ID: 970503164

View in Genome Browser
Species Human (GRCh38)
Location 4:16699363-16699385
Sequence CAGGGAATGAAGTCTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970503164_970503168 18 Left 970503164 4:16699363-16699385 CCTGCTACAGACTTCATTCCCTG 0: 1
1: 0
2: 3
3: 22
4: 157
Right 970503168 4:16699404-16699426 AAGTATTTCTTTCCGGTTCATGG 0: 1
1: 0
2: 0
3: 9
4: 162
970503164_970503167 11 Left 970503164 4:16699363-16699385 CCTGCTACAGACTTCATTCCCTG 0: 1
1: 0
2: 3
3: 22
4: 157
Right 970503167 4:16699397-16699419 AAGTAATAAGTATTTCTTTCCGG 0: 1
1: 1
2: 3
3: 47
4: 428
970503164_970503169 25 Left 970503164 4:16699363-16699385 CCTGCTACAGACTTCATTCCCTG 0: 1
1: 0
2: 3
3: 22
4: 157
Right 970503169 4:16699411-16699433 TCTTTCCGGTTCATGGAGATAGG 0: 1
1: 0
2: 0
3: 3
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970503164 Original CRISPR CAGGGAATGAAGTCTGTAGC AGG (reversed) Intronic
900202444 1:1415935-1415957 CAGGGACTGCAGAATGTAGCGGG + Intergenic
900989368 1:6091010-6091032 CATGGAAAGACGCCTGTAGCAGG - Intronic
901022336 1:6261564-6261586 CCGGGAATCCAGTCTGAAGCAGG + Intergenic
901097234 1:6691803-6691825 CAGGGACTGCAATCTGTACCAGG + Intronic
902541860 1:17161524-17161546 TGGGAAATGAAGTCTTTAGCTGG + Intergenic
903334224 1:22614188-22614210 CAGGGACTGGAGGCTGGAGCTGG - Intergenic
904091064 1:27945417-27945439 CAGAGAATGAAGTCTGGCTCTGG - Exonic
904972970 1:34433574-34433596 CAGGGAAGGAAGCCAGTTGCAGG + Intergenic
907036443 1:51220304-51220326 CAGGAAGTGAAGGCTGTAGTGGG + Intergenic
911368761 1:96972099-96972121 AATGGAGTCAAGTCTGTAGCTGG + Intergenic
913480551 1:119285085-119285107 CAGGCAAAGAAGTCTATAGAAGG - Intergenic
914873172 1:151492401-151492423 CAGAGAAGGAAGACTGAAGCAGG - Intergenic
917447712 1:175120691-175120713 TAGGAAATGAGGTCTTTAGCTGG + Intronic
917981163 1:180270386-180270408 CACGGAATAAAGTCAGCAGCTGG - Intronic
919429139 1:197471304-197471326 CAGGGTTTGAAGTCTCTTGCTGG - Intronic
920346243 1:205307434-205307456 GAGGGAATGAACTCAGTACCAGG + Intronic
921571610 1:216786236-216786258 AAGGGAAGGAAGTCTATTGCAGG - Intronic
922539343 1:226407580-226407602 CGGGAAATAAAGTCTGCAGCTGG - Intronic
923361029 1:233211246-233211268 CAGGGAATGAAGCCTGGAGCTGG - Intronic
1064153443 10:12884571-12884593 GAGGGAAGGAAGTGTGAAGCAGG + Intergenic
1064297599 10:14092435-14092457 CTGGGAATGGACTCTGTTGCTGG + Intronic
1064562116 10:16604084-16604106 CAGGGCATAAAATCTGAAGCAGG - Intronic
1067259864 10:44679980-44680002 CAGAGAGTCAAGTCTGTAACTGG - Intergenic
1068496049 10:57786580-57786602 CAGGGATTTAAGGCTGAAGCAGG - Intergenic
1068657762 10:59592325-59592347 CTGGGATTGAAATCTGTTGCTGG - Intergenic
1071252128 10:83829652-83829674 TAGAGAATAAAGTCAGTAGCTGG - Intergenic
1071734293 10:88281170-88281192 CAGAGAAAGAGGTCTGTGGCAGG - Intronic
1072378559 10:94841359-94841381 GAGGGATGGAAGTCTGCAGCGGG + Intronic
1072567290 10:96627404-96627426 CAGGCCATAAAGTCTGTTGCAGG + Intronic
1074716830 10:116227499-116227521 CAGGGAATAATGTTTGTAGAAGG - Intronic
1076730912 10:132438472-132438494 CAGGCCCTGAAGTCTGTTGCAGG - Intergenic
1078594008 11:12671346-12671368 AAGGGCATGAAATCTGGAGCTGG + Intergenic
1078642144 11:13106625-13106647 CAGGGAACTATGTTTGTAGCAGG + Intergenic
1079378587 11:19916868-19916890 GAGTGAGTTAAGTCTGTAGCAGG + Intronic
1080124580 11:28717950-28717972 CAGGGAATGAATTTTGTCTCAGG - Intergenic
1080206823 11:29738993-29739015 CATAGAATGTAGTCTGTAGTTGG + Intergenic
1080740374 11:35058384-35058406 AAGGGAATGAAGAATGTAGCTGG - Intergenic
1081965413 11:47166311-47166333 CAGGGTGTCAAGTCTGTGGCTGG - Exonic
1083961416 11:66016854-66016876 CAGGGGCTGAAGTCTGTATCTGG + Exonic
1086186419 11:84022300-84022322 CAGAGACTGAATTCTGTTGCTGG - Intronic
1086224318 11:84489417-84489439 CAGGGAATGGAGTGTTTAGTGGG - Intronic
1087136172 11:94722322-94722344 CATGGAATGCAGTCTGCAGATGG + Intronic
1089353886 11:117837380-117837402 CAGGGACTGTAGTCTGCATCTGG + Exonic
1094281941 12:28749887-28749909 CAGGGAATGAAATTTGCAGATGG - Intergenic
1095786831 12:46119231-46119253 CAGGGAATTAAGTTTGCAGTTGG - Intergenic
1098272537 12:68782908-68782930 CAAGGAAAGAAGTCTGAGGCAGG + Intronic
1098476350 12:70908674-70908696 TGGGGAAAGAGGTCTGTAGCTGG + Intronic
1100772382 12:97937704-97937726 CAGGGTCTGAAGTCTATAACAGG - Intergenic
1101034382 12:100690572-100690594 GAGGGTATGGATTCTGTAGCAGG + Intergenic
1101377998 12:104187650-104187672 GAGGGAATGAAGGCTGGAACTGG + Intergenic
1104729215 12:131095696-131095718 CAGGGCTTGACGTCTGAAGCAGG + Intronic
1105992393 13:25635619-25635641 CAGGGAATGCTGTCTGTTGGAGG + Intronic
1106366911 13:29090511-29090533 CAGTGAAGGAAGGCTGTAGCTGG + Intronic
1107417062 13:40210601-40210623 CATGGACTGAAGTCTTTAGTGGG - Intergenic
1107610139 13:42104645-42104667 CAGGAAATGGAGTTTGTAGCTGG + Intronic
1107614105 13:42146803-42146825 CAGTAAAGGAAGTCAGTAGCTGG + Intronic
1107637091 13:42403300-42403322 GGGCGAATGAAGTTTGTAGCTGG + Intergenic
1109260579 13:60140993-60141015 CTTGGAATTAAGTCTGTAGCAGG - Intronic
1111444972 13:88335426-88335448 CAGGGAATAAAATATTTAGCTGG - Intergenic
1112923332 13:104642420-104642442 GAGAGAATGAATTCTGAAGCCGG - Intergenic
1113838433 13:113344940-113344962 CAGGGAATGAATTTTATAGCAGG - Exonic
1116185599 14:41597288-41597310 TAGTGAATGAAGTCTATATCAGG + Intergenic
1116845974 14:49865394-49865416 CAGGCAATGTGGTCTCTAGCTGG - Intergenic
1122168622 14:99851961-99851983 CAGGGACAGAGCTCTGTAGCAGG - Intronic
1123785897 15:23672971-23672993 CAGCGAATTAAGTATGGAGCAGG - Intergenic
1125100817 15:35910596-35910618 CAAGAAATGAAGTTTGTTGCTGG - Intergenic
1126397661 15:48235980-48236002 CGGGAAATGTAGTCTGTATCTGG + Intronic
1129601586 15:77002047-77002069 CAGGGGATGATGTAAGTAGCTGG - Intronic
1130960502 15:88655726-88655748 GAGGGAATGAAGTCTTATGCTGG + Exonic
1131646611 15:94351853-94351875 GAGGGCATGAAGTCAGGAGCTGG - Intronic
1133466594 16:6033275-6033297 CAGGGAATGATGTATGTTACAGG + Intronic
1134198466 16:12177730-12177752 GAGTGAATGAATTCTGTATCTGG + Intronic
1139629193 16:68217891-68217913 CAGGAAATATACTCTGTAGCTGG + Intronic
1140478932 16:75252165-75252187 CAGGAAATGAAGCCTCAAGCAGG + Intronic
1140833253 16:78770573-78770595 CAGGGAAGGACGTCTGTGGGAGG + Intronic
1141018387 16:80471394-80471416 CCCGGAATGAAGTCTGAACCAGG + Intergenic
1143693565 17:8591733-8591755 GGGGGAATGAAGTATGCAGCAGG - Intronic
1146582285 17:34049426-34049448 CAGGGAATGCAGCCTGTTCCTGG - Intronic
1146915304 17:36674476-36674498 CAGGAAATGAAGCCTTTTGCTGG + Intergenic
1147901823 17:43791622-43791644 CAGGGAGTGAAGTGGATAGCAGG + Intergenic
1150589993 17:66553865-66553887 CAGGAGATGAAGTGTGTGGCCGG + Intronic
1154128182 18:11712833-11712855 CAGGGAATGTAGTCTGTGAAAGG - Intronic
1156152404 18:34258242-34258264 CAGGGAAGGCAGTGTGTAGCAGG - Intergenic
1157096889 18:44693855-44693877 CAGGGAGGGAAGTCTTTAGCTGG - Intronic
1157329102 18:46690236-46690258 CAGGAAATGAATCCTGTAACAGG - Intronic
1158041106 18:53095236-53095258 CACAGAATGAAGTCTGAAGGAGG + Intronic
1161179128 19:2867580-2867602 CAGGGAATGAAGACTGGGGCAGG - Intronic
1164705166 19:30314255-30314277 CTGGGAATGGAGTCTCGAGCGGG + Intronic
1165102974 19:33449837-33449859 CAGGGAATGAAATCTGTCCGGGG + Intronic
1167904651 19:52648994-52649016 CAGGGCATGAAAACTGTCGCTGG - Intronic
926143944 2:10385424-10385446 CAGGGAAGCAAGCCTGGAGCAGG - Intronic
928482736 2:31698817-31698839 CAGGGAATACATCCTGTAGCTGG + Intergenic
932416514 2:71576669-71576691 CAGGGCAGGAAGGCTGGAGCGGG + Intronic
932776643 2:74531805-74531827 CAGGGAAGGAAGGATGTAGCTGG + Intronic
933918840 2:87024204-87024226 CAGAGACTGAGGTCTGTAGCTGG - Intergenic
934004154 2:87745712-87745734 CAGAGACTGAGGTCTGTAGCTGG + Intergenic
935767110 2:106379724-106379746 CAGAGACTGAGGTCTGTAGCTGG + Intergenic
939521869 2:143241620-143241642 CTGGGAATAAAGTCTTCAGCTGG + Intronic
939883546 2:147656868-147656890 AAGGGAATCAAGGCTCTAGCAGG - Intergenic
944297314 2:198081057-198081079 CAGTGACTCAAGTCAGTAGCAGG + Intronic
947704671 2:232264651-232264673 CAGGGAAAGAAGTCTGCATGAGG - Intronic
948043026 2:234919459-234919481 CTGGGAATGAAGTGTGTGGGAGG - Intergenic
948965282 2:241374819-241374841 CAGAGAAGGAGGTCTGAAGCTGG + Intronic
1168787324 20:551157-551179 CCGGGAATGAGGGCTGAAGCAGG + Intergenic
1170827514 20:19809284-19809306 CAGGCAAAGAAGGCTGAAGCAGG + Intergenic
1173068194 20:39735281-39735303 CAAGGAGAGAAGCCTGTAGCAGG + Intergenic
1178751159 21:35304262-35304284 CAGGGAGTGAAGTTTGAAGCTGG + Intronic
1179058046 21:37954157-37954179 CAGGGACTGACGTCTGTGGAGGG + Intronic
1180194366 21:46184075-46184097 CAGGGAGTGAGGTCAGTAGGTGG - Intronic
1180981683 22:19881073-19881095 CAGTGAATGAAAACGGTAGCAGG - Intronic
1181935749 22:26437163-26437185 CAGAGAATGAGGTCAGAAGCAGG + Intronic
950378384 3:12590786-12590808 CAGGGAATGGAGTGAGTAGATGG - Exonic
951527804 3:23670592-23670614 CAGGGAATGGGGTCTAGAGCTGG + Intergenic
952638768 3:35565864-35565886 CAGGGAATTTTGTCAGTAGCTGG - Intergenic
957402087 3:79729293-79729315 CAGGGAATGAAGTCGGCCTCTGG + Intronic
957744271 3:84318246-84318268 CAGGGAAAGAAGACTCCAGCTGG - Intergenic
962041025 3:131707613-131707635 AAGGGAATGAACTCTGGAACTGG - Intronic
967953753 3:194861051-194861073 CAGAGAGTCAAGTCTGCAGCAGG + Intergenic
968377341 4:54193-54215 CAGGGACTGGCGTCTGCAGCGGG + Intronic
968874997 4:3262049-3262071 CAGGGAAATAAGGCTGTAGGGGG + Intronic
968969972 4:3788644-3788666 CAGGGAAGGAGGCCTGCAGCGGG + Intergenic
969089525 4:4683174-4683196 CTGGGAGTTAAGTCTGCAGCTGG - Intergenic
970095528 4:12459578-12459600 CAGGGATGGAAGTCTGCGGCGGG - Intergenic
970503164 4:16699363-16699385 CAGGGAATGAAGTCTGTAGCAGG - Intronic
970612267 4:17736783-17736805 TGGGAAATGAAGTCTCTAGCTGG + Intronic
970979009 4:22075193-22075215 CAGGGAATCAAGTCCCTAGGCGG - Intergenic
971774673 4:30947032-30947054 CAAGGAATGAGTTCTTTAGCTGG - Intronic
972723804 4:41727951-41727973 CAGGAAATGTAGTCTCTGGCTGG + Intergenic
975018754 4:69460272-69460294 CAGGAAAACAAGTCTTTAGCAGG - Intergenic
976860924 4:89665345-89665367 CAAAGTATGAAGTCTGTAGCTGG + Intergenic
977430794 4:96928470-96928492 CAGGGAGAGAAGACTGTGGCAGG - Intergenic
977593784 4:98855389-98855411 CAGAGAATGAAGGCAGTGGCTGG + Intergenic
979602413 4:122600939-122600961 CAGGGAGTGGACTCTGTATCTGG + Intergenic
981718840 4:147778815-147778837 CAGGGAATGAATTCTGTTGGAGG + Intronic
982135070 4:152267511-152267533 TAGGGAAAGAAGTCAGTAGAAGG - Intergenic
982482574 4:155930140-155930162 TGGGGAATGAGTTCTGTAGCTGG + Intronic
992062828 5:73073193-73073215 CAGGGAATCAAGTTTGGATCAGG - Intronic
993998714 5:94752855-94752877 CAGGGACTGTACTCTGTAACTGG + Intronic
994040593 5:95255582-95255604 CAGGTACTGAAGCCTGAAGCTGG + Intronic
995340363 5:111051805-111051827 TAGGAAATGCAGTCTGTAGCTGG + Intergenic
996445943 5:123550461-123550483 CAGGCAATGTAGTCTTTAGCTGG + Intronic
996550133 5:124721828-124721850 CTCGGAAGGAAGGCTGTAGCAGG + Intronic
999609424 5:153353022-153353044 CAGGCACTGAAGTCTGTGGTTGG + Intergenic
999920312 5:156311214-156311236 CAGGGAATCTAGTCTCAAGCAGG - Intronic
1001840915 5:174875961-174875983 CTGGGAATGAAGCCAGTGGCTGG + Intergenic
1001875609 5:175197826-175197848 CAGGGCATGTGGTGTGTAGCTGG + Intergenic
1005492989 6:26363962-26363984 CAGAGAATGAAGTCAGAAGCAGG - Intergenic
1005502264 6:26439286-26439308 CAGAGAATGAAGTCAGAAGCAGG - Intergenic
1008148736 6:47924077-47924099 CAGGGAATAAAGGATGTAGCCGG - Intronic
1009763825 6:68042027-68042049 AAGGGAATAAAGTCTGTGCCTGG - Intergenic
1012170074 6:96005917-96005939 CAGGAAATGTAGTCTGTAGCTGG - Intergenic
1012798166 6:103790223-103790245 CAGGGAATGAAGGCTGCCTCTGG + Intergenic
1014024512 6:116629850-116629872 TAGGGAGTGAAGAATGTAGCTGG + Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1018127937 6:160699862-160699884 CAGAGACTGAGGTCTGTAGCTGG + Intergenic
1018212426 6:161495430-161495452 CAGGGAATGTAGTCTGTACCTGG - Intronic
1018467625 6:164065210-164065232 AAGGGAATGAAGTCAGTATGTGG + Intergenic
1019278985 7:190965-190987 CAGGGACAGAAGCCTGTGGCAGG - Intergenic
1019316225 7:388212-388234 CAGGAAAGGAAGTCGGTGGCTGG - Intergenic
1021907012 7:25344542-25344564 CAGGAAATGTAGTCTCTACCAGG + Intergenic
1022368008 7:29744093-29744115 CAAGGACTGCACTCTGTAGCAGG + Intergenic
1023257853 7:38329623-38329645 CATGGAATGAATTCTGCTGCAGG + Intergenic
1024614138 7:51093818-51093840 CAGGGATTGAAGGCTGCAGGAGG + Intronic
1027510606 7:79075086-79075108 CATGGAAAGAACTATGTAGCAGG + Intronic
1028585723 7:92449019-92449041 AAGGGAATGAGCTCTGTTGCAGG + Intronic
1040581703 8:48703963-48703985 CAAGGACTGAAGCCTGTTGCAGG + Intergenic
1042967024 8:74364606-74364628 GAGAGAATGAAGTCTGTATAGGG + Exonic
1044759069 8:95497947-95497969 GAAGTACTGAAGTCTGTAGCTGG - Intergenic
1050397852 9:5218498-5218520 CAGGGAATGAAATGTGCAGTAGG + Intergenic
1055577183 9:77671761-77671783 CAGGGAATGAACCCTGGAGGTGG + Intergenic
1056345631 9:85691728-85691750 TAGGGAATTAAGTCTGTACGTGG - Intronic
1056786576 9:89596901-89596923 CTGGGAATGCAGTCTCTGGCTGG + Intergenic
1056792822 9:89637282-89637304 CAGGGAAGGAAGCCCGCAGCCGG - Intergenic
1059819704 9:117958187-117958209 GCTGGAATGAAGTGTGTAGCAGG + Intergenic
1060000959 9:119958312-119958334 CAGAGAATGCTGTATGTAGCAGG - Intergenic
1060090732 9:120740418-120740440 TAGGAAATGTAGCCTGTAGCTGG + Intergenic
1060953187 9:127618128-127618150 CAGGGGATGAAGTGAGTAGAAGG + Intronic
1062702435 9:137914346-137914368 CAGGGTATGAAGTCTGGGGTGGG - Intronic
1203571895 Un_KI270744v1:140053-140075 CAGGGACTGGCGTCTGCAGCGGG - Intergenic
1187855798 X:23635436-23635458 AAGGGGCTAAAGTCTGTAGCAGG - Intergenic
1190277847 X:48910774-48910796 CAGGGACTGAATCCTGTATCAGG + Intronic
1190708834 X:53050877-53050899 CAGGGAAAGAAGACTGGAGTGGG - Intronic
1196410351 X:115411921-115411943 GAGGGAATGAAGTAAGCAGCTGG - Intergenic