGG - Intronic
1091820817 12:3473970-3473992 GACCCTGCCATTCCTTGCTGGGG + Intronic
1091848278 12:3674440-3674462 GACCCTGTTCTCCCTTTCTGGGG + Intronic
1092888019 12:12942336-12942358 AACCCAGCCCTTCCCTCCTTTGG - Intronic
1094498540 12:31004303-31004325 ACTCCAGCTCTTTCTTCCTGGGG + Intergenic
1096097636 12:48946950-48946972 GACCCTGGTCTTCCTTCCCCTGG - Intronic
1096448512 12:51717031-51717053 GCCTCATCCCTTCCTTCCTGAGG + Intronic
1096682890 12:53268575-53268597 GATTCCGCTCTTCCTTCCTCCGG - Intronic
1097582942 12:61480981-61481003 GACTCAGCTGTTCCAACCTGTGG + Intergenic
1097768456 12:63552557-63552579 GACCCATCTCCTCATTCATGTGG - Intergenic
1100229858 12:92595910-92595932 GACCCAGCCCTTCATTACTCTGG + Intergenic
1103342947 12:120230737-120230759 TACCCAGCTCACCATTCCTGGGG - Intronic
1104467642 12:129003810-129003832 GCCCAAGCCCTTCCTGCCTGGGG - Intergenic
1104937783 12:132375772-132375794 CCCCCAGCTCTGCCTGCCTGAGG + Intergenic
1106250288 13:27977537-27977559 GGCCCACCGCCTCCTTCCTGCGG + Intergenic
1106389766 13:29323745-29323767 GACCTCACTCTTCCTTCCAGAGG - Intronic
1106454188 13:29912154-29912176 CCCCCAGCCCTTCCTTCCAGGGG - Intergenic
1106761838 13:32875428-32875450 GAACCAGAACTTCCTTCCTAAGG - Intergenic
1107271852 13:38628473-38628495 GACCTAGCTCTTTCTTACTTGGG - Intergenic
1109516145 13:63444303-63444325 GACCCAAACCTTCCTTCCTGAGG - Intergenic
1109519288 13:63486685-63486707 GACCCAAACCTTCATTCCTGAGG - Intergenic
1112230476 13:97584544-97584566 GACCCATTTCTTTTTTCCTGAGG - Intergenic
1112439986 13:99418208-99418230 GCCTCAGCTCTTCCTTCTGGGGG - Intergenic
1113396409 13:109951494-109951516 GACCCAAACCTTCATTCCTGAGG - Intergenic
1113606509 13:111611241-111611263 GACCCAACACTGCCTTCCAGAGG - Intronic
1113654044 13:112057168-112057190 TACCCACCTGTTCTTTCCTGGGG - Intergenic
1113817844 13:113187336-113187358 GACCCAGCATTTCCACCCTGAGG - Intronic
1114905131 14:27118661-27118683 GACCCAAACCTTCATTCCTGAGG + Intergenic
1116682020 14:47984151-47984173 GTCCCAGCTCTTCTTGGCTGCGG + Intergenic
1117979332 14:61327063-61327085 AAGCCAGTCCTTCCTTCCTGAGG - Intronic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1118820928 14:69345422-69345444 AAACCAGGTCTTCCTTCCTCAGG - Intronic
1119028071 14:71169495-71169517 GCCCCAACTCTGCCTTCCTGAGG + Intergenic
1119059443 14:71460302-71460324 GACCCAAATCTTCATTCCTGAGG + Intronic
1119431476 14:74570744-74570766 GGCCCAGCACTTCCCTGCTGGGG - Intronic
1119782994 14:77290667-77290689 GAGCCAGATCTTCCTTTCTTTGG - Intronic
1120350607 14:83352819-83352841 GACCCAAATCTTCGTTCCTGAGG - Intergenic
1121100965 14:91249975-91249997 GACCCAGCTCCTCCTTCCCCAGG - Intronic
1121604370 14:95229872-95229894 GACACGGCTCTGCCCTCCTGGGG - Intronic
1122419376 14:101565461-101565483 AACCCAACTCTTCCTGCGTGTGG + Intergenic
1122702294 14:103598094-103598116 GACCCAGCACTTTCTTCCCAGGG + Intronic
1122706539 14:103625507-103625529 GGCACTGCACTTCCTTCCTGTGG + Intronic
1123012599 14:105356582-105356604 GAGCCACCGCTTGCTTCCTGTGG + Intronic
1123034834 14:105467659-105467681 GCCCCAGCCCTCCTTTCCTGGGG + Intronic
1124237686 15:28004058-28004080 CACCCTGCTCTTCCTTCCTGTGG + Intronic
1124440016 15:29678836-29678858 GAGCCAGCCCTTCCCTCCTGGGG + Intergenic
1124850848 15:33337741-33337763 GACCCAGCAATTCCTCCCAGTGG + Intronic
1125761662 15:42100323-42100345 GACCAAACCCTTCTTTCCTGGGG - Intergenic
1127023333 15:54775596-54775618 AACCCAGACCTTCCTTCCTGAGG - Intergenic
1127264637 15:57351623-57351645 GAGCCAACTCTTCCTACCTGAGG - Intergenic
1127476483 15:59338675-59338697 GACCTTGCTCCTCCTGCCTGTGG - Intronic
1128081148 15:64857629-64857651 GACCCAGCTCCACCCTCCTAAGG - Intronic
1128139455 15:65288041-65288063 CTCCAAGCTCTCCCTTCCTGGGG - Intronic
1128212527 15:65912593-65912615 GACTCTGCTCTTCCCTCCTAAGG + Intronic
1128937222 15:71757135-71757157 GACCCAGCCCCTCCTACCTTTGG - Intronic
1129014431 15:72453565-72453587 TTCTCAGCTCTGCCTTCCTGAGG + Intergenic
1129184450 15:73897525-73897547 GAGCCACCTCCTCTTTCCTGTGG + Intergenic
1129737308 15:77973488-77973510 CAGCCAGCCCTTCCTTCCTCTGG - Intergenic
1129750081 15:78056592-78056614 GACTCTTCTCTCCCTTCCTGTGG - Intronic
1129848764 15:78780137-78780159 CAGCCAGCCCTTCCTTCCTCTGG + Intronic
1130253174 15:82313933-82313955 CAGCCAGCCCTTCCTTCCTCTGG - Intergenic
1130316352 15:82800177-82800199 GACCTCCCCCTTCCTTCCTGGGG + Intronic
1130412708 15:83660356-83660378 GACCCAGGACTACCTTCCTTAGG - Intronic
1131090970 15:89624829-89624851 CCCCCATCTCCTCCTTCCTGTGG + Exonic
1132533809 16:467415-467437 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533823 16:467459-467481 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533852 16:467547-467569 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533867 16:467591-467613 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533882 16:467635-467657 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533934 16:467789-467811 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533949 16:467833-467855 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533956 16:467855-467877 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132684925 16:1158316-1158338 GGGGCAGCTCATCCTTCCTGGGG + Intronic
1132723913 16:1330638-1330660 GACCCTGCCCTTCCTTGCTTGGG + Intergenic
1132842578 16:1985313-1985335 GAGCCATCTCTTCCTCACTGAGG + Intronic
1132936988 16:2486236-2486258 GCCACAGCACCTCCTTCCTGTGG + Intronic
1133538178 16:6722133-6722155 GACCCTGCTTTCCATTCCTGTGG + Intronic
1134021797 16:10926156-10926178 CACCCAGCTCTCACTTGCTGGGG - Exonic
1134219986 16:12346211-12346233 GTCCCCGCTCCTCCATCCTGTGG - Intronic
1134542444 16:15078575-15078597 GACCAAACTCCTCCTTCCGGCGG + Intronic
1134672661 16:16067337-16067359 GAACCAGCTCTGGCTTCCCGTGG + Intronic
1135360024 16:21804658-21804680 GACCAAACTCCTCCTTCCAGCGG + Intergenic
1136262779 16:29092281-29092303 GACCAAACTCCTCCTTCCAGCGG - Intergenic
1136933231 16:34436877-34436899 GACCCAAATCGTGCTTCCTGGGG + Intergenic
1136971341 16:34974937-34974959 GACCCAAATCGTGCTTCCTGGGG - Intergenic
1138244987 16:55460720-55460742 CACTCAGCTCTTTCTCCCTGCGG - Intronic
1138290210 16:55840306-55840328 GCCTCACCTCTTCCTTCCCGGGG + Intergenic
1138292202 16:55857198-55857220 GACTCAACTCTTCCTGCCTCAGG + Intronic
1138335924 16:56252781-56252803 CATCCAGCTGTTCCTTCTTGTGG + Intronic
1139663085 16:68435555-68435577 GCCCCAGCCCTTCCTGTCTGTGG - Intronic
1140112877 16:72018586-72018608 CACCCAGCCCTCCCTCCCTGTGG + Intronic
1140192630 16:72830941-72830963 GACCCAGTACTTCCTTGCTGGGG - Intronic
1141558982 16:84854221-84854243 ATTCCAGCTCTTCCCTCCTGGGG + Intronic
1141622229 16:85242368-85242390 GACCCACCCCTTCCTGCATGGGG - Intergenic
1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG + Intronic
1143356212 17:6330723-6330745 GACCCAGCTCTGCCATCCATGGG - Intergenic
1143398928 17:6627916-6627938 GCCCCAGCTCCTCTTTCCAGCGG - Intronic
1144001569 17:11059986-11060008 GGCTCAGCTCTTCCTTCCAGGGG + Intergenic
1145280712 17:21464907-21464929 GACCCACCTCATTCTTCCTCAGG - Intergenic
1145794498 17:27647596-27647618 ATCCCAGCACTTCCTTCATGCGG - Intronic
1145905719 17:28515082-28515104 AATACAGCTCCTCCTTCCTGGGG + Intronic
1147952625 17:44115550-44115572 CCCCCAGCTCTTCCTTTCTGAGG - Intronic
1148470506 17:47890182-47890204 GGCCCTGCCCTTTCTTCCTGAGG + Intergenic
1148610433 17:48961160-48961182 CACCCAGCGCTGCCTGCCTGGGG + Intronic
1150335361 17:64326686-64326708 GGCCCAGCCCTTCCTGTCTGTGG - Intronic
1151470101 17:74312602-74312624 GTCCCAGCCCTTCCCTCCAGGGG - Intronic
1151705099 17:75763275-75763297 GACCCAGCCCTCCTTCCCTGAGG - Intronic
1152048246 17:77953141-77953163 GCCCCTGCTCTGTCTTCCTGAGG + Intergenic
1152101742 17:78305493-78305515 GAGGCTGCTCCTCCTTCCTGTGG + Intergenic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152241927 17:79165447-79165469 GACCCCGCTGTGCCCTCCTGCGG - Intronic
1152991845 18:370772-370794 GCCAGAGCTCTTCCTGCCTGGGG + Intronic
1153217414 18:2833718-2833740 GACCCAAACCTTCATTCCTGAGG + Intergenic
1153541286 18:6158821-6158843 GACCCCGTGCTTCCTTACTGAGG - Intronic
1153601629 18:6786452-6786474 GCCCCAACTCTTCCTTCCTGAGG - Intronic
1153632716 18:7087475-7087497 CAACCAGCTCTTCCTTCCCCTGG + Intronic
1156304108 18:35860579-35860601 GACCCAAACCTTCATTCCTGAGG - Intergenic
1156436646 18:37137844-37137866 GTCCCAGCTTTTCCCTCCTGAGG + Intronic
1157285356 18:46373818-46373840 GCCCCAGCTCTGCCTTTCTCTGG - Intronic
1158352316 18:56575257-56575279 GACACAGCTCTTCCCTCCCAAGG - Intergenic
1159293241 18:66449526-66449548 GACTCAAATCTTCATTCCTGAGG + Intergenic
1160374692 18:78402488-78402510 GCTCCAGCTTTCCCTTCCTGAGG + Intergenic
1160585407 18:79911082-79911104 GGCTCTGCTCTTCCTTCCTGGGG - Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160761076 19:784809-784831 GGTCCAGCAGTTCCTTCCTGGGG - Intergenic
1160772974 19:841299-841321 AACCCAGCCCTTCCCTCCTGAGG + Intronic
1161405602 19:4089684-4089706 AAGCCAGCGCTTCCTTTCTGTGG + Intergenic
1161516425 19:4699261-4699283 GTCCCAGCCCTTCCATCCTCTGG + Intronic
1161551746 19:4916796-4916818 GAAACTGCTCTGCCTTCCTGAGG - Intronic
1163318347 19:16556717-16556739 GAGCCAGCTCTGTCCTCCTGTGG - Intronic
1163653688 19:18533189-18533211 GCCCCAGGTCTTTCTTGCTGTGG - Intronic
1163694809 19:18758758-18758780 GACTCAGTTCTTCCCTCCTTTGG + Intronic
1166052334 19:40267781-40267803 GACACAGCCCTGCCTTCATGAGG + Intronic
1166266749 19:41689014-41689036 GTCCCACCTCTTCCTTCCTGGGG - Intronic
1166335744 19:42105853-42105875 GACCCCTCTCTGCCTGCCTGGGG - Intronic
1166637855 19:44467688-44467710 GTGCCAGCTCTTCCTTGGTGAGG - Intergenic
1166682903 19:44778918-44778940 GCCCCAGCCCCTCCTTCCTAAGG + Intronic
1166767878 19:45263221-45263243 GACCCACCTGACCCTTCCTGCGG + Intronic
1167228891 19:48269159-48269181 CTCCCAGCCCTTCCTTCCTGGGG + Intronic
1167279752 19:48559999-48560021 AACCCAGGACTGCCTTCCTGTGG - Intronic
1167596909 19:50432716-50432738 GCCCCAGCCCCTCCTCCCTGGGG + Intergenic
1168685501 19:58347119-58347141 GACCACGCGCTTCCTTCCGGGGG - Intronic
925226731 2:2189975-2189997 CACCGAGCTCTCCCTTCCTCAGG + Intronic
925370969 2:3345213-3345235 GTACCGGCTCTTCCTTCCAGTGG + Intronic
925762737 2:7201632-7201654 GATTAAGATCTTCCTTCCTGGGG - Intergenic
928412892 2:31067955-31067977 GAACCTGCTCTTCCTTCGTGTGG + Intronic
929564776 2:42977471-42977493 CTCCCAGCCCTTCCTCCCTGTGG - Intergenic
929569429 2:43011079-43011101 GATGGAGCTCTTCCTGCCTGTGG + Intergenic
929587614 2:43126304-43126326 GCCATAGATCTTCCTTCCTGAGG + Intergenic
929783271 2:44971576-44971598 TACCCAGACCTTCCTGCCTGGGG + Intergenic
930754428 2:54960496-54960518 CACCCAGCTGGTTCTTCCTGGGG - Intronic
930774584 2:55159422-55159444 GAGCCACCTCTTCCTCTCTGAGG - Intergenic
932139704 2:69264465-69264487 GACCCAGATCCTCATCCCTGTGG - Intergenic
932793028 2:74672346-74672368 GACCCAGCTATATCTACCTGAGG - Intronic
935270847 2:101433010-101433032 GACCCCGCCCTTCCCTCCAGTGG - Intronic
935564039 2:104588366-104588388 GACCCAAACCTTCATTCCTGAGG + Intergenic
936388811 2:112054634-112054656 CCCCAAGCTCTTCCTTCCTGGGG + Intergenic
936388855 2:112054766-112054788 CCCCAAGCTCTTCCTTCCTGGGG + Intergenic
936388941 2:112055010-112055032 CCCCAAGCTCTTCCTTCCTGGGG + Intergenic
937784947 2:125885839-125885861 GACCCAAACCTTCATTCCTGAGG + Intergenic
938107978 2:128546271-128546293 AACCCAGCTCATCCTCCCTATGG - Intergenic
938977425 2:136493301-136493323 TTCCCACTTCTTCCTTCCTGAGG - Intergenic
939214130 2:139214132-139214154 GACCCAAACCTTCATTCCTGAGG - Intergenic
940046554 2:149416291-149416313 GACCCAAATCCTCTTTCCTGGGG + Intronic
940461050 2:153963436-153963458 GACTCAGCACTTCCATCCTTTGG - Intronic
941027134 2:160469334-160469356 GACCCAGAGCTTCCCGCCTGGGG + Intronic
942120221 2:172769449-172769471 CACCCCTGTCTTCCTTCCTGGGG + Intronic
943326908 2:186510756-186510778 GACCAAGCTTTTCCAACCTGAGG + Intergenic
944540686 2:200750656-200750678 CTCCCAGCTCTTCCTGCCTTTGG + Intergenic
944685995 2:202118338-202118360 CACCCAGCATTTCCTTCCAGTGG + Intronic
945642451 2:212445731-212445753 GACCCAAACCTTCATTCCTGCGG - Intronic
946037965 2:216759079-216759101 GCTCCAGCTCTTCCTTGGTGAGG + Intergenic
946478640 2:220032860-220032882 GACCCAGACCTTTCTTTCTGGGG - Intergenic
947441118 2:230122146-230122168 GACCCAAACCTTCATTCCTGAGG - Intergenic
947518934 2:230829146-230829168 GACTCAGCTCTTCCTGGCTTGGG + Intergenic
947524225 2:230868697-230868719 GACCCAGCTCCTCCTGCCGAGGG - Intronic
947805888 2:232967760-232967782 GAGGCAACACTTCCTTCCTGAGG - Intronic
948608595 2:239152508-239152530 GGTCCAGCTCTTCCTGCCAGAGG - Intronic
948641479 2:239378382-239378404 GACTCAGCTCTTCGTTCCCCGGG - Intronic
1168888742 20:1279899-1279921 GGCACAGCTGTGCCTTCCTGTGG + Intronic
1168948429 20:1780363-1780385 CACCAAGCCCTTCCTGCCTGAGG - Intergenic
1170967045 20:21082893-21082915 GACCCAGATCTTTGTCCCTGAGG - Intergenic
1171386016 20:24769954-24769976 GACCGAGCTCTACCATGCTGGGG - Intergenic
1174190970 20:48740230-48740252 GACCCAGCACCTCTTTCCTTTGG + Intronic
1174251934 20:49226408-49226430 GACCCAGTTCTTTTTTCCTCAGG + Exonic
1174484309 20:50851682-50851704 GGCCCAGCCCTGCCATCCTGGGG + Intronic
1175074331 20:56360273-56360295 AGCCCAGCTGTTCCTTCCTCCGG + Intronic
1175202789 20:57289738-57289760 AACCCAGCTTTTCTTTCCTGTGG - Intergenic
1175470362 20:59222894-59222916 AACCCTGCTCTCCCTTCCTTCGG - Intronic
1175990227 20:62785168-62785190 CACCCAGGTTATCCTTCCTGCGG - Intergenic
1176199958 20:63855674-63855696 CCCCCAGCCCTTCCTTCCTGGGG - Intergenic
1177039027 21:16083341-16083363 CAACCAGTTCTTCTTTCCTGGGG - Intergenic
1177879376 21:26673854-26673876 GACCAACCTCCTCCTACCTGGGG - Intergenic
1178612811 21:34100402-34100424 TCCCCAGCTATTCTTTCCTGGGG + Exonic
1179039144 21:37786260-37786282 GCCCCAACCCTTCCTCCCTGTGG - Intronic
1179630753 21:42677025-42677047 GAGCCCGCTCTTCCCTCCTGGGG + Intronic
1179902897 21:44402998-44403020 GGACCTGATCTTCCTTCCTGGGG - Intronic
1180843477 22:18969930-18969952 CCCCCACCTCTTCCTTCCTGCGG - Intergenic
1181559949 22:23694214-23694236 GCCCCAGGTCTGCCCTCCTGAGG + Intronic
1182765857 22:32757837-32757859 GACCCAAACCTTCATTCCTGAGG - Intronic
1183422922 22:37722822-37722844 GGCCCACCTCTCCCTCCCTGGGG + Intronic
1184048644 22:41988345-41988367 TTCCCAGCACTTCCTTCATGGGG - Intronic
1184060523 22:42078563-42078585 GACCCAGCTCTTCCTGAGAGGGG + Exonic
1184418177 22:44364076-44364098 GGCCCAGCCCCTCCTTCCTCAGG - Intergenic
1184459040 22:44626854-44626876 GAGCCAGCTCTTCCCTCCTCAGG + Intergenic
949376217 3:3393038-3393060 CTCCCACCTCTTCCTCCCTGGGG + Intergenic
949379255 3:3426717-3426739 GACCCAGCTATCCCATCATGGGG - Intergenic
950157045 3:10729486-10729508 CACCCAGTCCTTCCTGCCTGAGG + Intergenic
950654406 3:14427778-14427800 TGCCCTGCTCTTCCCTCCTGTGG + Intronic
951003825 3:17594373-17594395 GACCCAGACCTTCATTCCTAAGG - Intronic
952673666 3:36000751-36000773 GACTCAGCTGTTCCAACCTGTGG - Intergenic
954384719 3:50238022-50238044 GCCCCTTCTCTTCCTCCCTGAGG - Intronic
954511229 3:51127797-51127819 GACCCAAACCTTCATTCCTGAGG + Intronic
954643487 3:52116396-52116418 GACCCAGCTCCCTCTTCCAGAGG + Intronic
954852444 3:53615210-53615232 GACCCAAACCTTCCTTCCTCAGG + Intronic
955220751 3:57021163-57021185 GACCCATCCTTTCATTCCTGGGG - Intronic
955898593 3:63727178-63727200 GACCCAGCTCTTCCTTCTAATGG - Intergenic
956109018 3:65852319-65852341 TACCCTCCTCTTCCTTTCTGGGG - Intronic
956307126 3:67837520-67837542 GACCCAAACCTTCATTCCTGAGG - Intergenic
958021235 3:87998952-87998974 GGAACAGCTCTTACTTCCTGAGG + Intergenic
958613106 3:96452670-96452692 GGCCCAGCTCTTCCCTACTCAGG - Intergenic
958738923 3:98043955-98043977 GACCCCTCTTTTCTTTCCTGTGG + Intergenic
959500680 3:107102875-107102897 CACCCAGCTCTTCCCTCCTGGGG + Intergenic
960349775 3:116577593-116577615 GACCCAAGCCTTCATTCCTGAGG - Intronic
961165941 3:124763922-124763944 GACCCAACTCCTCCTTCCAGAGG - Intronic
963768429 3:149363311-149363333 GGCTCATCTCTTCCTGCCTGGGG - Intergenic
965711911 3:171563898-171563920 AAAACAGCTCTTCCCTCCTGAGG - Intergenic
966824016 3:183948633-183948655 TACCCAGTTCTCCCTTCCAGTGG + Intronic
967215558 3:187206990-187207012 CACCCAGCTCTTCCAGGCTGGGG + Intergenic
967447233 3:189580898-189580920 AATCCTGTTCTTCCTTCCTGAGG - Intergenic
968289311 3:197526450-197526472 AAGCCAGCTCTTCCTTCTTGGGG + Intronic
968960822 4:3742639-3742661 GACCCAGCGTCTCCTGCCTGAGG - Intergenic
968984685 4:3868763-3868785 GGCCCACCTCCTCCTTCTTGGGG + Intergenic
969609009 4:8216758-8216780 GTCCCAGCTCTGCCTCCATGTGG - Intronic
969684444 4:8662912-8662934 GTCCCAGCTCTTCCCTCCTAGGG + Intergenic
969890765 4:10257675-10257697 ATCCCTGCTTTTCCTTCCTGTGG + Intergenic
969961223 4:10946628-10946650 CACCCAGCACTCCCTTCATGAGG - Intergenic
970501684 4:16683840-16683862 GACCCAGCTCTTCCTTCCTGTGG + Intronic
971159168 4:24115776-24115798 GACCCAGCTCAGCCTCCCTTTGG + Intergenic
971306274 4:25484682-25484704 GCCACAGCTCTTCCTGTCTGTGG + Intergenic
973202715 4:47522458-47522480 TTCTCAGCTCTTTCTTCCTGTGG - Intronic
975637674 4:76466499-76466521 GACACTGCTCTTAGTTCCTGAGG - Intronic
975982351 4:80175383-80175405 GACCCAAACCTTCCTTCCTGAGG + Intergenic
977289352 4:95146678-95146700 GACCCAGGACTTCTTACCTGGGG + Intronic
978771883 4:112465894-112465916 GACCCAAACCTTCATTCCTGAGG + Intergenic
979259153 4:118632790-118632812 GACCAAGCTCTCCCTCCCAGTGG + Intergenic
979259303 4:118633492-118633514 GGCCCAGCTCTTCCTCTCGGCGG + Intergenic
979329045 4:119407071-119407093 GGCCCAGCTCTTCCTCTCGGCGG - Intergenic
979329196 4:119407769-119407791 GACCAAGCTCTCCCTCCCAGTGG - Intergenic
980405104 4:132345048-132345070 GACCGAGTTCCTGCTTCCTGCGG - Intergenic
981835264 4:149045794-149045816 GACCCAAACCTTCATTCCTGAGG - Intergenic
984060025 4:174980147-174980169 GACCCAAACCTTCATTCCTGTGG + Intergenic
984403725 4:179300362-179300384 GACCCAAACCTTCATTCCTGTGG + Intergenic
984482631 4:180325376-180325398 GTATCAGCTCTTCATTCCTGTGG - Intergenic
985028350 4:185762247-185762269 CACCCTGCTCTTCCTTCCCAGGG - Intronic
985339156 4:188930173-188930195 GACCCTGCCCTTCATTTCTGAGG - Intergenic
985806581 5:2048757-2048779 TTCCCAGCTCTGCCTTCCTCCGG + Intergenic
986289321 5:6386351-6386373 AAACCAGCTGTTCCTTCCTCTGG - Intergenic
987490620 5:18576543-18576565 GACCCAAACCTTCATTCCTGAGG + Intergenic
988731555 5:33977613-33977635 GAGCCAGCCCTTCCTTCTTCAGG - Intronic
989044886 5:37265391-37265413 GACCCAAACCTTCATTCCTGAGG + Intergenic
989307241 5:39972735-39972757 GACCCAAACCTTCATTCCTGAGG + Intergenic
991013524 5:61909002-61909024 GACCCAAACCTTCATTCCTGTGG + Intergenic
991033820 5:62107810-62107832 GACCCAAACCTTCATTCCTGAGG - Intergenic
991946413 5:71902014-71902036 GACCCAAACCTTCATTCCTGAGG - Intergenic
992709187 5:79431895-79431917 GATCCAGTTCTTGCTTCATGGGG - Intronic
993367078 5:87047973-87047995 GACCCAAACCTTCATTCCTGAGG + Intergenic
993412320 5:87589926-87589948 GACCCAAACCTTCATTCCTGAGG + Intergenic
994984152 5:106913848-106913870 GACCCAAACCTTCATTCCTGAGG + Intergenic
995592053 5:113709457-113709479 GACCAAACTCTTCATTCCTGAGG + Intergenic
996510783 5:124313742-124313764 GACCCATCTCTTACTGGCTGTGG + Intergenic
997346500 5:133196165-133196187 GACCCAGCCCACCCTGCCTGGGG - Intergenic
997391318 5:133519434-133519456 AACCCAGCACCTGCTTCCTGAGG - Intronic
998141541 5:139702316-139702338 GAGCAAGCTCTTCCTGCCTCAGG + Intergenic
998261375 5:140634258-140634280 GTCCCATCCCTTCCTTCCTAGGG - Intergenic
998706502 5:144768034-144768056 GACCCAGCCCTAACTTCCTTTGG + Intergenic
999351637 5:150876705-150876727 GACCCAAACCTTCATTCCTGAGG - Intronic
1000338980 5:160262429-160262451 GACCCAGCACTGCCTGGCTGTGG - Intronic
1000393519 5:160749378-160749400 CCCCCAGCTCCTTCTTCCTGTGG - Intronic
1001778152 5:174344611-174344633 CACCCAGCTCTGCCCTCCTCTGG - Intergenic
1001843969 5:174904440-174904462 GACTCAGCTGTTCCAGCCTGTGG + Intergenic
1001882674 5:175258169-175258191 GAATCAGCTCCTCCCTCCTGAGG + Intergenic
1001915628 5:175557910-175557932 GCCCCATCTCCTCCTTCCAGTGG + Intergenic
1002048008 5:176552900-176552922 AATCCAGCTCTTCCTTCCAGGGG + Intronic
1002400416 5:178988837-178988859 CACCCAGCCCTTCCACCCTGAGG + Intronic
1002797330 6:484757-484779 TGCTCAGCTCTTCCTTCCAGCGG - Intergenic
1002943510 6:1739088-1739110 GACCCAGGTCTTCATGCCTGTGG - Intronic
1004803677 6:19178822-19178844 AACGCAGGACTTCCTTCCTGAGG - Intergenic
1006066113 6:31463727-31463749 GACTGAAATCTTCCTTCCTGAGG + Intergenic
1007228358 6:40330427-40330449 TACCCAGAGCTTCCTTCCTGGGG - Intergenic
1010580553 6:77592361-77592383 GACCCAAACCTTCATTCCTGAGG + Intergenic
1013302523 6:108818002-108818024 GACCCAGCACTGCCTTCCTTGGG + Intergenic
1013406929 6:109851629-109851651 GACCCAAACCTTCATTCCTGAGG - Intergenic
1013671208 6:112405540-112405562 GACACAGCCCTGCCTTCCAGTGG + Intergenic
1014363146 6:120506453-120506475 GACCCAAACCTTCATTCCTGAGG + Intergenic
1014417254 6:121197302-121197324 GACCCAAACCTTCATTCCTGAGG - Intronic
1015223076 6:130826738-130826760 GCCCCATCTCCTTCTTCCTGAGG - Intergenic
1015443014 6:133270655-133270677 GACCCAAACCTTCATTCCTGGGG + Intronic
1015751251 6:136561408-136561430 GACCCAGCCCTGCCCTCCTGAGG - Intronic
1016810821 6:148259574-148259596 GACCTAGCCCTGCCTTCCCGGGG - Intergenic
1017388325 6:153911261-153911283 GACCCAAACCTTCATTCCTGAGG + Intergenic
1017558788 6:155604657-155604679 GACCCAAACCTTCATTCCTGAGG + Intergenic
1018390236 6:163336211-163336233 CCCCCAGCTCTGCCTGCCTGGGG + Intergenic
1018600147 6:165529421-165529443 GACCCAAACCTTCATTCCTGAGG - Intronic
1018604722 6:165584802-165584824 GACCCAGACCCTCATTCCTGAGG - Intronic
1018980124 6:168595112-168595134 GGCCGAGCTCCTCCTTCCTAAGG + Intronic
1019337050 7:490467-490489 GTCCTAGCTCTTGGTTCCTGGGG + Intergenic
1019446868 7:1075935-1075957 GACTCTGCTGTTCCTACCTGAGG - Intronic
1019524473 7:1474524-1474546 CACCCAGCTCCTCCCACCTGAGG + Intronic
1020583096 7:10030756-10030778 GACCCAGACCTTCATACCTGAGG + Intergenic
1021666811 7:22990439-22990461 GCCCAAACTCTTCATTCCTGTGG + Intronic
1022871907 7:34488740-34488762 GACCCATCTTTTTCTTCCCGAGG - Intergenic
1022967509 7:35487276-35487298 GGCCCAGCTCTTCCACCCTTGGG + Intergenic
1023400745 7:39792023-39792045 GGCCCAGCTCTTCCTCCCGGCGG + Intergenic
1023649194 7:42350931-42350953 AAACCAGCCCTTCCCTCCTGGGG - Intergenic
1023674731 7:42617527-42617549 GACCCACCTCCTCTTGCCTGGGG - Intergenic
1024074061 7:45809836-45809858 GACCAAGCTCTCCCTCCCAGTGG + Intergenic
1024074210 7:45810538-45810560 GGCCCAGCTCTTCCTCCCGGCGG + Intergenic
1024556480 7:50607444-50607466 CAGTCAGCTCTTCCCTCCTGAGG - Intronic
1024649122 7:51389660-51389682 GGCCCAGCTCTTCCTCCCAGCGG - Intergenic
1024649273 7:51390362-51390384 GACCAAGCTCTCCCTCCCAGTGG - Intergenic
1025053201 7:55744990-55745012 GGCCCAGCTCTTCCTCTCGGCGG - Intergenic
1025053352 7:55745692-55745714 GACCAAGCTCTCCCTCCCAGTGG - Intergenic
1025058271 7:55782897-55782919 GACCGAGCTCATCCTTCATAAGG + Intergenic
1025131305 7:56375463-56375485 GGCCCAGCTCTTCCTCCCGGCGG - Intergenic
1025131455 7:56376165-56376187 GACCAAGCTCTCCCTCCCAGTGG - Intergenic
1025182114 7:56828532-56828554 GGCCGAGCTCTTCCTCCCGGCGG - Intergenic
1025182161 7:56828722-56828744 GGCCCATCTCTTCCTAACTGTGG - Intergenic
1025689768 7:63748273-63748295 GGCCCATCTCTTCCTAACTGTGG + Intergenic
1025977282 7:66378985-66379007 GGCCCAGCTCTTCCTCCTGGCGG - Intronic
1026614014 7:71885795-71885817 TCCCCAGCTCTCTCTTCCTGTGG + Intronic
1027188223 7:75984178-75984200 GACCCACCTCTGCCGGCCTGGGG + Intronic
1027235972 7:76297977-76297999 GCCCCAGCTCTTCCCTGATGGGG + Intergenic
1027315191 7:76981154-76981176 GACGCAGCTCCTCCTTCCCTGGG + Intergenic
1028625048 7:92868555-92868577 GGCCCACATCCTCCTTCCTGTGG - Intergenic
1029048625 7:97659498-97659520 GACACAGAACTTCATTCCTGAGG + Intergenic
1029658404 7:101942822-101942844 GCCCCAGCTCTTGGTGCCTGGGG + Intronic
1030579446 7:111334929-111334951 GACACATCTCTTCTTTCTTGAGG + Intronic
1034401482 7:150864409-150864431 GACCAAGCTCTGCCTACTTGAGG - Intergenic
1034408570 7:150923554-150923576 GACCCAGCTCTTCCAACCTCTGG - Intergenic
1034438423 7:151074709-151074731 GACCCAGCCCCTCTTTTCTGGGG - Exonic
1034502904 7:151462493-151462515 CACCCAGCACTTTCTCCCTGGGG + Intergenic
1035381411 7:158443681-158443703 GAGCCACCTCTTCCTACCAGGGG + Intronic
1035563806 8:628230-628252 CACCCTGCTCTGCCTGCCTGGGG - Intronic
1035717368 8:1764168-1764190 GTCCCAGCCCTGCCTTCCGGTGG + Intronic
1036638202 8:10565579-10565601 GAACTAGCTCCTTCTTCCTGGGG + Intergenic
1036750474 8:11440542-11440564 GACCCAGCACTGCCTGCCTCTGG + Intronic
1036798438 8:11772246-11772268 AAACCAGCTCATCCTTCCAGGGG + Intronic
1036823189 8:11955836-11955858 GACCCAGGCTTTCCTCCCTGCGG - Intergenic
1037048401 8:14338221-14338243 GACCCAGCTCCTCCTTTCTTAGG - Intronic
1037702557 8:21288102-21288124 GACCCACACCTTCATTCCTGAGG - Intergenic
1037730248 8:21517915-21517937 GCACCACCTCTTCCTGCCTGGGG + Intergenic
1037923876 8:22829607-22829629 AAGCAATCTCTTCCTTCCTGGGG - Intronic
1039802751 8:40974282-40974304 GCCCCATCCCTGCCTTCCTGAGG + Intergenic
1040410137 8:47145546-47145568 GAACAGGCTCTCCCTTCCTGTGG - Intergenic
1041623374 8:59999097-59999119 GACTCAGCTGTTCCAGCCTGTGG + Intergenic
1041890048 8:62858704-62858726 GACTCAGCTGTTCCAGCCTGTGG - Intronic
1041972627 8:63760928-63760950 GACTCAGCTGTTCCAGCCTGTGG - Intergenic
1042131005 8:65586793-65586815 GACTAGGCTTTTCCTTCCTGAGG - Intergenic
1042215957 8:66429767-66429789 GGCCCAGCTCCTCCTTACTCTGG - Exonic
1042564692 8:70100186-70100208 GACCCAAATCTTCATTCCTGAGG + Intergenic
1043622955 8:82219670-82219692 GACTCAGTTCTGCATTCCTGGGG + Intergenic
1044852800 8:96445614-96445636 GACCCGCCTCTTGCTTCCTGCGG - Intergenic
1044864285 8:96554895-96554917 GGCCCAGCTCCTCCCTCCAGGGG + Intronic
1047026886 8:120834081-120834103 GACACATCACTTCTTTCCTGGGG + Intergenic
1048116873 8:131533132-131533154 GACCCAGCCCGTCATTCCTCAGG + Intergenic
1048511252 8:135064673-135064695 GATCCAGATCTTCATCCCTGAGG + Intergenic
1048769982 8:137884780-137884802 GGCCCACCCCTTCCTTTCTGTGG - Intergenic
1049436336 8:142587768-142587790 GTCCCATCTTTTCCTGCCTGTGG - Intergenic
1049469942 8:142770789-142770811 GATCCAGGCCCTCCTTCCTGGGG + Intronic
1049519150 8:143079455-143079477 CACCCAGCTCTCCCCTCCGGAGG - Intergenic
1051334708 9:16055356-16055378 GACCCAGCTCAGCCAGCCTGTGG - Intronic
1053323119 9:37118410-37118432 GTCCCAGCTGTTCCTGGCTGAGG - Intergenic
1053547336 9:39037009-39037031 CATACAGCTTTTCCTTCCTGTGG - Intergenic
1056110777 9:83392415-83392437 GAACCAGCTCTTCCAACCTTTGG - Intronic
1056842428 9:90009354-90009376 GACTCTGCTCTCCCTTCCAGTGG + Intergenic
1059933226 9:119282293-119282315 ATCCCAGCTCTTTCCTCCTGTGG - Intronic
1060748285 9:126152003-126152025 GACCCAGTTTCTCCTTCCTTAGG + Intergenic
1061225418 9:129278432-129278454 GACACAGCCCTGCCTTCCTGGGG - Intergenic
1061645510 9:131997724-131997746 GTCCCAGCACTTCCTAGCTGGGG + Intronic
1062586454 9:137251974-137251996 GGCCCAGAGCTTGCTTCCTGTGG + Intronic
1186446563 X:9635073-9635095 GTCCCGGCGCCTCCTTCCTGTGG + Intronic
1188977529 X:36692869-36692891 GGCCCAGCTCTTCCTTCCTTAGG - Intergenic
1189638687 X:43043087-43043109 GACCAAGCTCTTCATATCTGAGG - Intergenic
1190123595 X:47683911-47683933 GTCCCCACTCTTCCCTCCTGAGG + Intergenic
1190282918 X:48942893-48942915 CAAGCAGCTCTTCTTTCCTGAGG - Intronic
1190803569 X:53814159-53814181 GACTCAGCTGTTCCAGCCTGTGG - Intergenic
1191590169 X:62874066-62874088 GACTGAGCTCTTTCTACCTGAGG + Intergenic
1191658541 X:63627913-63627935 GACCCAAATCTTCATTCCTGAGG + Intergenic
1191703068 X:64064108-64064130 GACTCAGCCCTTCCAGCCTGAGG + Intergenic
1192240710 X:69325302-69325324 AACCCAGGTCCTCCCTCCTGGGG - Intergenic
1192728536 X:73778413-73778435 GTTCCAGCTCTTCCTAACTGTGG - Intergenic
1193212767 X:78827104-78827126 GAACTAAGTCTTCCTTCCTGTGG + Intergenic
1193841297 X:86411881-86411903 GACCCAAATCTTCATTCCTGAGG + Intronic
1193905432 X:87238036-87238058 GACCCAAATCTTCATTCCTGAGG + Intergenic
1194513170 X:94820378-94820400 GACCCAAACCTTCATTCCTGAGG + Intergenic
1194537168 X:95119502-95119524 GACTCAGCTATTCCAACCTGTGG - Intergenic
1195708056 X:107752436-107752458 GACCCATCCCTTGCTTCCAGAGG + Intronic
1196152784 X:112392913-112392935 GACCTAGCTCTTCCAGCCTTTGG - Intergenic
1196311756 X:114176114-114176136 GACCCAGCACTTCCATTCTTAGG - Intergenic
1196717661 X:118826094-118826116 GACCCTCCACTTCCATCCTGGGG + Exonic
1199052340 X:143251525-143251547 GACCCAGCTCTCCATTGGTGGGG + Intergenic