ID: 970504369

View in Genome Browser
Species Human (GRCh38)
Location 4:16712183-16712205
Sequence TTAGAGTTCTTTATATATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29776
Summary {0: 5, 1: 271, 2: 1256, 3: 6355, 4: 21889}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970504369_970504372 12 Left 970504369 4:16712183-16712205 CCAGAATATATAAAGAACTCTAA 0: 5
1: 271
2: 1256
3: 6355
4: 21889
Right 970504372 4:16712218-16712240 AGGCAACTCAATTTACAAATGGG 0: 1
1: 3
2: 20
3: 164
4: 681
970504369_970504371 11 Left 970504369 4:16712183-16712205 CCAGAATATATAAAGAACTCTAA 0: 5
1: 271
2: 1256
3: 6355
4: 21889
Right 970504371 4:16712217-16712239 AAGGCAACTCAATTTACAAATGG 0: 1
1: 3
2: 15
3: 120
4: 635
970504369_970504370 -8 Left 970504369 4:16712183-16712205 CCAGAATATATAAAGAACTCTAA 0: 5
1: 271
2: 1256
3: 6355
4: 21889
Right 970504370 4:16712198-16712220 AACTCTAACTCAACAATAAAAGG No data
970504369_970504373 18 Left 970504369 4:16712183-16712205 CCAGAATATATAAAGAACTCTAA 0: 5
1: 271
2: 1256
3: 6355
4: 21889
Right 970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG 0: 2
1: 24
2: 233
3: 766
4: 2258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970504369 Original CRISPR TTAGAGTTCTTTATATATTC TGG (reversed) Intronic
Too many off-targets to display for this crispr